Evaluation of 18F-SFB-Annexin B1 in detecting apoptosis / 中华核医学杂志

Objective To evaluate 18F-N- succinimidyl -4-fluorobenzoate (SFB)-Annexin B1 in detectingin vitro andin vivo apoptosis. Methods Anti-Fas antibody was used to induce apoptosis in Jurkat cells. Apoptosis in Jurkat cells was confirmed by flow cytometer (FCM). Unilateral renal ischemia/reperfusion injury was induced by transient (45 min) ligation of the renal artery in the rabbit. The rabbit was then administrated with 18F-SFB-Annexin B1 intravenously 24 h later and then imaged by PET/CT at 10,30,60,90,120 and 240 min postinjection. Apoptosis in kidney was confirmed by terminal deoxynucleotidyl transferase mediated dUTP biotin nick end labeling (TUNEL) assay and HE staining. Results The apoptosis rate induced by anti-Fas antibody was 25.98%(120 min) while that in the control group was only 1.81%. The uptake of 18F-SFB-Annexin B1in apoptosis group was greater than that in the control group. PET/CT images at 240 min showed higher uptake in the ligated kidney than the non-ligated kidney. TUNEL assay and HE staining confirmed great amount apoptotic cells in the ligated kidney. Conclusion 18 F-SFB-Annexin B1may be potentially useful in detecting apoptosis both in vitro and in vivo.

Dexamethasone protects airway epithelial cell line NCI-H292 against lipopolysaccharide induced endoplasmic reticulum stress and apoptosis / 中华医学杂志(英文版)

<p><b>BACKGROUND</b>Endoplasmic reticulum (ER) stress and ER stress-mediated apoptosis were reported to be involved in the pathogenesis of several diseases. In a recent study, it was reported that the ER stress pathway was activated in the lungs of lipopolysaccharide (LPS)-treated mice. It was also found that the C/EBP homologous protein (CHOP), an apoptosis-related molecule, played a key role in LPS-induced lung damage. The aim of this study was to verify whether LPS could activate the ER stress response in airway epithelial cells and which molecule was involved in the pathway. This study was also aimed at finding new reagents to protect the airway epithelial cells during LPS injury.</p><p><b>METHODS</b>ER stress markers were observed in LPS-incubated NCI-H292 cells. SiRNA-MUC5AC was transfected into NCI-H292 cells. The effects of dexamethasone and erythromycin were observed in LPS-induced NCI-H292 cells.</p><p><b>RESULTS</b>LPS incubation increased the expression of ER stress markers at the protein and mRNA levels. The knockout of MUC5AC in cells attenuated the increase in ER stress markers after incubation with LPS. Dexamethasone and erythromycin decreased caspase-3 activity in LPS-induced NCI-H292 cells.</p><p><b>CONCLUSIONS</b>LPS may activate ER stress through the overexpression of MUC5AC. Dexamethasone may protect human airway epithelial cells against ER stress-related apoptosis by attenuating the overload of MUC5AC.</p>

Augmented humoral and cellular immune responses of a hepatitis B DNA vaccine encoding HBsAg by protein boosting.

Several reports have indicated that combinatorial regimens with DNA and protein vaccines can elicit both strong immune responses, to circumvent the limits of each vaccine. Surprisingly little was known on HBV vaccine. Here, we investigated the immunization effects of several regimens in BALB/c mice. The level of total antibody and isotypes of IgG were determined by ELISA. Cellular immune responses were assayed by measuring the production of cytokines and CTL activity after re-stimulation for 7 days in vitro with tumor cells CT26/S stably expressing HBsAg. The efficacy of immunoprotection against the challenge of transplanted CT26/S was also examined. The regimen involving twice priming pVAX(S) encoding HBsAg and once recombinant HBsAg protein (rHBsAg) boosting, induced strong and homogenous antibody responses. This regimen induced significant stronger responses of interleukin-12 and gamma interferon (IFN-gamma) in splenocytes, and elicited stronger CD8+ CTL responses and greater immunopretectional efficacy than those elicited by immunization with rHBsAg or pVAX(S) alone. Our regimen may thus provide a strategy for developing an improved immunization against HBV and many other pathogens.

Cloning and bioinformatics analysis of a thrombin-like enzyme gene from Agkistrodon acutus / 中国实验血液学杂志

The venoms of Viperidae and Crotalidae snakes contain a large variety of proteins and peptides affecting the hemostatic system, which classified as coagulant, anticoagulant and fibrinolytic factors. To obtaind the thrombin-like enzyme gene of snake venoms, primers 1 5' ATGGTGCTGATCAGAGTGCTAGC 3' and 2 5' CTCCTCTTAA-CTTTTTCAAAAGTTT 3' were designed according to the snake venom thrombin-like enzyme highly conserved regions of 5' and 3'. Total RNA was prepared from the venom glands of a D. acutus specimen collected from Guangxi province of China, RT-PCR was conducted to amplify the gene of the venom thrombin-like enzyme (TLE). A 0.8 kb DNA fragment was specifically amplified, inserted into the pMD18-T vector and transformed into Escherichia coli strain DH5alpha, then identified by PCR and sequencing. The results showed that this cDNA shared great sequence homology (98.5%) with the published snake TLE cDNA sequence, the deduced amino acid sequence of this TLE encoded by the 783 bp consisted of 260 amino acids, which included a signal peptide of 24 amino acids and a matured peptide of 236 amino acids. In conclusion, a new cDNA encoding snake TLE was obtained by amplificantion.