Factors influencing spatial variability in nitrogen processing in nitrogen-saturated soils.

Nitrogen (N) saturation is an environmental concern for forests in the eastern U.S. Although several watersheds of the Fernow Experimental Forest (FEF), West Virginia exhibit symptoms of N saturation, many watersheds display a high degree of spatial variability in soil N processing. This study examined the effects of temperature on net N mineralization and nitrification in N-saturated soils from FEF, and how these effects varied between high N-processing vs. low N-processing soils collected from two watersheds, WS3 (fertilized with [NH4]2SO4) and WS4 (untreated control). Samples of forest floor material (O1 horizon) and mineral soil (to a 5-cm depth) were taken from three subplots within each of four plots that represented the extremes of highest and lowest rates of net N mineralization and nitrification (hereafter, high N and low N, respectively) of untreated WS4 and N-treated WS3: control/low N, control/high N, N-treated/low N, N-treated/high N. Forest floor material was analyzed for carbon (C), lignin, and N. Subsamples of mineral soil were extracted immediately with 1 N KCl and analyzed for NH4+ and NO3- to determine preincubation levels. Extracts were also analyzed for Mg, Ca, Al, and pH. To test the hypothesis that the lack of net nitrification observed in field incubations on the untreated/low N plot was the result of absence of nitrifier populations, we characterized the bacterial community involved in N cycling by amplification of amoA genes. Remaining soil was incubated for 28 d at three temperatures (10, 20, and 30 degrees C), followed by 1 N KCl extraction and analysis for NH4+ and NO3-. Net nitrification was essentially 100% of net N mineralization for all samples combined. Nitrification rates from lab incubations at all temperatures supported earlier observations based on field incubations. At 30 degrees C, rates from N-treated/high N were three times those of N-treated/low N. Highest rates were found for untreated/high N (two times greater than those of N-treated/high N), whereas untreated/low N exhibited no net nitrification. However, soils exhibiting no net nitrification tested positive for presence of nitrifying bacteria, causing us to reject our initial hypothesis. We hypothesize that nitrifier populations in such soil are being inhibited by a combination of low Ca to Al ratios in mineral soil and allelopathic interactions with mycorrhizae of ericaceous species in the herbaceous layer.

Sequence analysis and initial characterization of two isozymes of hydroxylaminobenzene mutase from Pseudomonas pseudoalcaligenes JS45.

Pseudomonas pseudoalcaligenes JS45 grows on nitrobenzene by a partially reductive pathway in which the intermediate hydroxylaminobenzene is enzymatically rearranged to 2-aminophenol by hydroxylaminobenzene mutase (HAB mutase). The properties of the enzyme, the reaction mechanism, and the evolutionary origin of the gene(s) encoding the enzyme are unknown. In this study, two open reading frames (habA and habB), each encoding an HAB mutase enzyme, were cloned from a P. pseudoalcaligenes JS45 genomic library and sequenced. The open reading frames encoding HabA and HabB are separated by 2.5 kb and are divergently transcribed. The deduced amino acid sequences of HabA and HabB are 44% identical. The HAB mutase specific activities in crude extracts of Escherichia coli clones synthesizing either HabA or HabB were similar to the specific activities of extracts of strain JS45 grown on nitrobenzene. HAB mutase activity in E. coli extracts containing HabB withstood heating at 85 degrees C for 10 min, but extracts containing HabA were inactivated when they were heated at temperatures above 60 degrees C. HAB mutase activity in extracts of P. pseudoalcaligenes JS45 grown on nitrobenzene exhibited intermediate temperature stability. Although both the habA gene and the habB gene conferred HAB mutase activity when they were separately cloned and expressed in E. coli, reverse transcriptase PCR analysis indicated that only habA is transcribed in P. pseudoalcaligenes JS45. A mutant strain derived from strain JS45 in which the habA gene was disrupted was unable to grow on nitrobenzene, which provided physiological evidence that HabA is involved in the degradation of nitrobenzene. A strain in which habB was disrupted grew on nitrobenzene. Gene Rv3078 of Mycobacterium tuberculosis H37Rv encodes a protein whose deduced amino acid sequence is 52% identical to the HabB amino acid sequence. E. coli containing M. tuberculosis gene Rv3078 cloned into pUC18 exhibited low levels of HAB mutase activity. Sequences that exhibit similarity to transposable element sequences are present between habA and habB, as well as downstream of habB, which suggests that horizontal gene transfer resulted in acquisition of one or both of the hab genes.

Genetic and biochemical comparison of 2-aminophenol 1,6-dioxygenase of Pseudomonas pseudoalcaligenes JS45 to meta-cleavage dioxygenases: divergent evolution of 2-aminophenol meta-cleavage pathway.

Nitrobenzene is degraded to pyruvate and acetaldehyde by Pseudomonas pseudoalcaligenes JS45 via a reductive pathway, and by Comamonas sp. JS765 via an oxidative pathway. Although the initial reactions in the degradation of nitrobenzene by the two bacteria are totally different, the lower pathways are similar and converge at the level of 4-oxalocrotonate. In order to further investigate the biochemical properties and reveal the evolutionary relationships between the two lower pathways, the genes encoding the 2-aminophenol 1,6-dioxygenase were cloned and sequenced. 2-Aminophenol 1,6-dioxygenase from P. pseudoalcaligenes JS45 and catechol 2,3-dioxygenase from Comamonas sp. JS765 were able to act on both catechol and 2-aminophenol, but catechol was a suicide substrate of 2-aminophenol 1,6-dioxygenase. The activity of 2-aminophenol 1,6-dioxygenase was restored after removal of catechol and incubation with ascorbate and FeCl(2). Both the alpha-subunit (AmnA) and the beta-subunit (AmnB) of the dioxygenase from P. pseudoalcaligenes JS45 show a high degree of identity to the corresponding subunits of the ring-fission dioxygenase from Pseudomonas sp. AP-3: 67% for the alpha-subunit, and 84% for the beta-subunit. Sequence similarity studies suggest that the beta-subunits of both 2-aminophenol 1,6-dioxygenases are distantly related to homoprotocatechuate 2,3-dioxygenase from Escherichia coli strains W and C and then to catechol 2, 3-dioxygenase from Alcaligenes eutrophus. Four active-site-relevant histidines are conserved in AmnB, but not in AmnA. The lack of conserved histidines indicates the absence of an Fe(2+) binding site in AmnA, which explains the previous observations of only approximately one Fe(2+) per two subunits in the 2-aminophenol 1, 6-dioxygenases from P. pseudoalcaligenes JS45. The 2-aminophenol 1, 6-dioxygenase genes are located upstream of the 2-aminomuconic semialdehyde dehydrogenase gene, and a putative member of the YjgF protein family is upstream of the dioxygenase genes. Transcriptional analysis indicates that the YjgF-like protein, 2-aminophenol 1, 6-dioxygenase, and 2-aminomuconic semialdehyde dehydrogenase are coordinately transcribed. A putative ORF similar to part of the RNA helicase genes is downstream of the dehydrogenase gene. Both the novel organization of the genes and the phylogeny of the dioxygenases and dehydrogenase indicate that the 2-aminophenol pathway in P. pseudoalcaligenes JS45 represents an example of a distant divergent evolution of meta-cleavage pathways.

Purification and characterization of nitrobenzene nitroreductase from Pseudomonas pseudoalcaligenes JS45.

Pseudomonas pseudoalcaligenes JS45 grows on nitrobenzene as a sole source of carbon, nitrogen, and energy. The catabolic pathway involves reduction to hydroxylaminobenzene followed by rearrangement to o-amino-phenol and ring fission (S. F. Nishino and J. C. Spain, Appl. Environ. Microbiol. 59:2520, 1993). A nitrobenzene-inducible, oxygen-insensitive nitroreductase was purified from extracts of JS45 by ammonium sulfate precipitation followed by anion-exchange and gel filtration chromatography. A single 33-kDa polypeptide was detected by denaturing gel electrophoresis. The size of the native protein was estimated to be 30 kDa by gel filtration. The enzyme is a flavoprotein with a tightly bound flavin mononucleotide cofactor in a ratio of 2 mol of flavin per mol of protein. The Km for nitrobenzene is 5 microM at an initial NADPH concentration of 0.5 mM. The Km for NADPH at an initial nitrobenzene concentration of 0.1 mM is 183 microM. Nitrosobenzene was not detected as an intermediate of nitrobenzene reduction, but nitrosobenzene is a substrate for the enzyme, and the specific activity for nitrosobenzene is higher than that for nitrobenzene. These results suggest that nitrosobenzene is formed but is immediately reduced to hydroxylaminobenzene. Hydroxylaminobenzene was the only product detected after incubation of the purified enzyme with nitrobenzene and NADPH. Hydroxylaminobenzene does not serve as a substrate for further reduction by this enzyme. The products and intermediates are consistent with two two-electron reductions of the parent compound. Furthermore, the low Km and the inducible control of enzyme synthesis suggest that nitrobenzene is the physiological substrate for this enzyme.

Sequence analysis of the beta-N-acetylhexosaminidase gene of Vibrio vulnificus: evidence for a common evolutionary origin of hexosaminidases.

DNA cloned from the marine bacterium Vibrio vulnificus into Escherichia coli HB101 can hydrolyze chitin oligomer analogs in the recipient. The nucleotide sequence of the cloned DNA was determined and a single long open reading frame of 2541 base pairs (initiation codon through termination codon) was found. The nucleotide sequence predicts a gene product of 847 amino acids and a molecular mass of 94.3 kDa. In vitro transcription and translation analyses indicated a single protein of 94 kDa encoded by the cloned DNA. The gene product hydrolyzes methylumbelliferyl beta-D conjugates of chitotriose, chitobiose, N-acetylglucosamine, and N-acetylgalactosamine and has, therefore, been termed a beta-N-acetylhexosaminidase. The predicted protein shares a high degree of sequence similarity with the chitobiase of Vibrio harveyi and limited similarity with the alpha chain of human beta-hexosaminidase. Cluster analyses suggest a common evolutionary ancestor for all known hexosaminidase enzymes, with no detectable relationship to known chitinases.

Secondary structure and phylogeny of the chloroplast 23S rRNA gene from the brown alga Pylaiella littoralis.

The entire nucleotide sequence of a 23S rRNA gene from the brown alga Pylaiella littoralis (L.) Kjellm has been determined. The predicted length of the 23S rRNA is 2948 nucleotides, including the 4.5S rRNA-like region at the 3' end of the molecule. The putative transcript has been folded into a secondary structure by comparison to existing structure models, and the predicted helical regions were inspected by identifying compensatory downstream base changes. The 23S rRNA secondary structure presented here has features that are unique to P. littoralis (no other chromophyte or red algal 23S rRNA sequences are yet available), but has none of the features specific to the chloroplast rRNAs of green plants and green algae. The Pylaiella sequence was aligned with analogous plastidial and eubacterial gene sequences, and the alignment was used to construct a phylogenetic tree. The plastidial sequences formed a coherent cluster closely associated with the 23S rRNA of the cyanobacterium Anacystis nidulans. Within the plastid group, the P. littoralis sequence was most closely related to that of Euglena gracilis confirming earlier analyses based upon 16S rRNA sequences.

Sequence, proposed secondary structure, and phylogenetic analysis of the chloroplast 5S rRNA gene of the brown alga Pylaiella littoralis (L.) Kjellm.

The chloroplast 5S rRNA gene of the brown alga Pylaiella littoralis (L.) Kjellm has been cloned and sequenced. The gene is located 23 bp downstream from the 3' end of the 23S rRNA gene. The sequence of the gene is as follows: GGTCTTG GTGTTTAAAGGATAGTGGAACCACATTGAT CCATATCGAACTCAATGGTGAAACATTATT ACAGTAACAATACTTAAGGAGGAGTCCTTTGGGAAGATAGCTTATGCCTAAGAC. A secondary structure model is proposed, and compared to those for the chloroplast 5S rRNAs of spinach and the red alga Porphyra umbilicalis. Cladograms based on chloroplast and bacterial 5S rRNA and rRNA gene sequences were constructed using the MacClade program with a user-defined character transformation in which transitions and transversions were assigned unequal step values. The topology of the resulting cladogram indicates a polyphyletic origin for photosynthetic organelles.

Hydrocarbon mineralization in sediments and plasmid incidence in sediment bacteria from the campeche bank.

Rates of degradation of radiolabeled hydrocarbons and incidence of bacterial plasmid DNA were investigated in sediment samples collected from the Campeche Bank, Gulf of Mexico, site of an offshore oil field containing several petroleum platforms. Overall rates of mineralization of [C]hexadecane and [C]phenanthrene measured for sediments were negligible; <1% of the substrate was converted to CO(2) in all cases. Low mineralization rates are ascribed to nutrient limitations and to lack of adaptation by microbial communities to hydrocarbon contaminants. Plasmid frequency data for sediment bacteria similarly showed no correlation with proximity to the oil field, but, instead, showed correlation with water column depth at each sampling site. Significant differences between sites were observed for proportion of isolates carrying single or multiple plasmids and mean number of plasmids per isolate, each of which increased as a function of depth.

Particulate DNA in smoker fluids: evidence for existence of microbial populations in hot hydrothermal systems.

As part of an interdisciplinary study of hydrothermal vents on the Endeavour Segment of the Juan de Fuca Ridge, we used the submersible ALVIN to collect 57 fluid samples in titanium syringes and Go Flo Niskin bottles from 17 different hot vents (smokers and flanges) and their environs for the purpose of extracting particulate DNA. The relative purity of the vent fluids collected was determined by Mg content as an indicator of seawater entrainment. Particulate material concentrated from these samples was lysed enzymatically (enz) and by a combination of enzyme and French press treatment (fp). Concentrations of partially purified DNA recovered from these lysates were determined spectrofluorometrically by using the dye Hoechst 33258. Ambient seawater surrounding the vents was found to contain low DNA concentrations, 0.18 to 0.32 ng of DNA per ml (n = 4; mean(enz) = 0.23 +/- 0.05; mean(fp) = 0.26 +/- 0.05), while low-temperature vent samples yielded significantly higher concentrations of 0.37 to 2.12 ng of DNA per ml (n = 4; mean(enz) = 0.97 +/- 0.68; mean(fp) = 1.05 +/- 0.54). Although DNA recovery values from superheated (210 to 345 degrees C) flange samples (mean(enz) = 0.14 +/- 0.10; mean(fp) = 0.12 +/- 0.14) were not significantly different from ambient seawater values, most of the superheated (174 to 357 degrees C) smoker fluid samples contained particulate DNA in concentrations too high to be attributable to entrained seawater. Detailed sampling at one smoker site demonstrated not only the existence of significant levels of particulate DNA in the superheated smoker fluids but also the presence of an elevated microbial population in the buoyant plume 20 to 100 m above the smoker. These results underscore the heterogeneity of smoker environments within a given hydrothermal vent field and indicate that microorganisms exist in some superheated fluids.

Simple, rapid method for direct isolation of nucleic acids from aquatic environments.

Direct isolation of nucleic acids from the environment may be useful in several respects, including the estimation of total biomass, detection of specific organisms and genes, estimations of species diversity, and cloning applications. We have developed a method that facilitates the concentration of microorganisms from aquatic samples and the extraction of their nucleic acids. Natural water samples of 350 to greater than 1,000 ml are concentrated on a single cylindrical filter membrane (type SVGS01015; Millipore Corp., Bedford, Mass.), and cell lysis and proteolysis are carried out within the filter housing. Crude, high-molecular-weight nucleic acid solutions are then drawn off the filter. These solutions can be immediately analyzed, concentrated, or purified, depending on the intended application. The method is simple, rapid, and economical and provides high-molecular-weight chromosomal DNA, plasmid DNA, and speciated RNAs which comigrate with 5S, 16S, and 23S rRNAs. The methods presented here should prove useful in studying both the ecology and the phylogeny of microbes that resist classical culture methods.

Chitinase determinants of Vibrio vulnificus: gene cloning and applications of a chitinase probe.

To initiate study of the genetic control of chitinolytic activity in vibrios, the chitobiase gene was isolated by cloning chromosomal DNA prepared from Vibrio vulnificus. Chimeric plasmids were constructed from Sau3A I partial digests of chromosomal DNA by ligating 5 to 15-kilobase fragments into the BamHI site, i.e., in the Tcr gene, of pBR322 (Amr Tcr). The resulting plasmids were transformed into Escherichia coli DH1. Chitobiase activity of the insert-bearing clones was detected by using a chromogenic substrate, p-nitrophenyl-N-acetyl-beta, D-glucosaminide, and confirmed by the appearance of a fluorescent end product from the hydrolysis of 4-methylumbelliferyl-beta,D-N-N'-diacetylchitobiose. Endochitinase activity was demonstrated by liberation of water-soluble products produced by the degradation of [3H]chitin. Transformation of E. coli Y10R (lacY) with plasmids from chitinase-positive clones restored the lactose-positive phenotype, suggesting the presence of a permease associated with chitinase activity. Physical mapping of plasmids containing the chitinase determinants indicate that transcription of these genes in E. coli may be initiated at a V. vulnificus promoter.

Target sites for the transposition of rat long interspersed repeated DNA elements (LINEs) are not random.

The long interspersed repeated DNA family of rats (LINE or L1Rn family) contains about 40,000 6.7-kilobase (kb) long members (1). LINE members may be currently mobile since their presence or absence causes allelic variation at three single copy loci (2, 3): insulin 1, Moloney leukemia virus integration 2 (Mlvi-2) (4), and immunoglobulin heavy chain (Igh). To characterize target sites for LINE insertion, we compared the DNA sequences of the unoccupied Mlvi-2 target site, its LINE-containing allele, and several other LINE-containing sites. Although not homologous overall, the target sites share three characteristics: First, depending on the site, they are from 68% to 86% (A+T) compared to 58% (A+T) for total rat DNA (5). Depending on the site, a 7- to 15-bp target site sequence becomes duplicated and flanks the inserted LINE member. The second is a version (0 or 1 mismatch) of the hexanucleotide, TACTCA, which is also present in the LINE member, in a highly conserved region located just before the A-rich right end of the LINE member. The third is a stretch of alternating purine/pyrimidine (PQ). The A-rich right ends of different LINE members vary in length and composition, and the sequence of a particularly long one suggests that it contains the A-rich target site from a previous transposition.

Modification of the 14C most-probable-number method for use with nonpolar and volatile substrates.

A method was developed to allow the use of volatile and nonpolar substrates in 14C most-probable-number tests. Naphthalene or hexadecane was sorbed to filter paper disks and submerged in minimal medium. The procedure reduced the volatilization of the substrates while allowing them to remain available for microbial degradation.