Targeting duplex DNA with chimeric α,ß-triplex-forming oligonucleotides.

Triplex-directed DNA recognition is strictly limited by polypurine sequences. In an attempt to address this problem with synthetic biology tools, we designed a panel of short chimeric α,ß-triplex-forming oligonucleotides (TFOs) and studied their interaction with fluorescently labelled duplex hairpins using various techniques. The hybridization of hairpin with an array of chimeric probes suggests that recognition of double-stranded DNA follows complicated rules combining reversed Hoogsteen and non-canonical homologous hydrogen bonding. In the presence of magnesium ions, chimeric TFOs are able to form highly stable α,ß-triplexes, as indicated by native gel-electrophoresis, on-array thermal denaturation and fluorescence-quenching experiments. CD spectra of chimeric triplexes exhibited features typically observed for anti-parallel purine triplexes with a GA or GT third strand. The high potential of chimeric α,ß-TFOs in targeting double-stranded DNA was demonstrated in the EcoRI endonuclease protection assay. In this paper, we report, for the first time, the recognition of base pair inversions in a duplex by chimeric TFOs containing α-thymidine and α-deoxyguanosine.

Conformational changes induced in the human protein translin and in the single-stranded oligodeoxynucleotides d(GT)(12) and d(TTAGGG)(5) upon binding of these oligodeoxynucleotides by translin.

Translin is a human single-stranded DNA and RNA binding protein that has been highly conserved in eukaryotic evolution. It consists of eight subunits having a highly helical secondary structure that assemble into a ring. The DNA and the RNA are bound inside the ring. Recently, some of us demonstrated that the human translin specifically binds the single-stranded microsatellite repeats, d(GT)(n), the human telomeric repeats, d(TTAGGG)(n), and the Tetrahymena telomeric repeats, d(GGGGTT)(n). These data suggested that translin might be involved in recombination at d(GT)(n).d(AC)(n) microsatellites and in telomere metabolism. Other data indicated that translin might stimulate binding of telomerase to single-stranded telomeric overhangs by unwinding secondary structures formed by the telomeric repeats. Here we present a circular dichroism (CD) analysis of complexes formed between the human translin and the microsatellite and telomeric oligodeoxynucleotides d(GT)(12) and d(TTAGGG)(5). We report that conformational changes occur in both the translin and the oligodeoxynucleotides upon formation of the complexes. In translin octamers bound to the oligodeoxynucleotide d(GT)(12), the fraction of alpha-helices decreases from approximately 67% to approximately 50%, while the fraction of turns and of the unordered structure increases from approximately 11% to approximately 17% and from approximately 19% to approximately 24%, respectively. In the bound oligodeoxynucleotide d(GT)(12), we observed CD shifts which are consistent with a decrease of base stacking and a putative anti-syn switch of some guanines. The oligodeoxynucleotide d(TTAGGG)(5) formed intramolecular quadruplexes under the conditions of our assays and translin was found to unfold the quadruplexes into structures consisting of a single hairpin and three unwound single-stranded d(TTAGGG) repeats. We suggest that such unfolding could account for the stimulation of telomerase activity by translin mentioned above.

Parallel DNA double helices incorporating isoG or m5isoC bases studied by FTIR, CD and molecular modeling.

FTIR spectroscopy has been used to follow the formation of parallel stranded DNA duplexes incorporating isoG or m5isoC bases and determine their base pairing scheme. The results are discussed in comparison with data concerning anti-parallel duplexes with comparable base composition and sequence. In duplexes containing A-T and isoG-C or m5isoC-G base pairs shifts of the thymine C2=O2 and C4=O4 carbonyl stretching vibrations (to lower and higher wavenumbers, respectively, when compared to their positions in classical cis Watson-Crick (WC) base pairs) reflect the formation of trans Watson-Crick A-T base pairs. All carbonyl groups of cytosines, m5isocytosines, guanines and isoguanines are found to be involved in hydrogen bonds, indicative of the formation of isoG-C and m5isoC-G base pairs with three hydrogen bonds. Molecular modeling shows that both structures form regular right handed helices with C2'endo sugar puckers. The role of the water content on the helical conformation of the parallel duplexes has been studied by FTIR and CD. It is found that a conformational transition similar to the B --> A transition observed for anti-parallel duplexes induced by a decrease of the water content of the samples can occur for these parallel duplexes. Their helical flexibility has been evidenced by FTIR studies on hydrated films by the emergence of absorption bands characteristic of A type geometry, in particular by an S-type --> N-type repuckering of the deoxyribose. All sugars in the parallel duplex with alternating d(isoG-A)/d(C-T) sequence can adopt an N-type geometry in low water content conditions. The conformational transition of the parallel hairpin duplex with alternating d(isoG-A)/d(C-T) sequence was followed by circular dichroism in water/trifluoroethanol solutions and its free energy at 0 degrees C was estimated to be 6.6 +/- 0.3 kcal mol(-1).

Fluorescent 2-pyrimidinone nucleoside in parallel-stranded DNA.

Stretches of parallel-stranded (ps) double-helical DNA can arise within antiparallel-stranded (aps) Watson-Crick DNA in looped structures or in the presence of sequence mismatches. Here we studied an effect of a pyrimidinone-G (PG) base pair on the stability and conformation of the ps DNA to explore whether P is useful as a structural probe.

The telomeric dG(GT)4G sequence can adopt a parallel-stranded double helical conformation.

Oligonucleotides 3'-d(GTGTGTGTGG)-L-d(GGTGTGTGTG)-3' (hp-GT) and 3'-d(G4STG4TG4STG4STGG)-L-d(GGTGTGTGTG)-3' (hp-SGT), (L=(CH2CH2O)3), were shown by use of several optical techniques to form a novel parallel-stranded (ps) intramolecular double helix with purine-purine and pyrimidine-pyrimidine base pairing. The rotational relaxation time of hp-GT was similar to that of a 10-bp reference duplex, and the fraction of unpaired bases was determined to be approximately 7%, testifying to the formation of an intramolecular double helical hairpin by the sequence under the given experimental conditions. A quasi-two-state mode of ps-double helix formation was validated, yielding a helix-coil transition enthalpy of -135 +/- 5 kJ/mol. The G x G and T x T (or 4ST x T) base pair configurations and conformational parameters of the double helix were derived with molecular modeling by force field techniques. Repetitive d(GT) sequences are abundant in telomers of different genomes and in the regulatory regions of genes. Thus, the observed conformational potential of the repetitive d(GT) sequence may be of importance in the regulation of cell processes.

Protein-free parallel triple-stranded DNA complex formation.

A 14 nt DNA sequence 5'-AGAATGTGGCAAAG-3' from the zinc finger repeat of the human KRAB zinc finger protein gene ZNF91 bearing the intercalator 2-methoxy,6-chloro,9-amino acridine (Acr) attached to the sugar-phosphate backbone in various positions has been shown to form a specific triple helix (triplex) with a 16 bp hairpin (intramolecular) or a two-stranded (intermolecular) duplex having the identical sequence in the same (parallel) orientation. Intramolecular targets with the identical sequence in the antiparallel orientation and a non-specific target sequence were tested as controls. Apparent binding constants for formation of the triplex were determined by quantitating electrophoretic band shifts. Binding of the single-stranded oligonucleotide probe sequence to the target led to an increase in the fluorescence anisotropy of acridine. The parallel orientation of the two identical sequence segments was confirmed by measurement of fluorescence resonance energy transfer between the acridine on the 5'-end of the probe strand as donor and BODIPY-Texas Red on the 3'-amino group of either strand of the target duplex as acceptor. There was full protection from OsO(4)-bipyridine modification of thymines in the probe strand of the triplex, in accordance with the presumed triplex formation, which excluded displacement of the homologous duplex strand by the probe-intercalator conjugate. The implications of these results for the existence of protein-independent parallel triplexes are discussed.

Parallel-stranded DNA with mixed AT/GC composition: role of trans G.C base pairs in sequence dependent helical stability.

Parallel-stranded (ps) DNAs with mixed AT/GC content comprising G.C pairs in a varying sequence context have been investigated. Oligonucleotides were devised consisting of two 10-nt strands complementary either in a parallel or in an antiparallel orientation and joined via nonnucleotide linkers so as to form 10-bp ps or aps hairpins. A predominance of intramolecular hairpins over intermolecular duplexes was achieved by choice of experimental conditions and verified by fluorescence determinations yielding estimations of rotational relaxation times and fractional base pairing. A multistate mode of ps hairpin melting was revealed by temperature gradient gel electrophoresis (TGGE). The thermal stability of the ps hairpins with mixed AT/GC content depends strongly on the specific sequence in a manner peculiar to the ps double helix. The thermodynamic effects of incorporating trans G.C base pairs into an AT sequence are context-dependent: an isolated G. C base pair destabilizes the duplex whereas a block of > or =2 consecutive G.C base pairs exerts a stabilizing effect. A multistate heterogeneous zipper model for the thermal denaturation of the hairpins was derived and used in a global minimization procedure to compute the thermodynamic parameters of the ps hairpins from experimental melting data. In 0.1 M LiCl at 3 degrees C, the formation of a trans G.C pair in a GG/CC sequence context is approximately 3 kJ mol(-)(1) more favorable than the formation of a trans A.T pair in an AT/TA sequence context. However, GC/AT contacts contribute a substantial unfavorable free energy difference of approximately 2 kJ mol(-)(1). As a consequence, the base composition and fractional distribution of isolated and clustered G.C base pairs determine the overall stability of ps-DNA with mixed AT/GC sequences. Thus, the stability of ps-DNA comprising successive > or =2 G.C base pairs is greater than that of ps-DNA with an alternating AT sequence, whereas increasing the number of AT/GC contacts by isolating G.C base pairs exerts a destabilizing effect on the ps duplex. Molecular modeling of the various helices by force field techniques provides insight into the structural basis for these distinctions.

Structural polymorphism of oligo(dC) with mixed alpha,beta-anomeric backbone.

Oligonucleotides with mixed alpha,beta-anomeric backbone have been proposed recently for the recognition of random DNA sequence via new triplex motif (Doronina and Behr, Chem. Soc. Reviews 26, 63-71 (1997)). In the present work we examined alpha- and beta- anomers of cytidine as possible candidates to recognize AT and TA base pairs of the double stranded DNA. The binding properties of beta-oligo(dC) were studied on a series of synthetic oligodeoxynucleotides by UV absorbtion spectroscopy, measurements of bound EtBr fluorescence polarization, circular dichroism (CD) and non-denaturing gel electrophoresis. The UV thermal denaturation, polarization studies and CD experiments with three stranded oligonucleotide 5'-((dCalpha) (dCbeta))5-L-(dAT)5-L-(dAT)5 (L = triethyleneglycol linker) and other oligonucleotide models showed that the formation of semiprotonated oligocytidilic complexes takes place at low temperatures and neutral pH, rather than folding of the clip into intramolecular triplex. The low-temperature transition was observed in denaturation profiles of any oligonucleotide containing beta- or mixed alpha,beta- cytidine stretches at the concentration of 1 microM. Self-association of alpha,beta-oligo(dC) was additionally confirmed by the appearance of two CD bands (at 290 and 265 nm) characteristic of CC+ base pairs. Despite the effective ability of alpha,beta-oligo(dC) to form self-associates, we succeeded in targeting 30-bp AT containing random DNA duplex by a 30-nt alpha,beta-oligocytidilate as evidenced by non-denaturing gel electrophoresis. A complete binding of the duplex was observed at a 5-fold excess of the third strand at 15 degrees C. Along with the formation of the three-stranded complex, self-association of mixed backbone oligo(dC) strands occurred.

FTIR and UV spectroscopy of parallel-stranded DNAs with mixed A*T/G*C sequences and their A*T/I*C analogues.

The infrared spectra of parallel-stranded (ps) hairpin duplexes with mixed A*T/G*C composition and either isolated or sequential G*C pairs were studied in comparison with antiparallel-stranded (aps) duplexes and a corresponding set of molecules with hypoxanthine as a G base analogue lacking the exocyclic amino group. The ps duplexes showed the characteristic bands for the C2=O2 and C4=O4 stretching vibrations of thymine residues in trans-Watson-Crick A*T pairing at 1683 and 1668 cm-1. The latter band was superimposed on the stretching vibration of the free C6=O6 group of guanine. Substitution of guanine by hypoxanthine inhibited the formation of ps hairpin duplexes whatever the sequence, demonstrating that in the H-bonding between G and C the 2-NH2 group is necessary for stabilizing all of the investigated ps duplexes. This result is in agreement with a model of trans-Watson-Crick G*C base pairs with two H-bonds [N2H2(G)-N3(C) and N1H(G)-O2(C)]. However, trans-Watson-Crick A*T and G*C base pairs with two H-bonds are not isomorphous, which may explain the decreased stability of the ps, but not the aps, duplexes upon increasing the number of A*T/G*C steps. Molecular modeling studies performed on two of the ps duplexes reveal the existence of propeller twist for avoiding a clash between the N2(G) and N4(C) amino groups, and favorable stacking of sequential G*C base pairs. The optimized hairpin ps duplexes invariably incorporated G*C base pairs with two H-bonds, regardless of the initial structures adopted for the force field calculations.

Distamycin-stabilized antiparallel-parallel combination (APC) DNA.

The formation of Antiparallel-Parallel-Combination (APC) DNA, a liner duplex with a segment of parallel-stranded (ps) helix flanked by conventional B-DNA, was tested with a number of synthetic oligonucleotides. The groove-binding ligand distamycin A (DstA) was used to stabilize the ps segment comprising five A x T base pairs. Two drug molecules bound per APC, one in each of the two equivalent grooves characteristic of ps-DNA. APC-DNA, reference molecules and their complexes with DstA were analysed by several methods: circular dichroism and absorption spectroscopy, thermal denaturation, chemical modification, and molecular modeling. The dye binding stoichiometry differed significantly due to inherent structural differences in the groove geometries of ps-DNA (trans base pairs, similar grooves) and conventional antiparallel-stranded (aps) B-DNA (cis base pairs, distinct major and minor grooves). The data support the existence of APC folding in solution.

Triple helix formation and homologous strand exchange in pyrene-labeled oligonucleotides.

The orientations of the symmetrical third strands (G3A4G3) and (G3T4G3) within the triplexes (C3T4C3) - (G3A4G3) x (G3A4G3) and (C3T4C3) - (G3A4G3) x (G3T4G3) were investigated by fluorescence spectroscopy and thermal denaturation using pyrene-labeled oligodeoxynucleotides. In the two triplex structures, both parallel and antiparallel orientations of the third strand with respects to the purine Watson-Crick one were identified by means of pyrene excimer formation. The pyrene labels do not modify the melting temperature of the (C3T4C3) - (G3A4G3) x (G3T4G3) triplex but somewhat stabilize the corresponding duplex against thermal denaturation. The absorption melting profiles of the (C3T4C3) - (G3A4G3) x (G3A4G3) triplex are monophasic in agreement with previous reports. In contrast, the melting of this structure, when monitored by the pyrene excimer band, reveals a biphasic behavior. These data, together with kinetics measurements, strongly suggest exchange mechanisms between the homologous oligomers (G3A4G3), Hoogsteen, and Watson-Crick strands.

Stabilizing and destabilizing effects of intercalators on DNA triplexes.

Oligonucleotide-directed triplex formation attracts much attention due to its potential usefulness in diagnostic and biotechnological applications. Among other aspects, the research embraces numerous studies probing the influence of intercalating ligands on triplex stability. The effect of the intercalator on triplex formation and stability is known to depend on nucleotide sequence, type of intercalator and solution conditions. The present work is aimed at determining the average number of intercalated ethidium bromide (EtBr) and acridine orange (AO) molecules leading to the most effective stabilization of triplexes. First, fluorescing complexes of intramolecular parallel (recombinant) triplex 5'-d(CATGCTAACT)-L-d(AGTTAGCATG)-L-d(CATGCTAACT)-3' (parARB) and classical antiparallel 5'-(dA)10-L-(dT)10-L-(dT)10-3'(antiATT) (L = -pO(CH2CH2O)3p-) with EtBr and AO were characterized, binding constants were obtained and compared to those for homologous DNA duplexes. Then the total EtBr and AO concentrations corresponding to an average of one, two or three intercalated molecules per oligonucleotide were estimated. Thermal denaturation of parARB and antiATT complexes with an average of one, two or three bound molecules was carried out, thermodynamic parameters of the triplex-to-duplex and duplex-to-open-strand transitions were evaluated using a three-state model. The ability of EtBr and AO to stabilize or destabilize both parallel (recombinant) and classical antiparallel triplexes was found to depend strongly on the concentration of bound intercalator. The triplexes were shown to be stabilized by intercalation of the first and second EtBr or AO molecules, while binding of the third intercalator molecule to 10 nucleotide long triplex resulted in significant triplex destabilization.

Parallel and antiparallel A*A-T intramolecular triple helices.

Intramolecular triple helices have been obtained by folding back twice oligonucleotides formed by decamers bound by non-nucleotide linkers: dA10-linker-dA10-linker-dT10 and dA10-linker-dT10-linker-dA10. We have thus prepared two triple helices with forced third strand orientation, respectively antiparallel (apA*A-T) and parallel (pA*A-T) with respect to the adenosine strand of the Watson-Crick duplex. The existence of the triple helices has been shown by FTIR, UV and fluorescence spectroscopies. Similar melting temperatures have been obtained in very different oligomer concentration conditions (micromolar solutions for thermal denaturation classically followed by UV spectroscopy, milimolar solutions in the case of melting monitored by FTIR spectroscopy) showing that the triple helices are intramolecular. The stability of the parallel triplex is found to be slightly lower than that of the antiparallel (deltaT(m) = 6 degrees C). The sugar conformations determined by FTIR are different for both triplexes. Only South-type sugars are found in the antiparallel triplex whereas both South- and North-type sugars are detected in the parallel triplex. In this case, thymidine sugars have a South-type geometry, and the adenosine strand of the Watson-Crick duplex has North-type sugars. For the antiparallel triplex the experimental results and molecular modeling data are consistent with a reverse-Hoogsteen like third-strand base pairing and South-type sugar conformation. An energetically optimized model of the parallel A*A-T triple helix with a non-uniform distribution of sugar conformations is discussed.

Stabilization of parallel (recombinant) triplex with propidium iodide.

Earlier we have shown that the oligonucleotide 5'-d(CATGCTAACT)-L-d(AGTTAGCATG)-L-d(CATGCTAACT)-3' [L = pO(CH2CH2O)3p] is able to fold back forming intramolecular RecA-independent triplex with identical strands oriented parallel to each other (parallel triplex) [A.K. Shchyolkina, E.N. Timofeev, O.F. Borisova, I.A. Il'icheva, E.E. Minyat, E.V. Khomyakova, V.L. Florentiev, FEBS Letters 339, 113-118 (1994) (1)]. In this study the propidium iodide (PI) was found to intercalate into the parallel triplex and increase its stability significantly (Tm increased from 21.4 up to 44.4 degrees C in 0.01 M Na phosphate buffer, pH 7, 0.1 M NaCl, when three PI molecules per triplex were bound). Fluorescence excitation and emission spectra, the quantum yield of fluorescence (q = 0.16) and the fluorescence lifetime of PI (tau = 24.5 ns at 3 degrees C) for the parallel triplex studied were shown to be similar to those for DNA. Scatchard binding plots indicated an anticooperative mode of PI binding to the parallel triplex. The association constant is close to that of PI binding to DNA. The fluorescence experiments revealed the maximum number of binding sites to be five PI molecules per one triplex molecule. Molecular mechanics calculation of possible structures for the parallel triplex-PI complex were performed.

Parallel purine-pyrimidine-purine triplex: experimental evidence for existence.

Oligonucleotides 5'-d(CT)5-L-d(AG)5-L-d(GA)5-3' and 5'-d(GA)5-L-d(TC)5-L-d(GA)5-3' [L = pO(CH2CH2O)3p] were studied by thermal denaturation, chemical modification and binding of fluorescent dyes. Both oligonucleotides are shown to fold back on itself twice forming at pH 7 a sufficiently stable triplex ether with antiparallel-oriented oligopurine strands (the first compound) or parallel-oriented oligopurine strands (the second compounds). The parallel triplex is significantly less stable than the antiparallel one. On the basis of conformational modeling, possible types of base tripling in the triplets are proposed. Thus our data provide the first convincingly evidence for the existence of a purine-pyrimidine-purine triplex with parallel orientation of identical strands.

A triple helix obtained by specific recognition of all 4 bases in duplex DNA can adopt a collapsed or an extended form.

It has been proposed that during homologous recombination promoted by RecA DNA triple helices can be formed between a Watson Crick duplex and a homologous third strand without any sequence constraint. A triple helix, obtained by targeting the d(AGTTAGCATG) sequence containing all 4 bases, in which both homologous strands are oriented in a parallel direction with respect to each other, stabilized by addition of Mn2+ ions has been studied by UV and FTIR spectroscopies. We have characterized the sugar conformations of this triplex. All strands are found to contain S type sugars (C2'endo, B family form). Progressive addition of propidium iodide induces a complete reorientation of the sugar geometry to a N type conformation (C3'endo, A family form). This sugar repuckering is consistent with a conformational transition from a collapsed to an extended DNA triple helical structure.

Parallel-stranded DNA with mixed sequence. Evidence for conformational transition in solution at low water activity.

Parallel-stranded deoxyoligonucleotide 5'd(CTATAGGGAT)3'/5'd(GATATCCCTA)3' (I-II) was shown to be stable in solution at 3 degrees-5 degrees C, 0.1-0.25 M NaCl, 10(-2) M phosphate buffer, pH 7.0 by means of a set of fluorescent techniques as well as of conventional optical methods. A cooperative change in the CD spectra is observed in trifluoroethanol (TFE) solutions at decreased water activity (relative humidity, r.h.). This distinctive change is supposed to stem from a cooperative conformational transition of parallel double helix from a B-like form with C2' endo sugar conformation to an A-like form designated as Ap. The free energy difference between the Ap and B-like conformation for the parallel duplex is 7.35 kcal/mol which is close to the value 7.40 kcal/mol for the antiparallel 5'd(CTATAGGGAT)3'/3'd(GATATCCCTA)5' (I-III). The ability of parallel helix to transit into Ap form is important for DNA-RNA parallel double helix formation.

The R-form of DNA does exist.

Oligonucleotide 5'-d(CATGCTAACT)-L-d(AGTTAGCATG)-L-d(CATGCTAACT)-3' [L = pO(CH2CH2O)3p] is shown to fold back on itself twice forming at pH 7 a sufficiently stable triplex (Tm is about 30 degrees C) with parallel-orientated identical strands (the recombinant or R-form of DNA). Experimental evidence was obtained by studying thermal denaturation, chemical modification and binding of fluorescent probes. The stability of the R-triplex increases in the presence of divalent ions or spermidine. Its structure is characterized by a certain heterogeneity that causes the cooperativity of a triplex-to-duplex transition to decrease. On the basis of conformational modeling, the possible types of base tripling in all four triplets are proposed. The experimental data as well as the molecular mechanic calculations indicate that the stabilities of triplets in the R-triplex decrease in the order: G:C-G = A:T-A >> T:A-T > C:G-C.

Three-stranded clip of the oligonucleotide 5'-(dT)10pO(CH2CH2O)3p(dT)10pO(CH2CH2O)3p(dA)10-3'.

Temperature dependence of UV and CD spectra of the oligonucleotide 5'-(dT)10-L-(dT)10-L-(dA)10-3' [tripl(ATT)] [L = -pO(CH2CH2O)3p-] in phosphate buffer, pH 7, at various NaCl concentrations and in the presence or absence of 0.01 M MgCl2 has been studied. At low oligonucleotide concentrations (2.2 x 10(-5) M nucleotide concentration) all structural transitions proceed intramolecularly. Tripl(ATT) exists in three forms: as a three-stranded clip (at low temperatures), a double-stranded hairpin (at intermediate temperatures), and as an open strand (at high temperatures). Thermodynamic parameters of the triplex formation depending on the NaCl concentration were calculated. The CD spectra were assigned to the single-, double-, and three-stranded forms. Ethidium bromide (EtBr) binding to the three-stranded clip was studied. Ethidium bromide molecules were shown to intercalate into the triple helix with the stable complex formation (association constant is 10(6)). One molecule of three-stranded clip binds not more than three EtBr molecules. The proposed synthetic model (oligonucleotide blocks coupled by hydroxyalkyl chains) has been shown to be convenient for studies of the physical and chemical properties of the triplex and other multistranded complexes of DNA.

Relative stability of AT and GC pairs in parallel DNA duplex formed by a natural sequence.

The low-cooperative melting of parallel DNA formed by a natural 40 bp long sequence from Drosophila: 5'-d(TGATTGATCGATTGTTTGCATGCACACGTTTTTGTGAGCG)-3' 5'-d(ACTAACTAGCTAACAAACGTACGTGTGCAAAAACACTCGC)-3' that possesses a normal nucleotide content was studied by using the special method of measuring the fluorescence of its complex with acriflavine as well as by conventional thermal denaturation. Acriflavine allows discrimination of the melting of AT and GC pairs because its fluorescence is quenched by neighbouring G bases. We have observed that about 40% of AT pairs melt at 14 degrees C while the remainder melt at 42 degrees C. The GC pairs remain stable up to approximately 40 degrees C and melt at 54 degrees C. The higher stability of GC pairs suggests the formation of cis Watson-Crick pairs in parallel DNA.