Development and characterization of microsatellite markers for Phyllanthus emblica Linn., important nontimber forest product species.

Phyllanthus emblica and P. indofischeri, commonly known as the Indian gooseberry, are important nontimber forest product (NTFP) species widely distributed across the Indian subcontinent. The fruits of these species are rich in vitamin C and are used in the preparation of a number of herbal medicines for treating a wide range of disorders. Due to the increased demand, they have been harvested extensively and form a major source of income for the forest-dwelling communities living in southern India. There are limited studies to understand the impact of harvesting on the genetic structure of these species. In this study, 15 polymorphic microsatellite markers have been developed for P. emblica and were characterized by screening 20 individuals each of P. emblica and P. indofischeri. The number of alleles per locus ranged 2-9 for P. emblica and 2-11 for P. indofischeri. The observed and expected heterozygosity of P. emblica ranged 0-1 and 0.401-0.825, respectively. Similarly, the observed and expected heterozygosity of P. indofischeri ranged 0.5-1 and 0.366-0.842, respectively. Cross-amplification of the designed primers was assessed with seven related Phyllanthus species. The microsatellite markers developed can be used for studying the population genetic structure, gene flow and genetic diversity of P. emblica and P. indofischeri.

Hepatoprotective activity of Indian Phyllanthus.

CONTEXT: Phyllanthus (Euphorbiaceae) species are traditionally well-known for their medicinal properties including hepatoprotective activity. OBJECTIVE: The study assessed the hepatoprotective and antioxidant activities of 11 Phyllanthus species, P. amarus Schumach., P. urinaria L., P. debilis Klein ex Willd, P. tenellus Roxb., P. virgatus G. Forst., P. maderaspatensis L., P. reticulatus Poir., P. polyphyllus Willd., P. emblica L., P. indofischerii Bennet. and P. acidus (L.) Skeels. MATERIALS AND METHODS: The dried leaves and stems of each plant species were extracted in methanol and successively in water. The extracts were screened for hepatoprotective activity at a concentration of 50 µg/mL against tert-butyl hydroperoxide (t-BH) induced toxicity in HepG2 cells. Seven extracts from five species that showed hepatoprotective activity were assessed for their 50% effective concentration (EC50) values and their antioxidant activity using a DPPH assay. Phyllanthin and hypophyllanthin contents were also determined in these Phyllanthus species. RESULTS: The methanol extracts of P. polyphyllus, P. emblica and P. indofischeri showed high levels of hepatoprotective activity with EC50 values of 12, 19 and 28 µg/mL and IC50 of 3.77, 3.38 and 5.8 µg/mL for DPPH scavenging activity respectively against an IC50 of 3.69 µg/mL for ascorbic acid. None of these activities could be attributed to phyllanthin and hypophyllanthin. DISCUSSION AND CONCLUSION: The hepatoprotective and antioxidant activities of P. indofischeri are demonstrated for the first time in literature. The study also confirms the hepatoprotective and antioxidant activities of leaves of P. emblica and P. polyphyllus. The molecule(s) responsible for the activities is being investigated.

Assessing species admixtures in raw drug trade of Phyllanthus, a hepato-protective plant using molecular tools.

ETHNOPHARMACOLOGICAL RELEVANCE: Phyllanthus (Euphorbiaceae) species are well known for their hepato-protective activity and are used in several ethno-medicines in indigenous health care systems in India. AIM OF THE STUDY: To assess species admixtures in raw drug trade of Phyllanthus using morphological and DNA barcoding tools. MATERIALS AND METHODS: Samples of Phyllanthus used in raw drug trade were obtained from 25 shops in southern India. Species admixtures in the samples were assessed by identifying species using morpho-taxonomic keys. These identities were further validated by developing species specific DNA barcode signatures using the chloroplast DNA region, psbA-trnH. DNA from the market samples were extracted and amplified using the forward (psbAF - GTTATGCATGAACGTAATGCTC) and reverse primer (trnHR - CGCGCATGGTGGATTCACAAATC). The amplified products were sequenced at Chromous Biotech India, Bangalore. The sequences were manually edited using Chromas Lite. Species identities were established by constructing a neighbor-joining tree using MEGA V 4.0. RESULTS: Morphological analysis of market samples revealed six different species of Phyllanthus in the trade samples. Seventy-six percent of the market samples contained Phyllanthus amarus as the predominant species (>95%) and thus were devoid of admixtures. The remaining 24% of the shops had five different species of Phyllanthus namely Phyllanthus debilis, Phyllanthus fraternus, Phyllanthus urinaria, Phyllanthus maderaspatensis, and Phyllanthus kozhikodianus. All identities, except those for Phyllanthus fraternus, were further confirmed by the species specific DNA barcode using chloroplast region psbA-trnH. CONCLUSION: Our results show that market samples of Phyllanthus sold in southern India contain at least six different species, though among them, Phyllanthus amarus is predominant. DNA barcode, psbA-trnH region of the chloroplast can effectively discriminate Phyllanthus species and hence can be used to resolve species admixtures in the raw drug trade of Phyllanthus.

Phytochrome regulation of branching in Arabidopsis.

The red light:far-red light ratio perceived by phytochromes controls plastic traits of plant architecture, including branching. Despite the significance of branching for plant fitness and productivity, there is little quantitative and mechanistic information concerning phytochrome control of branching responses in Arabidopsis (Arabidopsis thaliana). Here, we show that in Arabidopsis, the negative effects of the phytochrome B mutation and of low red light:far-red light ratio on branching were largely due to reduced bud outgrowth capacity and an increased degree of correlative inhibition acting on the buds rather than due to a reduced number of leaves and buds available for branching. Phytochrome effects on the degree of correlative inhibition required functional BRANCHED1 (BRC1), BRC2, AXR1, MORE AXILLARY GROWTH2 (MAX2), and MAX4. The analysis of gene expression in selected buds indicated that BRC1 and BRC2 are part of different gene networks. The BRC1 network is linked to the growth capacity of specific buds, while the BRC2 network is associated with coordination of growth among branches. We conclude that the branching integrators BRC1 and BRC2 are necessary for responses to phytochrome, but they contribute differentially to these responses, likely acting through divergent pathways.

Development of polymorphic microsatellite loci in Nothapodytes nimmoniana, a medicinally important tree from the Western Ghats, India.

Nothapodytes nimmoniana is a medicinally important tree species that occur in the Western Ghats, a megadiversity hotspot in southern India. Inner stem bark of the tree contains an important anti-cancer alkaloid, camptothecin for which the natural population of the tree is heavily harvested. In this paper, we report the isolation and characterization of eight polymorphic microsatellite loci using enrichment hybridization protocol. Analysis of 36 individuals representing two populations revealed three to 12 alleles per locus. Observed heterozygosity ranged from 0.21 to 0.94 for the two populations. None of the loci tested showed linkage disequilibrium. These markers are invaluable for evaluating the genetic structure and assessing the genetic impacts of harvesting of N. nimmoniana in the Western Ghats to formulate strategies for conservation of the species.