ATP alters the diffusion mechanics of MutS on mismatched DNA.

The mismatch repair (MMR) initiation protein MutS forms at least two types of sliding clamps on DNA: a transient mismatch searching clamp (∼1 s) and an unusually stable (∼600 s) ATP-bound clamp that recruits downstream MMR components. Remarkably, direct visualization of single MutS particles on mismatched DNA has not been reported. We have combined real-time particle tracking with fluorescence resonance energy transfer (FRET) to image MutS diffusion dynamics on DNA containing a single mismatch. We show searching MutS rotates during diffusion independent of ionic strength or flow rate, suggesting continuous contact with the DNA backbone. In contrast, ATP-bound MutS clamps that are visually and successively released from the mismatch spin freely around the DNA, and their diffusion is affected by ionic strength and flow rate. These observations show that ATP binding alters the MutS diffusion mechanics on DNA, which has a number of implications for the mechanism of MMR.

Label-free detection of kanamycin based on the aptamer-functionalized conducting polymer/gold nanocomposite.

Highly sensitive label-free detection of kanamycin is achieved with an aptamer sensor based on a conducting polymer/gold self-assembled nanocomposite. The sensor probe is fabricated by covalently immobilizing an in vitro selected DNA aptamer for kanamycin onto gold nanoparticle (AuNP)-comprised conducting polymer, poly-[2, 5-di-(2-thienyl)-1H-pyrrole-1-(p-benzoic acid)] (poly-DPB). The self-assembling of DPB on AuNP is investigated by TEM and UV-vis spectroscopy and the modification of the aptamer sensor is characterized using XPS and electrochemical impedance spectroscopy. The probe is applied to detect kanamycin by using voltammetric techniques. The sensor shows a pair of redox peaks around 0.26/ 0.08 V (vs. Ag/AgCl) for kanamycin captured by the aptamer-immobilized probe. The parameters that can affect the response, such as aptamer concentration, incubation time, temperature, and pH are optimized. The calibration plot shows a linear range from 0.05 µM to 9.0 µM kanamycin with a detection limit of 9.4±0.4 nM. The proposed aptamer sensor is examined with a real sample.

A highly sensitive aptasensor towards Plasmodium lactate dehydrogenase for the diagnosis of malaria.

Finding a highly sensitive diagnostic technique for malaria has challenged scientists for the last century. In the present study, we identified versatile single-strand DNA aptamers for Plasmodium lactate dehydrogenase (pLDH), a biomarker for malaria, via the Systematic Evolution of Ligands by EXponential enrichment (SELEX). The pLDH aptamers selectively bound to the target proteins with high sensitivity (K(d)=16.8-49.6 nM). The selected aptamers were characterized using an electrophoretic mobility shift assay, a quartz crystal microbalance, a fluorescence assay, and circular dichroism spectroscopy. We also designed a simple aptasensor using electrochemical impedance spectroscopy; both Plasmodium vivax LDH and Plasmodium falciparum LDH were selectively detected with a detection limit of 1 pM. Furthermore, the pLDH aptasensor clearly distinguished between malaria-positive blood samples of two major species (P. vivax and P. falciparum) and a negative control, indicating that it may be a useful tool for the diagnosis, monitoring, and surveillance of malaria.

Aptamers and their biological applications.

Recently, aptamers have attracted the attention of many scientists, because they not only have all of the advantages of antibodies, but also have unique merits, such as thermal stability, low cost, and unlimited applications. In this review, we present the reasons why aptamers are known as alternatives to antibodies. Furthermore, several types of in vitro selection processes, including nitrocellulose membrane filtration, affinity chromatography, magnetic bead, and capillary electrophoresis-based selection methods, are explained in detail. We also introduce various applications of aptamers for the diagnosis of diseases and detection of small molecules. Numerous analytical techniques, such as electrochemical, colorimetric, optical, and mass-sensitive methods, can be utilized to detect targets, due to convenient modifications and the stability of aptamers. Finally, several medical and analytical applications of aptamers are presented. In summary, aptamers are promising materials for diverse areas, not just as alternatives to antibodies, but as the core components of medical and analytical equipment.

A coordination polymer nanobelt (CPNB)-based aptasensor for sulfadimethoxine.

A polymer-based aptasensor, which consisted of fluorescein amidite (FAM)-modified aptamers and coordination polymer nanobelts (CPNBs), was developed utilizing the fluorescence quenching effect to detect sulfadimethoxine residue in food products. A single-stranded DNA (ssDNA) aptamer, which was a specific bio-probe for sulfadimethoxine (Su13; 5'-GAGGGCAACGAGTGTTTATAGA-3'), was discovered by a magnetic bead-based systematic evolution of ligands by exponential enrichment (SELEX) technique, and the fluorescent quenchers CPNBs were produced by mixing AgNO(3) and 4,4'-bipyridine. This aptasensor easily and sensitively detected sulfadimethoxine in solution with a limit of detection (LOD) of 10ng/mL. Furthermore, the antibiotic dissolved in milk was also effectively detected with the same LOD value. In addition, this aptamer probe offered high specificity for sulfadimethoxine compared to other antibiotics. These valuable results provide ample evidence that the CPNB-based aptasensor can be used to quantify sulfadimethoxine residue in food products.

Aptasensor for ampicillin using gold nanoparticle based dual fluorescence-colorimetric methods.

A gold nanoparticle based dual fluorescence-colorimetric method was developed as an aptasensor to detect ampicillin using its single-stranded DNA (ssDNA) aptamer, which was discovered by a magnetic bead-based SELEX technique. The selected aptamers, AMP4 (5'-CACGGCATGGTGGGCGTCGTG-3'), AMP17 (5'-GCGGGCGGTTGTATAGCGG-3'), and AMP18 (5'-TTAGTTGGGGTTCAGTTGG-3'), were confirmed to have high sensitivity and specificity to ampicillin (K(d), AMP7 = 9.4 nM, AMP17 = 13.4 nM, and AMP18 = 9.8 nM, respectively). The 5'-fluorescein amidite (FAM)-modified aptamer was used as a dual probe for observing fluorescence differences and color changes simultaneously. The lower limits of detection for this dual method were a 2 ng/mL by fluorescence and a 10 ng/mL by colorimetry for ampicillin in the milk as well as in distilled water. Because these detection limits were below the maximum residue limit of ampicillin, this aptasensor was sensitive enough to detect antibiotics in food products, such as milk and animal tissues. In addition, this dual aptasensor will be a more accurate method for antibiotics in food products as it concurrently uses two detection methods: fluorescence and colorimetry.

Gold nanoparticle-based colorimetric detection of kanamycin using a DNA aptamer.

A selective kanamycin-binding single-strand DNA (ssDNA) aptamer (TGGGGGTTGAGGCTAAGCCGA) was discovered through in vitro selection using affinity chromatography with kanamycin-immobilized sepharose beads. The selected aptamer has a high affinity for kanamycin and also for kanamycin derivatives such as kanamycin B and tobramycin. The dissociation constants (K(d) [kanamycin]=78.8 nM, K(d) [kanamycin B]=84.5 nM, and K(d) [tobramycin]=103 nM) of the new aptamer were determined by fluorescence intensity analysis using 5'-fluorescein amidite (FAM) modification. Using this aptamer, kanamycin was detected down to 25 nM by the gold nanoparticle-based colorimetric method. Because the designed colorimetric method is simple, easy, and visible to the naked eye, it has advantages that make it useful for the detection of kanamycin. Furthermore, the selected new aptamer has many potential applications as a bioprobe for the detection of kanamycin, kanamycin B, and tobramycin in pharmaceutical preparations and food products.

MutS switches between two fundamentally distinct clamps during mismatch repair.

Single-molecule trajectory analysis has suggested DNA repair proteins may carry out a one-dimensional (1D) search on naked DNA encompassing >10,000 nucleotides. Organized cellular DNA (chromatin) presents substantial barriers to such lengthy searches. Using dynamic single-molecule fluorescence resonance energy transfer, we determined that the mismatch repair (MMR) initiation protein MutS forms a transient clamp that scans duplex DNA for mismatched nucleotides by 1D diffusion for 1 s (~700 base pairs) while in continuous rotational contact with the DNA. Mismatch identification provokes ATP binding (3 s) that induces distinctly different MutS sliding clamps with unusual stability on DNA (~600 s), which may be released by adjacent single-stranded DNA (ssDNA). These observations suggest that ATP transforms short-lived MutS lesion scanning clamps into highly stable MMR signaling clamps that are capable of competing with chromatin and recruiting MMR machinery, yet are recycled by ssDNA excision tracts.

Simultaneous electrochemical detection of both PSMA (+) and PSMA (-) prostate cancer cells using an RNA/peptide dual-aptamer probe.

Using an RNA/peptide dual-aptamer probe, both PSMA (+) and PSMA (-) prostate cancer cells were simultaneously detected by electrochemical impedance spectroscopy. This approach can be applied as a general tool for early diagnosis of prostate cancer.