Electroacupuncture Promotes Angiogenesis in Mice with Cerebral Ischemia by Inhibiting miR-7.

OBJECTIVE: To observe the angiogenesis effect of electroacupuncture (EA) at Shuigou acupoint (GV 26) in the treatment of cerebral ischemia, and explore the value of miRNA-7 (miR-7) in it. METHODS: First, 48 mice were randomly divided into sham operation, middle cerebral artery occlusion (MCAO) model, and EA treatment groups. Then 9 mice were divided into carrier control group, miR-7 knockout group and miR-7 overexpression group (n=3 each group). Finally, 20 mice were divided into model and carrier control group, model and miR-7 knockout group, EA treatment and carrier control group and EA treatment and miR-7 overexpression group, with 3-6 mice in each group. The MCAO model was established in the MCAO and EA groups. Neurological deficit score and 2,3,5-triphenyltetrazolium chloride (TTC) staining were used to evaluate the severity of cerebral ischemia. Hematoxylin-eosin staining was used to describe basic pathological changes. Immunohistochemistry was used to quantify cerebral microvessel density. Real-time PCR and Western blot were used to detect the expression of miR-7 and its downstream target genes Krüppel-like factor 4/vascular endothelial growth factor (KLF4/VEGF) and angiopoietin-2 (ANG-2) in the ischemic cerebral cortex. RESULTS: After EA, neurological deficit scores and infarction volumes decreased, and the density of cerebral microvessels increased. In the MCAO group, miR-7 expression was higher than that in the sham group (P<0.01). After EA at GV 26, miR-7 expression decreased (P<0.01) and the expression of downstream target genes KLF4/VEGF and ANG-2 increased as compared with the MCAO group (P<0.01). After EA combined with overexpression of miR-7, the expression of downstream target genes KLF4/VEGF and ANG-2 decreased compared to the control EA group (P<0.01). After miR-7 knockdown, the expression of KLF4/VEGF and ANG-2 increased (P<0.05 or P<0.01). CONCLUSIONS: EA could promote angiogenesis in MCAO mice likely by inhibiting the expression of miR-7 and relieving inhibition of downstream target genes KLF4/VEGF and ANG-2.

Identification and characterization of the compound heterozygous variants of TYR gene in a northern Chinese family with Oculocutaneous albinism type 1.

Oculocutaneous albinism (OCA) is a genetically heterogeneous disease and is most inherited in an autosomal recessive manner. The characteristic manifestation of OCA is due to disfunction of melanin synthesis. OCA1 is the most severe subtype of OCA and is caused by homozygous or compound heterozygous variants in tyrosinase (TYR) gene, which is the key gene for melanin synthesis. This study aimed to identify the genetic variants of a northern Chinese family with OCA1. Clinical information and peripheral blood samples were collected. PCR amplification and Sanger sequencing were used to detect the entire exons and adjacent flanking sequences of TYR gene. Functional prediction of variants was performed by various bioinformatic analyses, while the pathogenicity classification of variants was evaluated according to ACMG standards and guidelines. A missense variant NM_000372.5:c.107G > C;NP_000363.1:p.C36S was discovered in TYR gene which converted cysteine to serine. Another variant in intron, NM_000372.5:c.1037-7 T > A, also affected the function of TYR gene. We verified the pathogenicity of the intron variant with a pCAS2 mini-gene based splicing assay and found that c.1037-7 T > A led to an insertion of 5 bp upstream from the common acceptor site of exon 3, which caused a frameshift TYR:c.1037-7 T > A:p.G346Efs*11. The results showed that the compound heterozygous variants c.107G > C:p.C36S and c.1037-7 T > A:p.G346Efs*11 of TYR gene were the pathogenic variants for this OCA1 family.

Identification of a hippocampal lncRNA-regulating network in a natural aging rat model.

BACKGROUND: Dysregulation of long noncoding RNA (lncRNA) expression is related to aging and age-associated neurodegenerative diseases, and the lncRNA expression profile in the aging hippocampus is not well characterized. In the present investigation, the changed mRNAs and lncRNAs were confirmed via deep RNA sequencing. GO and KEGG pathway analyses were conducted to investigate the principal roles of the clearly dysregulated mRNAs and lncRNAs. Subsequently, through the prediction of miRNAs via which mRNAs and lncRNAs bind together, a competitive endogenous RNA network was constructed. RESULTS: A total of 447 lncRNAs and 182 mRNAs were upregulated, and 385 lncRNAs and 144 mRNAs were downregulated. Real-time reverse transcription-polymerase chain reaction validated the reliability of mRNA and lncRNA sequencing. KEGG pathway and GO analyses revealed that differentially expressed (DE) mRNAs were associated with cell adhesion molecules (CAMs), the p53 signaling pathway (SP), phagosomes, PPAR SP and ECM-receptor interactions. KEGG pathway and GO analyses showed that the target genes of the DE lncRNAs were related to cellular senescence, the p53 signaling pathway, leukocyte transendothelial migration and tyrosine metabolism. Coexpression analyses showed that 561 DE lncRNAs were associated with DE mRNAs. A total of 58 lncRNA-miRNA-mRNA target pairs were confirmed in this lncRNA‒miRNA‒mRNA network, comprising 10 mRNAs, 13 miRNAs and 38 lncRNAs. CONCLUSIONS: We found specific lncRNAs and mRNAs in the hippocampus of natural aging model rats, as well as abnormal regulatory ceRNA networks. Our outcomes help explain the pathogenesis of brain aging and provide direction for further research.

Combinatorial approach of in silico and in vitro evaluation of MLH1 variant associated with Lynch syndrome like metastatic colorectal cancer.

Colorectal cancer (CRC) is the third most developing cancer worldwide and Lynch syndrome (LS) accounts for 3-4% of CRC. Genetic alteration in any of DNA mismatch repair (MMR) gene is the major cause of LS that disrupt the normal upstream and downstream MMR events. Germline mutation of MLH1 in heterozygous state have an increased risk for CRC. Defective MMR pathway mostly results in microsatellite instability (MSI) that occurs in high percentage of CRC associated tumors. Here, we reported a patient with LS like metastatic CRC (mCRC) associated with other related cancers. Whole exome sequencing (WES) of the proband was performed to identify potential causative gene. Genetic screening validated by Sanger sequencing identified a heterozygous missense mutation in exon 12 of MLH1 (c.1151T>A, p.V384D). The clinical significance of identified variant was elucidated on the basis of clinicopathological data, computational predictions and various in vitro functional analysis. In silico predictions classified the variant to be deleterious and evolutionary conserved. In vitro functional studies revealed a significant decrease in protein expression because of stability defect leading to loss of MMR activity. Mutant residue found in MutL transducer domain of MLH1 that localized in the nucleus but translocation was not found to be significantly disturbed. In conclusion, our study give insight into reliability of combinatorial prediction approach of in silico and in vitro expression analysis. Hence, we highlighted the pathogenic correlation of MLH1 variant with LS associated CRC as well as help in earlier diagnosis and surveillance for improved management and genetic counselling.

A heterozygous duplication variant of the HOXD13 gene caused synpolydactyly type 1 with variable expressivity in a Chinese family.

BACKGROUND: Synpolydactyly type 1 (SPD1), also known as syndactyly type II, is an autosomal dominant limb deformity generally results in webbing of 3rd and 4th fingers, duplication of 4th or 5th toes. It is most commonly caused by mutation in HOXD13 gene. In this study, a five-generation Chinese family affected with SPD1 disease were collected. We tried to identify the pathogenic variations associated with SPD1 involved in the family. METHODS: We used the whole genome sequencing (WGS) to identify the pathogenic variant in this family which was later confirmed by PCR-Sanger sequencing. The genetic variation were evaluated with the frequencies in the 1000 Genome Project and Exome Aggregation Consortium (ExAC) dataset. The significance of variants were assessed using different mutation predictor softwares like Mutation Taster, PROVEAN and SIFT. The classification of variants was assessed according to American College of Medical Genetics and Genomics (ACMG) guidelines. RESULTS: Our results showed the mutation of 24-base pair duplication (c.183_206dupAGCGGCGGCTGCGGCGGCGGCGGC) in exon one of HOXD13 in heterozygous form which was predicted to result in eight extra alanine (A) residues in N-terminal domain of HOXD13 protein. The mutation was detected in all affected members of the family. CONCLUSION: Based on our mutation analysis of variant c.183_206dupAGCGGCGGCTGCGGCGGCGGCGGC in HOXD13 and its cosegregation in all affected family members, we found this variant as likely pathogenic to this SPD1 family. Our study highlights variable expressivity of HOXD13 mutation. Our results also widen the spectrum of HOXD13 mutation responsible for SPD1.

Role of RbBP5 and H3K4me3 in the vicinity of Snail transcription start site during epithelial-mesenchymal transition in prostate cancer cell.

EMT (epithelial-mesenchymal transition) occurs in a wide range of tumor types, and has been shown to be crucial for metastasis. Epigenetic modifications of histones contribute to chromatin structure and result in the alterations in gene expression. Tri-methylation of histone H3 lysine 4 (H3K4me3) is associated with the promoters of actively transcribed genes and can serve as a transcriptional on/off switch. RbBP5 is a component of the COMPASS/ -like complex, which catalyzes H3K4me3 formation. In this study, we found that in the process of TGF-Beta1 induced EMT in the prostate cancer cell line DU145, H3K4me3 enrichment and RbBP5 binding increased in the vicinity of Snail (SNAI1) transcription start site. Knocking-down of RbBP5 notably decreased Snail expression and EMT. Recruitment of RbBP5 and formation of H3K4me3 at Snail TSS during EMT depend on binding of SMAD2/3 and CBP at Snail TSS. This study links the SMAD2/3 signal with Snail transcription via a histone modification - H3K4me3. Furthermore, our research also demonstrates that RbBP5 and even WRAD may be a promising therapeutic candidates in treating prostate cancer metastasis, and that DU145 cells maintain their incomplete mesenchymal state in an auto/ paracrine manner.