ABSTRACT
Background The contracted family doctor services are the embodiment of the implementation of the new medical reform policy, and the transformation of the grass-roots health service mode. Studies have proved that the occupational stress in medical staff was at a high level. The enhancement of professional identity will contribute to strengthen team building,alleviate job burnout, and reduce turnover intention of family doctors. Objective To investigate the current situation of occupational identity among family doctor teams in Chengdu, to examine potential influencing factors of occupational identity, and to provide a reference for promoting career development and team building of family doctor teams. Methods Multi-stage random cluster sampling was adopted to enroll study participants form 46 primary healthcare centers where family doctor contract services were implemented among 23 districts and counties in Chengdu between March 4 and 26, 2021. A total of 2 681 family doctors participated in this survey. A self-reported survey was conducted to collect participants' demographic and occupational data. The Effort-Reward Imbalance (ERI)questionnaire was implemented to assess occupational stress. The Professional Identity Scale was used to appraise occupational identity. Results A total of 2 327 valid questionnaires were collected, with a valid recovery rate of 86.80%, involving 1 715 females (73.7%) and 612 males (26.3%), with dominant age groups of 26−35 years (43.3%) and 36−45 years (30.4%), a high proportion of being married (82.8%), having college (36.0%) and undergraduate (47.3%) education, a high proportion of primary titles (66.0%) and informal work contract (66.1%). About 88.7% of family doctor team workers reported occupational stress. The average score of occupational identity was (3.68±0.62) points. There were significant differences in occupational identity scores among different professional title, work contract, working years in medical institutions, income, and effort/reward ratio (EER) groups (P < 0.05). ERR was negatively correlated with occupational identity (rs=−0.495, P<0.05). The multiple regression model showed that occupational identity score in the non-staffed participants was lower than the score in the staffed ones (OR=0.429, 95%CI: 0.299−0.825). The occupational identity score in the participants having associate senior title or above was higher than in without professional title (OR=1.424, 95%CI: 1.194−2.328). The longer the working years, the higher the occupational identity score among the participants. The score of the more than 20 working years group was 1.820 times that of the less than 5 working years group (95%CI: 1.342−2.543). The higher the income, the higher the occupational identity score. The score of the 9001−12000 yuan per month group was 1.977 times that of the 1000−3000 yuan per month group (95%CI: 0.811−9.696) , and the score of the more than 12000 yuan per month group was 2.283 times that of the 1000−3000 yuan per month group (95%CI: 1.199−10.267). Conclusion The family doctor team workers generally report occupational stress, and their occupational identity is at a medium level in Chengdu. Relevant managers should implement intervention measures against the main influencing factors to reduce their work tension and improve their occupational identity.
ABSTRACT
Objective:To investigate clinical features, risk factors and prognostic effects of paradoxical response(PR)in children with tuberculous meningitis(TBM)during anti-tuberculosis treatment.Methods:The clinical and follow-up data of TBM children admitted to the Department of Pediatrics, the Affiliated Hospital of Zunyi Medical University between January 2013 and December 2018 were retrospectively analyzed.The children were divided into the PR group and the non-PR group.Influencing factors of PR were selected by the univariate analysis, and independent risk factors were screened from these influencing factors by using the multivariate Logistic regression model.The effect of PR on long-term prognosis (≥9 months) of TBM was evaluated. Results:There were 31 cases(35.6%)with PR among the 87 TBM children enrolled, including 16 boys and 15 girls, with median age of 92(8-168)months.The median time for PR occurrence during the anti-tuberculosis treatment was 33(15-180)days.PR could present dete-rioration or recurrence of original symptoms, cerebrospinal fluid(CSF)deterioration and neuroimaging deterioration, accounting for 71.0%(22/31 cases), 80.6%(25/31 cases)and 51.6%(16/31 cases), respectively.Univariate analysis showed that stage Ⅱ, limb paralysis, cranial nerve palsy, positive tests of tuberculosis infection(T-SPOT), an increased lactate dehydrogenase(LDH)level in CSF, basilar meningeal enhancement, and tuberculosis infection outside the central nervous system were the influencing factors of the PR(all P<0.05). Multivariate analysis showed that limb paralysis, cranial nerve palsy, an increased CSF-LDH level, and positive T-SPOT were independent risk factors of PR(all P<0.05). PR was not associated with prognosis( P=0.165). Conclusions:PR occurs in 35.6% of children with TBM.Limb paralysis, cranial nerve palsy, an increased CSF-LDH level and positive T-SPOT are independent risk factors of PR.PR does not adversely affect the outcome.Identifying PR is extremely important for the prevention of some clinical misunderstandings.
ABSTRACT
Objective:To investigate the clinical effect of Dynamic neutralization system applied to the treatment of lumbar degenerative diseases with fatty infiltration of multifidus muscle.Methods:From Jan 2015 to Dec 2017, a total of 53 patients of lumbar degenerative diseases with multifidus fatty infiltration treated by Dynesys in our hospital were analyzed, included 21 males and 32 females, aged 66.2±7.4 (range 48-81) years. There were lumbar spinal stenosis in 37 casesand lumbar disc herniationin 16 cases; the index level included L 2-S 1 in 3 cases, L 3-S 1 in 13 cases, L 2-L 5 in 5 cases, L 4-S 1 in 17 cases, and L 3-L 5 in 15 cases. The pedicle screws were inserted at the point of intersection of the outer edge of superior articular process and the midline of transverse process. After discectomy of herniated disc and hyperplastic ligamentum flavum, the distance between the upper and lower pedicle screws was measured and then the spacer of the corresponding length was cut out. Finally, the spacer was placed and fixed between the upper and lower pedicle screws by the elastic rope. The degree of multifidus fat infiltration, lumbar lordosis (LL), pelvic incidence (PI), pelvic tilt (PT), sacral slop (SS), range of motion (ROM), intervertebral height (IH), Japanese Orthopaedic Association (JOA) score, Oswestry disability index (ODI), the MOS 36-item short-form health survey (SF-36) and visual analog scale (VAS) were evaluated postoperatively. Results:The operation was performed successfully in all the patients. The operation duration was 173.5±64.7 (range 125-240) min. Intraoperative blood loss was 469.5±118.2 (range 380-620) ml. The patients were followed up for 47.9±6.7 (range 38-62) months averagely. At the last follow-up, the degree of fatty infiltration of the multifidus muscle showed no further progress by MR scan. There was no significant difference in ROM and IH at different time points preoperativelyand postoperatively. The LL recovered from 37.6°±8.8° to 43.2°±9.1°, the PT decreased from 24.7°±9.3° to 20.5°±5.1°, and the SS increased from 22.1°±7.7°to 26.3°±8.0°. The JOA score increased from preoperative 6.4±1.2 to 20.6±2.8, ODI decreased from preoperative 50.6%±11.3% to 13.0%±3.4%, SF-36 increased from preoperative 81.5±3.6 to 95.5±4.2, and the VAS decreased from preoperative 4.2±1.0 to 1.1±0.6. One patient experienced loosening and displacement on the left side pedicle screw of the L2 vertebral body 3.5 years after operation, and herclinical symptom improved significantly after conservative treatment.Conclusion:Dynesysis is safe and effective for the treatment of lumbar degenerative diseases with fatty infiltration of multifidus muscle, and it can restore the complete structure and function of tension band at lower back and prevent the progress of multifidus muscle fat infiltration combined with postoperative rehabilitation training.
ABSTRACT
BACKGROUND: Existing evidence has shown that that the effect of NGF/TrkA signaling pathway on proliferation and differentiation of tumor cells is closely related to PI3 K/AKT signaling pathway in human benign and malignant tumors. However, there is little information on the NGF/TrkA signaling pathway in pathogenesis of intraspinal schwannomas. OBJECTIVE: To investigate the effect of nerve growth factor-beta on the proliferation of interspinal schwannoma cells and to explore on the pathogenesis of NGF/TrkA signaling pathway in interspinal schwannoma. METHODS: Tumor samples were collected and digested to obtain high purity tumor cells as experimental cells. Then the cells were given different concentrations of nerve growth factor-beta (15, 30, 60, 120 and 240 μg/L), K252 a (100, 200, 300, 400, 500 and 600 nmol/L), LY294002 (10, 20, 30, 40, 50 and 60 μmol/L), nerve growth factor-beta (120 μg/L) plus K252 a (TrkA inhibitor, 400 nmol/L), and nerve growth factor-beta (120 μg/L) plus LY294002 (P13 K inhibitor, 50 μmol/L), respectively, for a certain time. The cell proliferation was detected by MTT assay. TrkA, AKT, p-AKT (Ther308), p-GSK-3 beta protein expression was detected by western blot assay. TrkA and AKT mRNA expression was detected by RT-PCR. RESULTS AND CONCLUSION: (1) Compared with the control group, the absorbance value of cells in the nerve growth factor-beta groups was increased in a concentration-dependent manner (P < 0.05), and increased obviously at the concentration of 120 μg/L (P < 0.001). The absorbance value of cells in the K252 a and LY294002 groups was decreased continuously (P < 0.05), and decreased obviously at the concentration of 400 nmol/L and 50 μmol/L, respectively (P< 0.001). (2) The expression levels of TrkA, p-AKT (Ther308), and p-GSK-3 beta protein were upregulated in the nerve growth factor-beta group (P < 0.05), and the expression level of TrkA mRNA was upregulated (P < 0.05). (3) In the nerve growth factor-beta (120 μg/L) plus K252 a (400 nmol/L) group, the absorbance value of cells decreased (P < 0.001). The expression levels of TrkA, p-AKT (Ther308), and p-GSK-3 beta protein downregulated (P < 0.05), and the expression level of TrkA mRNA downregulated (P < 0.05). (4) In the nerve growth factor-beta (120 μg/L) plus LY294002 (50 μmol/L) group, the absorbance value of cells decreased (P < 0.01), and the expression levels of p-AKT (Ther308), and p-GSK-3 beta protein downregulated (P < 0.05). (5) There was no significant change in AKT protein and mRNA in each group (P> 0.05). (6) These results suggest that nerve growth factor-beta can promote interspinal schwannoma cell proliferation, which may be related to the expression of TrkA, p-AKT (Ther308) and p-GSK-3 beta protein in NGF/TrkA signaling pathway.
ABSTRACT
BACKGROUND:Transferrin (Tf) is one suitable ligand to be conjugated to drug delivery systems to achieve site-specific targeting and desired therapeutic effect, due to its specific binding to transferrin receptors (TfR), and high expression on the surface of tumor cells. Contrast agents are also modified with Tf to achieve specific tumor imaging. OBJECTIVE:To prepare Tf-labeled magnetoliposomes (MLs), and characterize their utility as TfR targeted MR specific contrast agent in vitro. METHODS:MLs and Tf-MLs were prepared by lipid film hydration method and covalent coupling method, respectively. Tf-MLs were characterized by their mean size, zeta potential, polyindex, r2 relaxivity, Tf-binding efficacy and cytotoxicity.In vitro MRI contrasting properties of the suspended nanoparticles incubated with HepG2 cells were determined. RESULTS AND CONCLUSION:The mean diameter, polydisperisity index, zeta potential and r2 relexivity of Tf-ML were 95.1 nm, 0.21,-1.25 mv and 94.62 mmol-1/s, respectively. The coupling efficiency was calculated and the values obtained were 59.4 μg Tf/μmol phospholipid corresponding to about 27 molecules of Tf-MLs. After a 2-hour incubation with rhodamine-labeled Tf-MLs, rhodamine fluorescence was detected intensively in the plasma membrane and the cytoplasm of the TfR-overexpressing HepG2 cells. In contrast, Tf-ML showed little binding in MCF-7 cells that had low TfR level. HepG2 cels incubated with Tf-ML showed much higher intracellualar iron density than incubated with non-targeted MLs.In vitro MR T2WI of cells demonstrated the centrifuge tube containing HepG2 cells incubated with Tf-MLs produced a lower visible signal intensity than that treated with non-targeted MLs. Tf-MLs showed their potentials such as high r2 relaxivity, specific binding ability characteristics. These results suggest the availability of Tf-MLs to serve as a targeted contrast agent.
ABSTRACT
<p><b>OBJECTIVE</b>To explore the correlation between intraspinal Schwannomas and mutations of the NF2 gene.</p><p><b>METHODS</b>Samples from 20 patients with sporadic intraspinal Schwannomas were collected and subjected NF2 gene mutation detection by PCR amplification and Sanger sequencing.</p><p><b>RESULTS</b>Four de novo frameshifting mutations of the NF2 gene were discovered in the tumor tissues, which included c.1213_1231delTGAGCAGGAAATGCAGCGC, c.752delC, c.519_556delATAAATCTGTACAGATGACTCCGGAAATGTGGGAGGA and c.255delT. The same mutations were not found in the peripheral blood samples of the corresponding patients. The mutations have resulted in alteration of primary structure of the protein. No significant difference was found in the age [(60.25± 7.37) vs. (52.44 ± 10.16), P > 0.05] or diameters of tumor [(2.83 ± 0.31) cm vs. (2.31 ± 0.32) cm, P> 0.05] between patients with or without the mutations.</p><p><b>CONCLUSION</b>The occurrance and evolvement of sporadic intraspinal Schwannomas have a close relationship with mutations of the NF2 gene. The latters may result in structural change and functional loss of the encoded protein and lead to the disease phenotype in the patients.</p>
Subject(s)
Adult , Aged , Female , Humans , Male , Middle Aged , Genes, Neurofibromatosis 2 , Mutation , Neurilemmoma , Genetics , Spinal Cord Neoplasms , GeneticsABSTRACT
Objective To evaluate the clinical safety and efficacy of CalliSpheres,a domestic drugeluting microspheres,in treating primary hepatocellular carcinoma (HCC).Methods A total of 12 HCC patients were enrolled in this study.Interventional chemoembolization with CalliSpheres was carried out in all patients.The preoperative and postoperative clinical data,laboratory results and imaging findings were retrospectively analyzed.Results The success rate of initial interventional chemoembolization in 12 patients was 100%,the median follow-up time was 7.5 months (6-9 months).One week after the treatment,both AST and ALT levels were obviously increased when compared with preoperative ones,the differences were statistically significant (P<0.05),although their mean values did not exceed the normal upper limit of 40 U/L.No statistically significant differences in Child-Pugh grading,creatinine level,hemoglobin,white blood cell count and platelet count existed between preoperative data and postoperative ones (P>0.05).At 3 months and 6 months after treatment,the disease remission rates (CR+PR) were 75.00% and 66.67% respectively,the disease control rates (CR+PR+SD) were 91.67% and 83.33% respectively.In 10 HCC patients whose preoperative AFP was ≥ 200 μg/L,the postoperative AFP levels showed a significant decrease.Three months after the treatment,the complete remission rate,disease remission rate and disease control rate in the CalliSpheres combined with Lipiodol sequential transarterial chemoembolization group were better than those in the simple CalliSpheres embolization group,but the differences were not statistically significant (P>0.05).Postoperative complications were mainly abdominal pain and fever.During follow-up period,the complications included pleural effusion (n=2),liver abscess (n=l) and lung metastasis (n=l).Conclusion The use of domestic CalliSpheres,as a drug-eluting microspheres,for the treatment of primary HCC is safe and feasible with satisfactory short-term efficacy.Its long-term efficacy and the effect of combination use of CalliSpheres and Lipiodol need to be further clarified with multicenter and large sample researches.
ABSTRACT
Objective To evaluate the charateristics of CT and MR imaging of struma ovarii(SO).Methods 10 lesions of 10 pa-tients confirmed by pathology were analyzed retrospectively.6 cases were performed plain and enhanced CT scan and 4 were under-went MR before operation.Imaging features were analyzed retrospectively correlated with histological findings.Results All the SO tumors were appeared as solitary,well-defined,lobulated or oval masses.The largest diameter was less than 10 cm.Ascites were found in 4 cases.Six of SOs were solid-cystic and four were cystic.The cystic portion was low density or high density on CT images. High density cysts were shoewed in 4 cases.On MR images,the cystic portion was hypointenstiy on T1 WI and hypo/hyperintensity on T2 WI.Vacuum phenomenon (hypointenstiy on T1 WI and extremly hypointensity on T2 WI)was observed in 1 case.Solid compo-nent and cystic wall showed remarkable enhancement.Conclusion CT and MR images of SO can reflect its histopathologic charater-istics,which provides important value in the diagnosis and differential diagnosis of SO.
ABSTRACT
BACKGROUND: The extramedulary fixation system including dynamic hip screw (DHS) is commonly used in treatment of Intertrochanteric fracture. However, in patients with unstable intertrochanteric fracture, extramedulary fixation system often leads to the failure of fracture fixation. Intramedulary fixation system including both proximal femoral nail antirotation (PFNA) and InterTan nail has been widely used in the treatment of unstable intertrochanteric fractures. OBJECTIVE:To compare the therapeutic effects of extramedulary fixation system containing DHS, PFNA and InterTan nail in the treatment of intertrochanteric fracture. METHODS:Literatures were searched in Wanfang, PubMed, Embase, Medline, the Cochrane library to screen literatures published from January 1990 to November 2014. Relevant studies addressing extramedulary fixation system containing DHS, PFNA and InterTan nail were screened. RESULTS AND CONCLUSION: 346 articles were screened, and 13 of them were in accordance with the inclusion criteria. 1 271 patients with different types of intertrochanteric fracture were assessed in this study. Compared to DHS group, patients treated with PFNA and InterTan nail had shorter operation time and less blood loss. No significant difference in rehabilitation time and Harris score was detected among three kinds of fixation methods. Additionaly, PFNA and InterTan nail had a similar effect. These findings verify that compared with DHS, PFNA and InterTan nail can optimize the surgery, but cannot elevate postoperative outcomes.
ABSTRACT
The authors retrospectively reviewed 269 patients treated from September 2006 to August 2011 with the minimally invasive plate osteosynthesis (MIPO) technique using a universal reconstruction ribbon plate for fresh displaced midshaft fracture of the clavicle. Mean follow-up was 40.6 months. All had bony union (average healing time, 14.6 weeks). At 2-month postoperative follow-up, the mean Constant-Murley score was 92 points and the mean Disabilities of the Arm, Shoulder and Hand (DASH) score was 4.6 points. A total of 166 patients underwent hardware removal at an average of 15 months. A total of 258 patients were satisfied with the results of this surgery. This technique appears to be safe, simple, effective, and practical and to lead to rapid recovery, a high rate of union, a favorable cosmetic effect, and excellent function restoration. Thus, it can be considered an alternative to conventional plate osteosynthesis, intramedullary fixation, or non-operative treatment for fresh displaced midshaft clavicle fractures.
Subject(s)
Clavicle/surgery , Fracture Fixation/methods , Fractures, Bone/surgery , Adolescent , Adult , Aged , Bone Plates , Clavicle/diagnostic imaging , Clavicle/injuries , Female , Fractures, Bone/diagnostic imaging , Humans , Male , Middle Aged , Minimally Invasive Surgical Procedures , Radiography , Retrospective Studies , Young AdultABSTRACT
BACKGROUND:Studies on tibial plateau fractures had gradualy focused on “360° stereochemical structure” from medial and lateral “double track structure” nowadays. Scholars pay great attention on the stability and reposition of posterior plateau and functional recovery after reduction. The choice of fixation material of posterior plateau was controversial. OBJECTIVE:To discuss the biomechanical characteristics of posterolateral fracture of tibial plateau using three types of internal fixation. METHODS:Using three-dimensional finite element analysis, we simulated 1/2 and 1/4 posterolateral tibial plateau fractures. Three types of internal fixation were used: two anterior 6.5 mm lag screws, lateral 4.5 mm L-shape plate, and posterior 3.5 mm T-shape plate. 500 N was loaded at the center of the tibial plateau verticaly, and biomechanical status of three types of fixation was compared. RESULTS AND CONCLUSION: In 1/2 fracture model, anterior lag screw group and posterior plate group gained least displacement in al directions, as lateral plate group gained more. In 1/4 model, the advantage in displacement of anterior lag screw group was more apparent, the second was posterior plate group, and the last was lateral plate group. In 1/2 fracture model, the maximum stress of anterior lag screw was 36.523 MPa, which of lateral plate group was 153.372 MPa and posterior plate group was 115.922 MPa. The maximum stress left in the separate bone of lag screw group was 4.309 MPa, which of lateral plate group was 4.37 MPa and posterior plate group was 3.124 MPa. In 1/4 fracture model, the maximum stress of anterior lag screw was 36.803 MPa, which of lateral plate group was 153.336 MPa and posterior plate group was 104.234 MPa. The maximum stress left in the separate bone of lag screw group was 1.195 MPa, which of lateral plate group was 0.827 MPa and posterior plate group was 1.196 MPa. Results indicated that anterior lag screw could bear more stress and gained least displacement after loading, and the fixation was more stable. Posterior plate can give more stabilization when the separate bone was bigger (1/2), similar to anterior lag screw. When the separate bone was smaler (1/4), posterior plate model was less stable than anterior lag screw. Lateral plate model, with poor stabilization, was the worst choice in three types of fixation.
ABSTRACT
Objectives To study the correlations between stroke-preventive knowledge,health belief and health behaviors in community hypertensive patients.Methods The questionnaire of SPKQ,CHBMS and HPLPⅡwere used to take the investigation among 94 hypertensive patients from a community hospital in Guangzhou.Results The total score on SPKQ was 62.70±18.39 and the average scores on CHBMS and HPLPⅡwere 3.51±0.24 and 2.48±0.37,respectively.The stroke-preventive knowledge was positively correlated with health belief,health motivation and self-efficacy(r=0.289,P<0.01;r=0.246,P<0.05;r=0.350 (P<0.01,respectively).The health motivation was positively correlated with health behaviors(r=0.304,P<0.01)and the seriousness negatively correlated with health behaviors(r=-0.279,P<0.01).Conclusion Medical staff should provide much more stroke education with community hypertensive patients and promote patients’health motivation and self-efficacy of health belief in stroke prevention,help patients understand stroke seriousness,establish and sustain healthy lifestyles.
ABSTRACT
[Objective]To investigate the effect of minimally invasive treating proximal humeral fracture with PHILOS plate under acromial anterior lateral deltoid splitting approach.[Method]A retrospective analysis was done on 31 patients treated with minimally invasively with Philos plate under modified approach from April 2005 to March 2009.There were 17 males and 14 females,12 of them were injured in a traffic accident and 19 in daily life,with their ages ranging from 42 to 89 years.According to Neer classification,there were 5 cases of two-part fractures,11 cases of three-part fractures,and 15 cases of four part fractures.[Result]The postoperative radiographs verified good position of all screws,with satisfactory bone fracture reduction.Follow-up for 8-36 months(average 18.8 months) showed no necrosis of head of humerus and injury of axillary nerve and all patients gained bone union,supficial infection occurred in two patients but relieved by care.According to Neer scoring,the excellent to good result rate was 87.1%.[Conclusion]Philos plate for proxima humeral fracture using acromial anterior lateral deltoid splitting approach possesses such advantages as better individuation,less disturbance of the blood supply,stable fixation of the fracture.It is an new method to treat proximal humeral fractures.