Unveiling the dynamic expression of PR-1 during Musa spp. infection by Fusarium oxysporum fsp. Cubense: a cloning and characterization study.

BACKGROUND: Pathogen-related proteins (PR) are pivotal in plant defense, combating diverse biotic and abiotic stresses. While multiple gene families contribute to banana resistance against Fusarium oxysporum f sp. cubense (Foc), Pseudocercospora eumusae, and Pratylenchus coffeae, the significance of PR-1 genes in defense is paramount. METHODS: Three PR-1 genes, up-regulated under diverse biotic stresses, were cloned from both resistant and susceptible cultivars of Foc, P. eumusae, and P. coffeae. Molecular characterization, phylogenetic analysis, and docking studies with the Foc TR4 CP gene were conducted. RESULTS: Through transcriptomic and real-time studies, three PR-1 genes (Ma02_g15050, Ma02_g15060, and Ma04_g34800) from Musa spp. were identified. These genes exhibited significant up-regulation in resistant cultivars when exposed to Foc, P. eumusae, and P. coffeae. Cloning of these genes was successfully performed from both resistant and susceptible cultivars of Foc race 1 and TR4, P. eumusae, and P. coffeae. Distinct characteristics were observed among the PR-1 genes, with groups 1 and 2 being acidic with signal peptides, and group 3 being basic without signal peptides. All cloned PR-1 proteins belonged to the CAP superfamily (PF00188). Phylogenetic analysis revealed clustering patterns for acidic PR-1 proteins, and KEGG orthology showed associations with vital pathways, including MAPK signaling, plant hormone signal transduction, and plant-pathogen interaction. Secondary and tertiary structure analyses confirmed sequence conservation across studied species. Docking studies explored interactions between the cerato-platanin (CP) gene from Foc TR4 and Ma02_g15060 from banana, suggesting the potential hindrance of PR-1 antifungal activity through direct interaction. CONCLUSIONS: The findings underscore the crucial role of cloned PR-1 genes in banana plant defense mechanisms against a broad spectrum of biotic stresses. These genes, especially those in groups 1 and 2, hold promise as candidates for developing stress-tolerant banana cultivars. The study provides valuable insights into the molecular aspects of banana defense strategies, emphasizing the potential applications of PR-1 genes in enhancing banana resilience.

Emerging and Re-Emerging Diseases Caused by Badnaviruses.

New and emerging plant diseases are caused by different pathogens including viruses that often cause significant crop losses. Badnaviruses are pararetroviruses that contain a single molecule of ds DNA genome of 7 to 9 kb in size and infect a large number of economically important crops such as banana and plantains, black pepper, cacao, citrus, grapevine, pineapple, sugarcane, sweet potato, taro, and yam, causing significant yield losses. Many of the species in the genus have a restricted host range and several of them are known to infect a single crop. Combined infections of different virus species and strains offer conditions that favor the development of new strains via recombination, especially in vegetatively propagated crops. The primary spread of badnaviruses is through vegetative propagating materials while for the secondary spread, they depend on insects such as mealybugs and aphids. Disease emerges as a consequence of the interactions between host and pathogens under favorable environmental conditions. The viral genome of the pararetroviruses is known to be integrated into the chromosome of the host and a few plants with integrants when subjected to different kinds of abiotic stress will give rise to episomal forms of the virus and cause disease. Attempts have been made to develop management strategies for badnaviruses both conventionally and using precision breeding techniques such as genome editing. Until 2016 only 32 badnavirus species infecting different crops were known, but in a span of six years, this number has gone up to 68. The current review highlights the emerging disease problems and management options for badnaviruses infecting economically important crops.

Insights into the capsid structure of banana bunchy top virus.

Banana is the major staple food crop for approximately 400 million people. Bunchy top disease of banana is one of the most devastating diseases caused by banana bunchy top virus (BBTV), which results in stunting of plants, bunchy appearance of leaves and a significant loss of yield. While many isolates of BBTV from various regions of India have been characterized by different groups, no structural study exists for this important virus. To bridge this gap, the pET28a clone of the coat protein (CP) gene from BBTV isolate of Hill banana grown in lower Pulney Hills (Virupakshi) of Tamilnadu was expressed in BL21 (DE3) pLysS. Purification of the CP was achieved by Ni-NTA affinity chromatography. In vitro capsid assembly studied using sucrose density gradient centrifugation suggested that the CP did not assemble as a virus-like particle (VLP), but remained as smaller oligomers. Studies using dynamic light scattering (DLS) indicate that the purified protein is poly-dispersed, represented majorly as pentamers. Homology modeling studies provided useful insights into the probable fold of the CP suggesting that it is a ß-sandwich, similar to that seen in the majority of plant viruses. In silico capsid reconstruction aided the understanding of the quaternary organization of subunits in the capsid and their molecular interactions. The location of the aphid-binding EAG motif was identified on the surface loops close to the pentameric axis indicating its role in vector-mediated transmission. Comparison with the CP and capsid structure of geminiviruses provided useful insights into the mode of nucleic acid binding and the role of genome during capsid assembly. Supplementary Information: The online version contains supplementary material available at 10.1007/s13205-022-03204-4.

First report of rhizome rot of banana caused by Klebsiella variicola in India.

Rhizome rot or soft rot disease is one of the major problems in banana (Musa spp.) cultivation, as it causes germination failure and death of early stage plants. A roving survey conducted during 2017 to 2019 in the major banana growing states of India indicated a 5-30% incidence of rhizome rot in commercial cultivars. The symptoms observed were yellowing of leaves, necrotic drying with or without heart rot, and yellow or brown water soaked spots with dark brown margins in the rhizomes. Decay of tissues, cavity formation and brown ooze with foul smell, and toppling were also observed. To isolate bacteria, dissected diseased tissues were surface sterilized and plated on Crystal Violet Pectate (CVP) medium. Of 60 samples plated on CVP medium, three samples collected from cvs. NeyPoovan-AB (Karur, Tamil Nadu, 10°56'36.8"N;78°24'12.5"E), Grand Naine-AAA (Tiruchirappalli, Tamil Nadu, 10°47'26.1"N;78°34'14.8"E) and Thellachakkarakeli-AAA (East-Godavari, Andhra Pradesh, 16°51'32.1"N;81°46'08.4"E), did not yield any bacteria; however, when plated on nutrient agar, they produced whitish to dull white, mucoid, raised, round and translucent colonies, and three isolates were named as NPK-3-48, GTC-5 and 1-1B-3, respectively. Because these colonies were distinct from colonies obtained on CVP medium (which were analyzed and confirmed separately as Pectobaterium sp.) (Gokul et al. 2019), they were further characterized. Amplification of 16S rDNA genes of NPK-3-48, GTC-5 and 1-1B-3 isolates using universal primers (27F 5' - AGAGTTTGATCCTGGCTCAG - 3'; 1492 R 5' - GGTTACCTTGTTACGACTT - 3') and rpoB gene (Rosenblueth et al. 2004) was carried; the amplicons were sequenced and deposited in NCBI (Accessions MW036529-MW036531; MW497572-MW497574). Phylogenetic analysis of rpoB clearly showed that the isolates NPK-3-48, GTC-5, 1-1B-3 are Klebsiella variicola (Rosenblueth et al. 2004) Besides, biochemical tests also indicated that all three isolates were Gram negative, catalase positive, oxidase negative and able to utilize glucose, maltose and citrate (Ajayasree and Borkar 2018). Therefore, the above said morphological, molecular and biochemical analyses carried out indicated that NPK-3-48, GTC-5, 1-1B-3 are of K. variicola. Earlier, K. variicola causing soft rot has been reported on banana in China (Fan et al. 2016), plantain soft rot in Haiti (Fulton et al. 2020) and carrot soft rot in India (Chandrashekar et al. 2018). For pathogenicity tests, these three isolates were grown in nutrient broth for 48 h at 37±1°C and the cells were harvested by centrifugation. Five milliliters of the culture suspension (2×108 CFUmL-1) taken in a syringe was injected into rhizomes of three month old tissue cultured Grand Naine plants. Each bacterial isolate was injected into eight banana plants at soil level. Appropriate controls were maintained. Inoculated plants were maintained in a glasshouse at 32±2°C and after 30-35 days, rhizome rot symptoms appeared in all the three bacterial isolates inoculated plants but in none of the control plants. The Koch's postulates were proved by re-isolation and identification.To the best of our knowledge, this is the first report of K. variicola causing rhizome rot disease of banana in India.

A rapid and sensitive lateral flow immunoassay (LFIA) test for the on-site detection of banana bract mosaic virus in banana plants.

Banana bract mosaic virus (BBrMV) is a serious pathogen threatening the cultivation of banana and plantain worldwide. This study reports the development of a practical, rapid, sensitive, specific and user-friendly lateral flow immunoassay (LFIA) test for the on-site detection of BBrMV. The BBrMV coat protein (CP) was expressed in Escherichia coli and purified and used to immunize rabbits to produce a polyclonal antiserum (anti-BBrMVCP). The test was based on a double-antibody sandwich format. Protein-A affinity column-purified anti-BBrMVCP Immunoglobulins (IgG) (16 µg/mL), conjugated to ∼30 nm gold nanoparticles, was applied onto the conjugate pad. The anti-BBrMVCP IgG and goat anti-rabbit IgG were printed on the surface of a nitrocellulose filter membrane as the test line and control line, respectively. A positive result could be confirmed visually by the presence of a pink band that developed on the LFIA strip within 5-10 min. The detection limit of the test was 10 ng of the expressed recombinant BBrMV CP (rBBrMVCP), and a 1:20 dilution of the BBrMV-infected crude extract. This LFIA test was validated using 114 banana leaf samples randomly collected from the field and the results indicated a very high diagnostic sensitivity (99.04 %) and specificity (100 %) for the test. A Cohen's kappa coefficient of 0.861 obtained also indicated a very good agreement between the LFIA developed in this study and ELISA. This assay could be adopted by farmers, tissue culture industries and quarantine departments for surveys and surveillance. This is the first report on the development of a LFIA-based test for BBrMV detection.

Virus titre determines the efficiency of Pentalonia nigronervosa (Aphididae: Hemiptera) to transmit banana bunchy top virus.

Banana bunchy top disease (BBTD) caused by banana bunchy top virus (BBTV) is one of the most serious viral diseases of banana and plantains. BBTV is transmitted by Pentalonia nigronervosa (Hemiptera, Aphididae) in a persistent circulative manner. Better knowledge of vector-virus-host relationship and the mechanism of transmission is essential for developing an effective control strategy. In this study, the viral copies in single to group of aphids with different acquisition access period (AAP) were quantified using SYBR green-based quantitative polymerase chain reaction (qPCR). The result indicated that a single aphid was able to acquire 861.04 copies of the virus after 24 h of AAP from the infected banana plant and transmitted the virus to 16.6% tissue culture plants, whereas 50 viruliferous aphids (15,066.94 viral copies) were necessary to achieve 100% transmission in a shortest time of 21.6 days. The number of viral copies acquired by the aphids were gradually increased with increased AAP. Hundred percent transmission was observed with 20 aphids in 48 h of AAP or 30-50 aphids in 24 h of AAP. The inoculated plants expressed typical bunchy top symptoms quickly when higher number of aphids (30 and above) were used with 24 h of AAP. Further, we report that the tissue culture banana plants are highly prone or vulnerable to BBTV infection compared to sucker grown plants. We conclude that higher the number of viral copies in the vector, higher the percent transmission and quicker the symptom expression and the results will contribute to a better understanding of vector-BBTV interactions and useful for epidemiological studies.

RNA Dependent RNA Polymerases: Insights from Structure, Function and Evolution.

RNA dependent RNA polymerase (RdRp) is one of the most versatile enzymes of RNA viruses that is indispensable for replicating the genome as well as for carrying out transcription. The core structural features of RdRps are conserved, despite the divergence in their sequences. The structure of RdRp resembles that of a cupped right hand and consists of fingers, palm and thumb subdomains. The catalysis involves the participation of conserved aspartates and divalent metal ions. Complexes of RdRps with substrates, inhibitors and metal ions provide a comprehensive view of their functional mechanism and offer valuable insights regarding the development of antivirals. In this article, we provide an overview of the structural aspects of RdRps and their complexes from the Group III, IV and V viruses and their structure-based phylogeny.

Badnaviruses: The Current Global Scenario.

Badnaviruses (Family: Caulimoviridae; Genus: Badnavirus) are non-enveloped bacilliform DNA viruses with a monopartite genome containing about 7.2 to 9.2 kb of dsDNA with three to seven open reading frames. They are transmitted by mealybugs and a few species by aphids in a semi-persistent manner. They are one of the most important plant virus groups and have emerged as serious pathogens affecting the cultivation of several horticultural crops in the tropics, especially banana, black pepper, cocoa, citrus, sugarcane, taro, and yam. Some badnaviruses are also known as endogenous viruses integrated into their host genomes and a few such endogenous viruses can be awakened, e.g., through abiotic stress, giving rise to infective episomal forms. The presence of endogenous badnaviruses poses a new challenge for the fool-proof diagnosis, taxonomy, and management of the diseases. The present review aims to highlight emerging disease problems, virus characteristics, transmission, and diagnosis of badnaviruses.

Biology, etiology, and control of virus diseases of banana and plantain.

Banana and plantain (Musa spp.), produced in 10.3 million ha in the tropics, are among the world's top 10 food crops. They are vegetatively propagated using suckers or tissue culture plants and grown almost as perennial plantations. These are prone to the accumulation of pests and pathogens, especially viruses which contribute to yield reduction and are also barriers to the international exchange of germplasm. The most economically important viruses of banana and plantain are Banana bunchy top virus (BBTV), a complex of banana streak viruses (BSVs) and Banana bract mosaic virus (BBrMV). BBTV is known to cause the most serious economic losses in the "Old World," contributing to a yield reduction of up to 100% and responsible for a dramatic reduction in cropping area. The BSVs exist as episomal and endogenous forms are known to be worldwide in distribution. In India and the Philippines, BBrMV is known to be economically important but recently the virus was discovered in Colombia and Costa Rica, thus signaling its spread into the "New World." Banana and plantain are also known to be susceptible to five other viruses of minor significance, such as Abaca mosaic virus, Abaca bunchy top virus, Banana mild mosaic virus, Banana virus X, and Cucumber mosaic virus. Studies over the past 100 years have contributed to important knowledge on disease biology, distribution, and spread. Research during the last 25 years have led to a better understanding of the virus-vector-host interactions, virus diversity, disease etiology, and epidemiology. In addition, new diagnostic tools were developed which were used for surveillance and the certification of planting material. Due to a lack of durable host resistance in the Musa spp., phytosanitary measures and the use of virus-free planting material are the major methods of virus control. The state of knowledge on BBTV, BBrMV, and BSVs, and other minor viruses, disease spread, and control are summarized in this review.

Development of Agrobacterium-mediated transformation of highly valued hill banana cultivar Virupakshi (AAB) for resistance to BBTV disease.

One of the most severe viral diseases of hill banana is caused by banana bunchy top virus (BBTV), a nanovirus transmitted by the aphid Pentalonia nigronervosa. In this study, we reported the Agrobacterium-mediated transformation on a highly valued hill banana cultivar Virupakshi (AAB) for resistance to BBTV disease. The target of the RNA interference (RNAi) is the rep gene, encoded by the BBTV-DNA1. In order to develop RNAi construct targeting the BBTV rep gene, the full-length rep gene of 870 bp was polymerase chain reaction amplified from BBTV infected hill banana sample DNA, cloned and confirmed by DNA sequencing. The partial rep gene fragment was cloned in sense and anti sense orientation in the RNAi intermediate vector, pSTARLING-A. After cloning in pSTARLING-A, the cloned RNAi gene cassette was released by NotI enzyme digestion and cloned into the NotI site of binary vector, pART27. Two different explants, embryogenic cells and embryogenic cell suspension derived microcalli were used for co-cultivation. Selection was done in presence of 100 mg/L kanamycin. In total, 143 putative transgenic hill banana lines were generated and established in green house condition. The presence of the transgenes was confirmed in the selected putative transgenic hill banana lines by PCR and reverse transcription PCR analyses. Transgenic hill banana plants expressing RNAi-BBTV rep were obtained and shown to resist infection by BBTV. The transformed plants are symptomless, and the replication of challenge BBTV almost completely suppressed. Hence, the RNAi mediating resistances were shown to be effective management of BBTV in hill banana.