[Hormonal contraceptives and their relationship to breast cancer]. / Hormonálna antikoncepcia a jej vzt'ah k rakovine prsníka.

BACKGROUND: The incidence of breast cancer diseases is continuously increasing. Hormonal factors like menarche, menopause and hormone replacement therapy are contributing to breast cancer cases. PATIENTS AND METHODS: Within the retrospective study we monitored one hundred patients between 28 and 79 years old, selected randomly with positive anamnesis of malignant breast cancer. Based on an analysis of their health records, we tried to identify the effect of the risk of hormonal therapy on breast cancer occurrence. The age of patients at which the disease was diagnosed and the length of hormonal treatment were monitored as well. RESULTS: Of the one hundred randomly selected patients diagnosed with breast cancer, the majority with positive anamnesis of breast cancer were between 40 and 59 years old. 69 of them have never used any hormonal treatment. The average age of cancer detection in the focused group was 53.38 years old. It was discovered that hormonal contraceptives (HC) and hormone replacement therapy (HRT) decreases the age when breast cancer was first diagnosed. The average age of patients with breast cancer who used HC (n=16) was 51.80 years old and the average age of patients who used HRT (n=15) was 51.25 years old. CONCLUSION: Although the age at which patients are diagnosed with breast cancer (being treated with HC and HRT) is lower than the age at which patients were positively diagnosed without using any hormonal treatment, the difference is statistically insignificant.

The diversity of eukaryotic microbiota in the traditional Slovak sheep cheese--bryndza.

We investigated the occurrence and diversity of yeasts and filamentous fungi in bryndza an artisanal Slovak soft spreadable cheese prepared from raw sheep milk or from a mixture of sheep and cow milk. Samples collected during four months of the summer production period from two locations (northern and southern parts of central Slovakia) contained 10(5)-10(7) (cfu) yeasts and about 10(2) (cfu) of mold per gram of wet weight. Further characterization by conventional taxonomy and sequence comparison of D1/D2 region from 26S rRNA gene revealed Mucor circinelloides v. Tieghem as the predominant filamentous fungus. A novel Geotrichum sp. together with Kluyveromyces (K. lactis/K. marxianus) was identified as the most abundant yeast species. Occasionally other yeasts, such as Candida inconspicua, Candida silvae, Pichia fermentans and Trichosporon domesticum were found. Conventional taxonomy readily identified isolates to the genus level, but DNA sequence comparison was capable of discriminating them at the species level.

DNA sequence diversity of intergenic spacer I region in the non-lipid-dependent species Malassezia pachydermatis isolated from animals.

The non-lipid-dependent species Malassezia pachydermatis is frequently isolated from animals. We analyzed the DNA sequences of the intergenic spacer (IGS) 1 region, which is the most variable region in the rRNA gene, of 43 M. pachydermatis strains obtained from dogs or cats. The lengths of the IGS 1 regions ranged from 552 to 898 bp and, based on the nucleotide sequence, these IGS 1 regions were divided into three major groups with 10 subtypes. Group 1 (552-601 bp long) was characterized by the short sequence repeat (CAGCA)n and had four to 14 repeats, and Group 3 (749-898 bp long), which included the neotype strain of M. pachydermatis, was characterized by the sequence (CAGCATAACATAACACACAACA)n in the IGS1 region. Group 2 possessed partial sequences of both Groups 1 and 3. Each group shared only 41.7-55.4% similarity in the IGS1 region with the other groups. The internal transcribed spacer (ITS) region and D1/D2 26S rDNA in the rRNA gene were also sequenced for representative strains in each IGS group. The groups were distinguished by both ITS (698-712 bp long including 5.8S rDNA) and D1/D2 26S rDNA (624 bp long) sequences with sequence similarities of 91.7-96.0% and 99.7-99.0%, respectively. Our results indicate that the sequence of the IGS region of M. pachydermatis has a remarkable intraspecies diversity, compared with ITS or D1/D2 26S rDNA, and that multiple genotypic strains of M. pachydermatis colonize animal skin.

GC clusters and the stability of mitochondrial genomes of Saccharomyces cerevisiae and related yeats.

The occurrence of GC clusters in Saccharomyces spp. and related yeasts was examined to clarify their association with the stability of intact mitochondrial genome. Abundance of nonspecific or specific GC clusters in these species decreases with phylogenetic distance from S. cerevisiae. Their number but not the number of replication origins correlates with the ability to form respiration-deficient mutants induced by ethidium bromide. This effect is not associated with the nuclear background since the cybrids having identical nuclei and mitochondria from different species gave similar results. In contrast to grand genomes, the presence of GC clusters in rho- mutants does not play any role in ethidium bromide induced mtDNA loss. The most plausible explanation for mitotically lost petite mtDNA seems to be dilution during the distribution.

The occurrence of yeasts in the forest soils.

One hundred and eighty one yeast strains were isolated from 180 soil samples collected in three types of forest. The samples were taken during one year. The yeast species found were similar in spite of distinct forest types. Cryptococcus laurentii, Cystofilobasidium capitatum, Leucosporidium scottii, Rhodotorula aurantiaca, and Trichosporon cutaneum were the predominant species in both deciduous and coniferous forests. The number of yeasts ranged from 1.5 x 10(3) to 1.1 x 10(4) CFU/g soil. We found that yeasts occurred unevenly in soils during the year. The lowest number of yeasts was ascertained in December and the highest one in May.

Seasonal occurrence of yeasts and yeast-like organisms in the river Danube.

One hundred and seventy yeast strains belonging to 14 genera and 29 species were isolated from 112 water samples of the river Danube in the area of Bratislava. The samples were collected through the year from April to March. Saccharomyces cerevisiae, Candida maltosa, Aureobasidium pullulans, Cystofilobasidium capitatum, Rhodotorula glutinis, Geotrichum candidum, and Candida krusei were the most frequent. The basidiomycetous yeasts and yeast-like organisms with oxidative metabolism were present in approximately equal numbers to those with fermentative metabolism. Saccharomyces cerevisiae was the dominant yeast and was isolated from 50% of all samples examined and represented approximately one quarter of the yeast community. Yeast densities ranged from 100 to 21,100 CFU per litre. The highest population density was observed in October. Cryptococcus albidus, Saccharomyces cerevisiae, Rhodotorula glutinis, and Aureobasidium pullulans formed the main part of the yeast population in this month.

Growth of Saccharomyces cerevisiae, Rhodotorula rubra and Bullera alba in the presence of beechwood prehydrolyzate-based lignin fractions.

The growth of yeast strains Saccharomyces cerevisiae, Rhodotorula rubra and Bullera alba isolated from natural lake microflora was examined in the presence of prehydrolysis lignin and/or its water-soluble derivative. The stimulation effect of the water-soluble lignin derivative was higher in comparison with that of unmodified lignin. The structural changes of the lignin macromolecule by the yeasts determined by IR spectroscopy indicate oxidative degradation and demeth(ox)ylation similar to that found with lignin-degrading hyphal fungi. The results indicate a partial utilization of lignin by the yeasts as carbon source.

Production of extracellular beta-mannanases by yeasts and yeast-like microorganisms.

A new screening method for simultaneous detection of endo-beta-1,4-mannanase and endo-beta-1,4-xylanase producing microorganisms is described. Two differently dyed substrates Ostazin Brilliant Red-galactomannan and Remazol Brilliant Blue-xylan were incorporated into the same agar media. Decolorizing of one or both substrates around the cell colonies indicates secretion of the corresponding enzyme(s). The method was used to screen 449 yeasts and yeast-like microorganisms belonging to 68 different genera. The secretion of endo-beta-1,4-mannanases and/or endo-beta-1,4-xylanases was found within 10 genera (42 positive strains out of 261 tested). A low frequency of occurrence of endo-beta-1,4-mannanases was observed within the genera Cryptococcus (1 positive strain out of 15 tested), Geotrichum (1 of 6) and Pichia (1 of 35). The highest frequency of occurrence of endo-beta-1,4-mannanases was found within the genera Stephanoascus (2 of 2) and Aureobasidium (14 of 14). Strains hydrolyzing Ostazin Brilliant Red-galactomannan were cultivated in liquid media containing 1% locust bean gum. The best producers of extracellualr endo-beta-1,4-mannanases were found to be the strains of Aureobasidium pullulans.

Killer activity of yeasts isolated from the water environment.

The killer activity of 46 strains belonging to 12 yeast and yeast-like species isolated from water or sediment samples was studied. Only two strains of the genus Cryptococcus did not show killer activity. Killer activity of yeast-like species Aureobasidium pullulans, Hyphopichia burtonii and Geotrichum candidum, and yeast species Candida krusei and Candida lambica was low. Sporobolomyces salmonicolor, Cryptococcus laurentii and Cryptococcus albidus had better activity against basidiomycetous than ascomycetous species. Hansenula anomala strains showed good activity against Geotrichum candidum strains, Cryptococcus albidus, and Sporobolomyces salmonicolor. Rhodotorula species showed activity against the majority of both ascomycetous and basidiomycetous species.

Yeasts and yeast-like organisms isolated from fish-pond waters.

Fifteen genera and 29 yeast species were found in the water of three fish-ponds located in the area of the Lowland Zahorie (Slovakia). The fish-ponds were sampled in summer and autumn. Aureobasidium, Sporobolomyces, Candida, and Cryptococcus species occurred the most frequently. The composition of yeast species was more heterogeneous in summer than in autumn, but the number of yeasts observed in autumn was 5.5 times higher than those isolated in summer. Some species of the genus Candida, Hyphopichia burtonii, Aureobasidium pullulans, Hansenula anomala and Cryptococcus laurentii were frequently isolated in summer in high counts. The occurrence of the "black yeasts" A. pullulans increased in autumn and together with red yeasts Sporobolomyces roseus represented approximately 70% of the yeast population.

New search for pectolytic yeasts.

A new screening method for pectin-depolymerizing microorganisms is described. The method is based on precipitation of non-hydrolyzed citrus pectin with hexadecyltrimethylammonium bromide in a medium solidified with a bacterial gelling gum. A substrate depolymerized by the secreted enzymes does not precipitate, and the positive strains thus show transparent areas around the colonies. The method was used to screen 300 yeast and yeast-like microorganisms belonging to 52 different genera. The secretion of pectin-depolymerizing enzymes occurred with different frequencies in 13 genera (69 positive strains of 207 tested), the lowest frequency being found in the genus Candida (13 positive out of 125 strains tested) and the highest frequency in the genera Aureobasidium (4 of 6) Cryptococcus (29 of 38), Geotrichum (4 of 9), Kluyveromyces (5 of 5), Rhodosporidium (2 of 2), Leucosporidium (2 of 2), Trichosporon (3 of 6) and Ustilago (2 of 2). Strains giving the highest number of harvested cells after growth on pectin in a liquid medium have been identified.

Fungi in activated sludge biocenosis.

It has been found that yeasts and yeast-like microorganisms are stable constituents of activated sludge biocenosis treating municipal wastewaters with a mixture of different industrial wastewaters at B upsilon values in the range of 1.3-1.7 kg COD m-3day-1 and B chi = 0.22-0.42 kg COD kg-1day-1. The number of these microorganisms reached about 10(4) cells mg VSS-1 and as typical species Saccharomyces cerevisiae and Candida famata can be considered. Considerably less numerous (4-8 cells mg VSS-1) was the mycoflora of high loaded treatment systems of petrochemical wastewaters (B upsilon = 10.3-14.1 kg COD m-3day-1 and B chi = 1.06-1.92 kg COD kg-1day-1) and municipal wastewaters with a mixture of aromatic amines (B upsilon = 1200-2400 mg COD l-1 day-1 and B chi = 0.43-0.94 mg COD mg-1day-1). Typical species for these sludges were Geotrichum candidum, G.klebahnii, G.sericeum, Trichosporon cutaneum and Sporobolomyces lactosus.

Sporobolomyces lactosus, a new species of ballistosporous yeast equipped with ubiquinone-10.

A new species of ballistospore-forming yeasts was recovered and its description given. Sporobolomyces lactosus, isolated from activated sludge treating petrochemical wastes, produces pinkish-coral to pink colored colonies, assimilates lactose and has Q-10 as the major ubiquinone.

[Diagnosis of aneurysms of the abdominal aorta]. / Diagnostika aneuryzmy abdominálnej aorty.

Since 1986 in the radiodiagnostic department of the District Institute of National Health in Lucenec 17 768 abdominal sonographies were made. In the total number of examinations by means of ultrasonography 22 aneurysms of the abdominal aorta were diagnosed, incl. one ruptured one. The high mortality rate on operation of ruptured aneurysms can be reduced in particular by elective resections of non-ruptured aneurysms. Examination of the abdominal aorta should be made as a matter of routine, independently on indication of abdominal sonographic examination, in particular in elderly patients.

Immunochemical and structural analysis of the cell wall mannan as the basis of the taxonomic reidentification of a yeast strain.

The immunochemical properties and structural features of D-mannans from two Candida parapsilosis strains were studied. Weak cross-reactivity of D-mannans with antisera produced to C. parapsilosis strains was observed, as well as significant differences in the mannans structures were found by means of methylation analysis, acetolysis and 1H-NMR spectroscopy. In view of the discrepancies found, new taxonomic identification of one strain was carried out. On the basis of assimilation of potassium nitrate and formation of hat-shaped spores as well as other differences found by investigation of physiological characteristics, one strain of C. parapsilosis was reidentified as Hansenula anomala. This work demonstrates that immunochemical and structural investigations of cell-wall polysaccharide components can serve as a basis for taxonomic identification of yeast strains.

Morphological changes during the life cycle of Aureobasidium pullulans (de Bary) Arnaud.

Aureobasidium pullulans (de Bary) Arnaud was isolated from different natural materials plant blossoms in particular. Elements of vegetative multiplication, structure of colonies and cultures in liquid media were analyzed in detail, leading to construction of the life cycle of this organism. Morphological polymorphism was found to be combined with the production of melanin and the polysaccharide pullulan. Morphological analysis served for a directed selection for studies of physiological properties of this organism and its practical application.