First Report of Colletotrichum fructicola Causing Leaf Spot on Smilax glabra Roxb in China.

Smilax glabra Roxb is a medicinal plant distributed in 17 countries and used in the production of food and tea (Wu et al. 2022). In May 2021, a leaf spot disease was observed on ~60% of S. glabra plants in a field (∼0.4 ha) in Qinzhou City, Guangxi Province. Initially, small, circular, brown spots appeared on the leaf surfaces, which then gradually expanded into large, sunken, dark brown necrotic areas. As disease progressed, lesions merged into large spots, eventually leading to defoliation. To determine the causal agent, six symptomatic plants were collected from the field. Small pieces (∼5 mm2) were cut from the infected leaves (n = 12), sterilized for two min in 1% NaOCl, and rinsed three times in sterile water. Then, the leaf tissues were placed on potato dextrose agar (PDA) with chloramphenicol (0.1 g/liter) and incubated for 3 days at 28°C (12-h photoperiod). Pure cultures were obtained by transferring hyphal tips from recently germinated spores or colony edges onto PDA. Among the 17 isolates, 15 exhibited similar morphologies. Two single-spore isolates (TFL45.1 and TFL46.2) were subjected to further morphological and molecular characterization. Colonies on PDA were grayish green with a white outer ring and cottony surface, and pale blackish green on the reverse side. Conidia were hyaline, aseptate, straight, and cylindrical, with rounded ends, and 11.4 to 16.5 µm × 4.1 to 6.1 µm (average 13.9 × 4.8 µm, n = 100). Appressoria were brown to dark brown, with a smooth edge and different shapes such as ovoid, elliptical or irregular, and 6.8 to 8.9 µm × 5.9 to 7.8 µm (average 7.7 × 6.6 µm, n = 25). For molecular identification, eight target gene sequences, internal transcribed spacer (ITS), glyceraldehydes-3-phosphate dehydrogenase (GAPHD), calmodulin (CAL), partial actin (ACT), chitin synthase (CHS-1), glutamine synthetase (GS), manganese superoxide dismutase (SOD2), and ß-tubulin (TUB) were selected for PCR amplification (Weir et al. 2012). The resulting sequences were deposited in GenBank (OR399160-61 and OR432537-50). BLASTn analysis of the obtained sequences showed 99-100% identity with those of the ex-type strain C. fructicola ICMP:18581 (JX010165, JX010033, FJ917508, FJ907426, JX009866, JX010095, JX010327, JX010405) (Weir et al. 2012). In addition, a phylogenetic analysis confirmed the isolates as C. fructicola. Therefore, based on morphological and molecular characteristics (Park et al. 2018; Weir et al. 2012), the isolates were identified as C. fructicola. To verify pathogenicity, three healthy leaves on each of six two-year-old S. glabra plants were inoculated with ∼5 mm2 mycelial discs or aliquots of 10 µl suspension (106 conidia/ml) of the strain TFL46.2, and six control plants were inoculated with sterile PDA discs or sterile water. All plants were enclosed in plastic bags and incubated in a greenhouse at 25°C (12-h photoperiod). Six days post-inoculation, leaf spot symptoms appeared on the inoculated leaves. No symptoms were detected in the controls. Experiments were replicated three times with similar results. To fulfill Koch's postulates, C. fructicola was consistently re-isolated from symptomatic tissue and confirmed by morphology and sequencing of the eight genes, whereas no fungus was isolated from the control plants. To our knowledge, this is the first report of C. fructicola causing leaf spot disease on S. glabra. Further studies will be needed to develop strategies against this disease based on the identification of this pathogen.

First Report of Epicoccum latusicollum Causing Leaf Blight on Curcuma kwangsiensis in China.

Curcuma kwangsiensis S. G. Lee et C. F. Liang is a traditional Chinese medicinal plant distributed in Guangxi and Yunnan Province, China. In May 2021, a leaf blight disease on C. kwangsiensi was observed in a plantation (~ 2 ha) in Lingshan county (21°51'00″N, 108°44'00″E), Guangxi Province. Disease incidence was up to 30% (n = 200). Initially, yellow to brown, irregular, water-soaked spots appeared at the tips or margins of leaves. As the disease progressed, the lesions gradually enlarged, merged. Finally, the entire leaf wilted, leading to defoliation. To isolate the pathogen, eighteen small pieces ( ~ 5 mm2) were cut from the margin of the necrotic lesions, surface disinfected with 1% NaOCl solution for 2 min, and rinsed three times in sterile water. Then the tissues were plated onto potato dextrose agar (PDA) and incubated for 3 days at 28°C. Hyphal tips from recently germinated spores were transferred to PDA to obtain pure cultures. Twelve isolates were obtained, of which ten isolates with similar morphological characterization. Two single-spore isolates (CK45.1 and CK45.2) were subjected to further morphological and molecular characterization. Colonies on PDA were villose, had a dense growth of aerial mycelia, and appeared white to grayish eventually. Pycnidia were brown, predominantly spheroidal, and 45.0 to 205.4 µm in diameter (n = 60). Conidia were ellipsoidal, aseptate, and 3.8 to 6.1 × 1.8 to 3.6 µm (n = 90). Morphological characteristics are similar to those of Epicoccum latusicollum (Chen et al. 2017).For molecular identification, primers ITS1/ITS4 (White et al. 1990), LR0R/LR5 (Vilgalys and Hester 1990, Rehner and Samuels 1994), RPB2-Ep-F (GGTCTTGTGTGCCCCGCTGAGAC)/RPB2-Ep-R TCGGGTGACATGACAATCATGGC), and TUB2-Ep-F (GTTCACCTTCAAACCGGTCAATG)/TUB2-Ep-R (AAGTTGTCGGGACGGAAGAGCTG) were used to amplify the internal transcribed spacer (ITS), partial nuclear large subunit rDNA (LSU), RNA polymerase II second largest subunit (rpb2), and ß-tubulin (tub2) genes, respectively. The obtained ITS (OP788080-81), LSU (OP811325-26), rpb2 (OP811267-68) and tub2 (OP811269-70) sequences showed 99.8% (478/479, and 478/479 bp), 99.9% (881/882, and 870/871 bp), 99.8 to 100% (429/431, and 429/430 bp), and 99.7% (332/333, and 332/333 bp) identity with those of ex-type strain E. latusicollum CGMCC 3.18346 (KY742101, KY742255, KY742174, KY742343). In addition, a phylogenetic analysis confirmed the isolates as E. latusicollum. Therefore, based on morphological and molecular characteristics, the isolates were identified as E. latusicollum. To verify pathogenicity, healthy leaves on nine plants (1 leaf per plant) were inoculated with mycelial discs from 5-day-old water-agar medium (WA) cultures of the strain CK45.1. Each leaf had four inoculation sites, two were inoculated with a representative strain, and two treated with pollution-free WA discs served as control. Plants were covered with transparent plastic bags and maintained in a greenhouse at 25°C with a 12 h photoperiod. Six days post-inoculation, the inoculated sites of leaves showed brown lesions, while the control remained healthy. The experiments repeated three times showed similar results. Koch's postulates were fulfilled by re-isolation of E. latusicollum from the lesions. To our knowledge, this is the first report of E. latusicollum causing leaf blight of C. kwangsiensi in China. This report might provide important information for growers to manage this disease.

[Application of exponential smoothing method in prediction and warning of epidemic mumps].

OBJECTIVE: To analyze the daily data of epidemic Mumps in a province from 2004 to 2008 and set up exponential smoothing model for the prediction. METHODS: To predict and warn the epidemic mumps in 2008 through calculating 7-day moving summation and removing the effect of weekends to the data of daily reported mumps cases during 2005-2008 and exponential summation to the data from 2005 to 2007. RESULTS: The performance of Holt-Winters exponential smoothing is good. The result of warning sensitivity was 76.92%, specificity was 83.33%, and timely rate was 80%. CONCLUSIONS: It is practicable to use exponential smoothing method to warn against epidemic Mumps.