First Report of Rice yellow mottle virus on Rice in the Democratic Republic of Congo.

Rice yellow mottle virus (RYMV), genus Sobemovirus, is a widespread rice pathogen reported in nearly all rice-growing countries of Africa. Although the virus was detected in Cameroon, Chad, Tanzania, Rwanda, Burundi, and Uganda (2,3), RYMV has never been described in the Democratic Republic of Congo (DRC). In July 2012, plants with leaf yellowing and mottling symptoms were observed in large irrigated rice production schemes 30 km south of Bukavu, in eastern DRC, and in lowland subsistence fields in the surroundings of Bukavu. Several dozen hectares affected by the disease were abandoned by the farmers. Symptomatic leaf samples were collected in different farmer fields. Back-inoculations to susceptible rice variety IR64 resulted in the same yellowing and mottling symptoms 7 to 9 days post-inoculation. Infected leaves gave positive results using double antibody sandwich (DAS)-ELISA tests with polyclonal antisera (as described in [1]), indicating for the first time the presence of RYMV in DRC. Triple antibody sandwich (TAS)-ELISA tests with discriminant monoclonal antibodies (1) revealed that they all belong to serotype 4 found in the neighboring region in Rwanda. Total RNA of three samples from South Kivu was extracted with the RNeasy Plant Mini kit (Qiagen, Germany). The 720 nucleotide coat protein (CP) gene was amplified by reverse transcription (RT)-PCR with primers 5'CTCCCCCACCCATCCCGAGAATT3' and 5'CAAAGATGGCCAGGAA3' (1). The sequences were deposited in GenBank (Accessions KC788208, KC788209, and KC788210). A set of CP sequences of 45 isolates representative of the RYMV diversity in Africa, including the sequences of the DRC samples, were used for phylogenetic reconstruction by maximum-likelihood method. The isolates from South Kivu belonged to strain S4-lv, mainly found around Lake Victoria. Specifically, within the S4-lv strain, the South Kivu isolates clustered with isolates from eastern and southern provinces of Rwanda and Burundi, respectively (2), suggesting a recent spread from these countries. Recently, efforts have been directed to shift from the traditional upland system to lowland and irrigated systems in which water availability allows sequential planting and maintenance of higher crop intensity. This agricultural change may increase insect vectors and alternate host plant populations which may result in higher RYMV incidence in DRC (3). Similar yellowing and mottling symptoms have been observed in Bas-Congo and Equateur provinces of the country, which would justify further surveys and characterisation of RYMV in the DRC. References: (1) D. Fargette et al. Arch. Virol. 147:583, 2002. (2) I. Ndikumana et al. Plant Dis. 96:1230, 2012. (3) O. Traoré et al. Mol. Ecol. 14:2097, 2005.

Magnaporthe oryzae populations adapted to finger millet and rice exhibit distinctive patterns of genetic diversity, sexuality and host interaction.

In this study, host-specific forms of the blast pathogen Magnaporthe oryzae in sub-Saharan Africa (SSA) were characterised from distinct cropping locations using a combination of molecular and biological assays. Finger millet blast populations in East Africa revealed a continuous genetic variation pattern and lack of clonal lineages, with a wide range of haplotypes. M. oryzae populations lacked the grasshopper (grh) element (96%) and appeared distinct to those in Asia. An overall near equal distribution (47-53%) of the mating types MAT1-1 and MAT1-2, high fertility status (84-89%) and the dominance of hermaphrodites (64%) suggest a strong sexual reproductive potential. Differences in pathogen aggressiveness and lack of cultivar incompatibility suggest the importance of quantitative resistance. Rice blast populations in West Africa showed a typical lineage-based structure. Among the nine lineages identified, three comprised ~90% of the isolates. Skewed distribution of the mating types MAT1-1 (29%) and MAT1-2 (71%) was accompanied by low fertility. Clear differences in cultivar compatibility within and between lineages suggest R gene-mediated interactions. Distinctive patterns of genetic diversity, sexual reproductive potential and pathogenicity suggest adaptive divergence of host-specific forms of M. oryzae populations linked to crop domestication and agricultural intensification.

Recombination, selection and clock-like evolution of Rice yellow mottle virus.

The clock-like diversification of Rice yellow mottle virus (RYMV), a widespread RNA plant virus that infects rice in Africa, was tested following a three-step approach with (i) an exhaustive search of recombinants, (ii) a comprehensive assessment of the selective constraints over lineages, and (iii) a stepwise series of tests of the molecular clock hypothesis. The first evidence of recombination in RYMV was found in East Africa, in the region most favorable to co-infection. RYMV evolved under a pronounced purifying selection, but the selection pressure did vary among lineages. There was no phylogenetic evidence of transient deleterious mutations. ORF2b, which codes for the polymerase and is the most constrained ORF, tends to diversify clock-like. With the other ORFs and the full genome, the departure from the strict clock model was limited. This likely reflects the dominant conservative selection pressure and the clock-like fixation of synonymous mutations.

A reassessment of the epidemiology of Rice yellow mottle virus following recent advances in field and molecular studies.

The available knowledge on the epidemiology of Rice yellow mottle virus (RYMV) is reassessed in the light of major advances in field and molecular studies of the disease it causes in rice. Previously un-described means of transmission by mammals and through leaf contact have been discovered recently. Several agricultural practices, including the use of seedbed nurseries, have also contributed to a massive build-up of RYMV inoculum. Phytosanitation is now known to be critical to reduce disease incidence in rice. A new model of the ecology of RYMV in which man plays a central role has emerged. Furthermore, estimates of the evolutionary rate of change of RYMV provided a time-frame for its epidemiology, the first attempt for a plant virus. Earlier interpretations of the patterns of virus diversity which assumed a long-term evolution, and assigned a major role to adaptive events had to be discarded. In contrast, a wave-like model of dispersal of RYMV, which postulates its initial diversification in East Africa, followed by westward spread across the continent, was developed, refined and dated. The most salient -- and largely unexpected -- finding is that RYMV emerged recently and subsequently spread rapidly throughout Africa in the last two centuries. Diversification and spread of RYMV has been concomitant with an extension of rice cultivation in Africa since the 19th century. This major agro-ecological change increased the encounters between primary hosts of RYMV and cultivated rice. It also modified the landscape ecology in ways that facilitated virus spread.

Rice yellow mottle virus, an RNA plant virus, evolves as rapidly as most RNA animal viruses.

The rate of evolution of an RNA plant virus has never been estimated using temporally spaced sequence data, by contrast to the information available on an increasing range of animal viruses. Accordingly, the evolution rate of Rice yellow mottle virus (RYMV) was calculated from sequences of the coat protein gene of isolates collected from rice over a 40-year period in different parts of Africa. The evolution rate of RYMV was estimated by pairwise distance linear regression on five phylogeographically defined groups comprising a total of 135 isolates. It was further assessed from 253 isolates collected all over Africa by Bayesian coalescent methods under strict and relaxed molecular clock models and under constant size and skyline population genetic models. Consistent estimates of the evolution rate between 4 x 10(-4) and 8 x 10(-4) nucleotides (nt)/site/year were obtained whatever method and model were applied. The synonymous evolution rate was between 8 x 10(-4) and 11 x 10(-4) nt/site/year. The overall and synonymous evolution rates of RYMV were within the range of the rates of 50 RNA animal viruses, below the average but above the distribution median. Experimentally, in host change studies, substitutions accumulated at an even higher rate. The results show that an RNA plant virus such as RYMV evolves as rapidly as most RNA animal viruses. Knowledge of the molecular clock of plant viruses provides methods for testing a wide range of biological hypotheses.

First Report of Rice yellow mottle virus in Rice in The Gambia.

Rice yellow mottle virus (RYMV) of the genus Sobemovirus is a major biotic constraint to rice (Oryza sativa) production in Africa. First reported in Kenya during 1966, RYMV was later found in most countries in Africa where rice is grown (1). In countries in westernmost Africa (The Gambia, Guinea-Bissau, Mauritania, and Senegal), plants with leaf yellowing and mottling symptoms were observed, but RYMV was never isolated. Rice is the staple food in The Gambia. In 2006, four samples were collected from local rice varieties in the Kuntaur Region in the center of The Gambia. Mechanical inoculation with leaf extracts from all samples caused typical yellow mottle symptoms on the susceptible rice varieties BG90-2, Bouaké 189, and IR64. RYMV was detected in the four samples collected by ELISA with polyclonal antisera (2). The 720-nt coat protein gene was amplified for each isolate by reverse-transcriptase-PCR with primers 5'-CAAAGATGGCCAGGAA-3' (sense) and 5'-CTCCCCCACCCATCCCGAGAATT-3' (antisense) (2). The RT-PCR products were directly sequenced (EMBL Accession Nos. AM765810, AM765811, AM765812, and AM765813) and then aligned using ClustalW with a pool of RYMV coat protein sequences from West African isolates (EMBL Accession Nos. AJ279905, AJ279901, AJ885137, AJ885124, and AJ279935). Phylogenetic reconstruction by maximum-likelihood with PAUP indicated that the isolates from The Gambia formed a monophyletic group with over 97% nucleotide identity and are closely related to isolates of other countries in West Africa (Burkina Faso, Côte d'Ivoire, Guinea, Mali, and Sierra-Leone) with 91 to 94% identity. Detection of RYMV in The Gambia indicates that RYMV is present in westernmost Africa, which is referred to as the 'rice belt' of Africa, and shows that RYMV is widely distributed from eastern Africa (Tanzania) to the western part of the continent. References: (1) N. K. Kouassi et al. Plant Dis. 89:124, 2005. (2) A. Pinel et al. Arch. Virol. 145:1621, 2000.

Processes of diversification and dispersion of rice yellow mottle virus inferred from large-scale and high-resolution phylogeographical studies.

Phylogeography of Rice yellow mottle virus (RYMV) was reconstructed from the coat protein gene sequences of a selection of 173 isolates from the 14 countries of mainland Africa where the disease occurred and from the full sequences of 16 representative isolates. Genetic variation was linked to geographical distribution and not to host species as isolates from wild rice always clustered with isolates from cultivated rice of the same region. Genetic variation was not associated to agro-ecology, viral interference and insect vector species. Distinct RYMV lineages occurred in East, Central and West Africa, although the Central African lineage included isolates from Benin, Togo and Niger at the west, adjacent to countries of the West African lineage. Genetic subdivision at finer geographical scales was apparent within lineages of Central and West Africa, although less pronounced than in East Africa. Physical obstacles, but also habitat fragmentation, as exemplified by the small low-lying island of Pemba offshore Tanzania mainland, explained strain localization. Three new highly divergent strains were found in eastern Tanzania. By contrast, intensive surveys in Cote d'Ivoire and Guinea at the west of Africa did not reveal any new variant. Altogether, this supported the view that the Eastern Arc Mountains biodiversity hotspot was the centre of origin of RYMV and that the virus spread subsequently from east to west across Africa. In West Africa, specific strains occurred in the Inner Niger Delta and suggested it was a secondary centre of diversification. Processes for diversification and dispersion of RYMV are proposed.