DNase I footprinting of the nucleosome in whole nuclei.

DNase I was used to footprint the 147 bp DNA fragment of the nucleosome in whole chicken erythrocyte nuclei. It was found that the higher-order structure imposes an additional protection on nucleosomes at sites close to the entry and exit points of the linker DNA, around the dyad axis (site S 0). The observed protection is extended up to 20 bp on either side of S 0. It is partial (approximately 50%) and most probably reflects a full protection of different regions in alternatively oriented nucleosomes. These are the same regions which interact with linker histones. The results strongly support the findings by simulation of DNase I digests of unlabelled oligonucleosome fragments in the 30 nm fibre that in all nucleosomes sites S -5 to S -3 and S +3 to S +5 ara on the outside of the fibre exposed to DNase I.

Topological constraints on the possible structures of the 30 nm chromatin fibre.

The packing of mammalian DNA into chromatin plays an important role in cell differentiation and selection of epigenetically marked genes for expression or silencing. The first level of folding, the nucleosome, is evolutionary conserved. It allows transcription, after remodeling and/or histone modifications. The second level, the transcriptionally dormant 30 nm fibre, exhibits species and tissue variations in the chromatin repeat length. Nevertheless, very similar structures of fibres have been observed in all metazoans, and therefore, have to accommodate variable linker lengths with a corresponding change of tilt of the nucleosomes, which is defined by the DNA helical periodicity. So far, none of the models for a regular fibre structure has considered this requirement nor the relationship between repeat length and orientations of nucleosomes in the fibre. Here, we present two regular structural arrangements with negatively tilted consecutive nucleosomes which can compensate for a non-integer number of bp/turn of DNA; one can accommodate a series of structures with discrete repeat lengths differing by 5 bp in the region around 200 bp and the other from around 220 to 250 bp, accommodating repeat lengths differing by 10 to 12 bp.

Redefinition of the cleavage sites of DNase I on the nucleosome core particle.

DNase I has been widely used for the footprinting of DNA-protein interactions including analyses of nucleosome core particle (NCP) structure. Our understanding of the relationship between the footprint and the structure of the nucleosome complex comes mainly from digestion studies of NCPs, since they have a well-defined quasi-symmetrical structure and have been widely investigated. However, several recent results suggest that the established consensus of opinion regarding the mode of digestion of NCPs by DNase I may be based on erroneous interpretation of results concerning the relationship between the NCP ends and the dyad axis. Here, we have used reconstituted NCPs with defined ends, bulk NCPs prepared with micrococcal nuclease and molecular modelling to reassess the mode of DNase I digestion. Our results indicate that DNase I cuts the two strands of the nucleosomal DNA independently with an average stagger of 4 nt with the 3'-ends protruding. The previously accepted value of 2 nt stagger is explained by the finding that micrococcal nuclease produces NCPs not with flush ends, but with approximately 1 nt 5'-recessed ends. Furthermore we explain why the DNA stagger is an even and not an odd number of nucleotides. These results are important for studies using DNase I to probe nucleosome structure in complex with other proteins or any DNA-protein complex containing B-form DNA. We also determine the origin of the 10n +/- 5 nt periodicity found in the internucleosomal ladder of DNase I digests of chromatin from various species. The explanation of the 10n +/- 5 nt ladder may have implications for the structure of the 30 nm fibre.

Suppression of granulocyte-macrophage colony-stimulating factor expression by glucocorticoids involves inhibition of enhancer function by the glucocorticoid receptor binding to composite NF-AT/activator protein-1 elements.

Increased expression of a number of cytokines including GM-CSF is associated with chronic inflammatory conditions such as bronchial asthma. Glucocorticoid therapy results in suppression of cytokine levels by a mechanism(s) not yet fully understood. We have examined regulation of GM-CSF expression by the synthetic glucocorticoid dexamethasone in human T cells. Transient transfection assays with reporter constructs revealed that dexamethasone inhibited the function of the GM-CSF enhancer, but had no effect on regulation of GM-CSF expression occurring through the proximal promoter. Activation of the GM-CSF enhancer involves cooperative interaction between the transcription factors NF-AT and AP-1. We demonstrate here that glucocorticoid-mediated inhibition of enhancer function involves glucocorticoid receptor (GR) binding to the NF-AT/AP-1 sites. These elements, which do not constitute recognizable glucocorticoid response elements, support binding of the GR, primarily as a dimer. This binding correlates with the ability of dexamethasone to inhibit enhancer activity of the NF-AT/AP-1 elements, suggesting a competition between NF-AT/AP-1 proteins and GR.

DNase I digestion reveals alternating asymmetrical protection of the nucleosome by the higher order chromatin structure.

DNase I was used to probe the higher order chromatin structure in whole nuclei. The digestion profiles obtained were the result of single-stranded cuts and were independent of pH, type of divalent ion and chromatin repeat length. Furthermore, the protection from digestion of the DNA at the entry/exit points on the nucleosome was found to be caused not by the H1/H5 histone tails, but by the compact structure that these proteins support. In order to resolve symmetry ambiguities, DNase I digestion fragments over several nucleosome repeat lengths were analysed quantitatively and compared with computer simulations using combinations of the experimentally obtained rate constants (some of which were converted to 0 to simulate steric protection from DNase I digestion). A clear picture of precisely defined, alternating, asymmetrically protected nucleosomes emerged. The linker DNA is inside the fibre, while the nucleosomes are positioned above and below a helical path and/or with alternating orientation towards the dyad axis. The dinucleosomal modulation of the digestion patterns comes from alternate protection of cutting sites inside the nucleosome and not from alternating exposure to the enzyme of the linker DNA.

Glucocorticoid resistance in asthma is associated with elevated in vivo expression of the glucocorticoid receptor beta-isoform.

BACKGROUND: Glucocorticoid-resistant bronchial asthma is characterized by failure of corticosteroids to suppress key asthma-relevant, cell-mediated inflammatory responses in the airways. OBJECTIVE: The mechanism of this phenomenon is not clear but may involve aberrant expression of the beta-isoform of the glucocorticoid receptor. METHODS: We have measured expression of the alpha- and beta-glucocorticoid receptor isoforms in tuberculin-driven cutaneous cell-mediated inflammatory lesions in people with asthma who are glucocorticoid sensitive and resistant after 9 days of therapy with oral prednisolone (40 mg/day) or matching placebo in a random order, crossover design. RESULTS: After placebo therapy, the mean numbers of cells expressing glucocorticoid receptor alpha immunoreactivity in the lesions evoked in glucocorticoid-sensitive and -resistant patients with asthma were statistically equivalent. The numbers of cells expressing glucocorticoid receptor beta were significantly elevated in the patients who were glucocorticoid resistant, resulting in an 8-fold higher ratio of expression of glucocorticoid receptor alpha/glucocorticoid receptor beta in the patients who were glucocorticoid sensitive. Glucocorticoid receptor alpha/glucocorticoid receptors beta were colocalized to the same cells. Oral prednisolone therapy was associated with a significant decrease in the numbers of cells expressing glucocorticoid receptor alpha but not glucocorticoid receptor beta in the subjects who were glucocorticoid sensitive. No significant change was found in the numbers of cells expressing glucocorticoid receptor alpha and glucocorticoid receptor beta in the patients who were glucocorticoid resistant. Prednisolone therapy reduced the ratio of glucocorticoid receptor alpha/glucocorticoid receptor beta expression for the patients who were glucocorticoid sensitive to a level seen in the patients who were glucocorticoid resistant before therapy. CONCLUSION: Because glucocorticoid receptor beta inhibits alpha-glucocorticoid receptor-mediated transactivation of target genes, the increased expression of glucocorticoid receptor beta in inflammatory cells might be a critical mechanism for conferring glucocorticoid resistance.

DNase I footprinting of the human interleukin-5 gene promoter.

A characteristic feature of allergic asthma is the overexpression of the T helper type 2 (Th2) cytokines interleukin-4 (IL-4), IL-5 and IL-13 by T lymphocytes. Of these cytokines, IL-5 is critical for the growth, survival and recruitment of eosinophils which are thought to be responsible for the tissue damage observed in asthmatic airways. The expression of human IL-5 is primarily regulated at the transcriptional level; however, little is known about the mechanisms that control its transcription. Using nuclear extracts from allergen-specific human T-cell clones we have performed DNase I footprinting of the human IL-5 promoter in order to establish sites occupied by transcription factors. We show footprints covering the conserved lymphokine element 0 ¿(CLE0) -60 to -44 base pairs (bp) and GATA (-73 to -62 bp) elements, which have previously been identified to be important in the regulation of the murine IL-5 promoter. We also describe a footprint covering a considerably extended Octamer binding site (-249 to -217 bp), which encompasses two hitherto unidentified CCAAT/enhancer binding protein consensus binding sites. We have also identified a previously unknown Ets binding site (-274 to -264 bp). These novel data on the regions of the human IL-5 promoter that are bound by transcription factors should allow dissection of the regulatory mechanisms involved in the transcription of IL-5 in the T-helper lymphocytes of asthmatics.

Intergenic transcription occurs throughout the human IL-4/IL-13 gene cluster.

Recent experiments have shown that the previously identified elements in the proximal promoter of IL-4 are not sufficient to fully explain the regulation of its transcription. Consequently we examined another aspect of transcriptional regulation, intergenic transcription, which has been observed throughout the prototypic gene cluster of human beta-globin. These intergenic transcripts are nuclear and it is possible that they play an important functional role in the beta-globin locus. Here we show that intergenic transcription also occurs in the IL-4/IL-13 gene cluster. Intergenic transcription occurs when the surrounding genes are not transcriptionally active; it also occurs in the promoters of these genes; the transcripts are polyadenylated and they remain in the nucleus. We also show that, in HeLa cells which do not express IL-4 or IL-13, intergenic transcription is absent from the region immediately surrounding the genes. This suggests a role for intergenic transcription in the regulation of the IL-4/IL-13 gene cluster.

Quantitative analysis of DNase I digestion patterns of oligo- and polynucleosomes.

DNase I digestion of unlabelled chromatin has been used to determine the orientation of nucleosomes in the higher-order structure of chromatin. DNA digestion patterns were analysed quantitatively and compared with simulation curves that were generated with the experimentally obtained rate constants for cutting inside nucleosomes and the half-height widths of the bands. The rate constants for cutting at the linker DNA were varied to fit the experimental curves. By comparing the digestion profiles of polynucleosomes, oligonucleosomes and H1/H5-depleted oligonucleosomes we have been able to distinguish between protection caused by H1/H5 histones only and protection caused by the higher-order structure. By the nature of this method the area protected by H1/H5 histones appears symmetrical around the centre of the nucleosomal DNA on the dyad axis (position S[0]), but it can also be interpreted as a superposition of two separate protected areas that are symmetrical around position S[0]. Protection by the higher-order structure shows that the nucleosomes are oriented with their S[0] positions inside the 30 nm fibre and that there is a minimum number of nucleosomes required for this structure to be formed. We have also found that the linker DNA is cut in a continuous (non-periodical) way and that there are considerable amounts of nucleosomes at discrete distances of multiples of ten nucleotides (10a nt) as well as stretches of nucleosomes positioned either at random or at distances of (10a + 5)nt.

A conserved motif in the promoters of several cytokines expressed by human Th2-type lymphocytes.

We have recently found a novel conserved motif in the promoters of several T-cell-expressed cytokines [human interleukin-2, -4, -5 and -13 and human and mouse granulocyte/macrophage-colony stimulating factor (GM-CSF)]. It contains a core sequence CTTGG ... CCAAG which is present as part of larger palindromic sequences in each gene. This suggest that they may interact with a new family of trans-acting factors. In transfection assays, the human GM-CSF element has a strong positive effect on the expression of a reporter gene by the human T cell line Jurkat J6 upon stimulation. In DNA mobility shift assays, this sequence can give either six different specific bands which are competed out by different parts of the sequence or one specific band which is competed out by each of the inverted repeats, depending on the reconstitution conditions. In different genes, the core sequences are separated by integer numbers of helical turns. Considering the strong positive regulatory effect of this element and its presence in several T-cell-expressed cytokine genes, it may be crucial to the coordinated expression of these cytokines in T helper cells.

A regulatory element in the promoter of the human granulocyte-macrophage colony-stimulating factor gene that has related sequences in other T-cell-expressed cytokine genes.

Granulocyte-macrophage colony-stimulating factor (GM-CSF) is a cytokine with a broad spectrum of cell-differentiating and colony-stimulating activities. It is expressed by several undifferentiated (bone marrow stromal cells, fibroblasts) and fully differentiated (T cells, macrophages, and endothelial cells) cells. Its expression in T cells is activation dependent. We have found a regulatory element in the promoter of the GM-CSF gene which contains two symmetrically nested inverted repeats (-192 CTTGGAAAGGTTCATTAATGAAAACCCCCAAG -161). In transfection assays with the human GM-CSF promoter, this element has a strong positive effect on the expression of a reporter gene by the human T-cell line Jurkat J6 upon stimulation with phorbol dibutyrate and ionomycin or anti-CD3 antibody. This element also acts as an enhancer when inserted into a minimal promoter vector. In DNA band-retardation assays this sequence produces six specific bands that involve one or the other of the inverted repeats. We have also shown that a DNA-protein complex can be formed involving both repeats and probably more than one protein. The external inverted repeat contains a core sequence CTTGG...CCAAG, which is also present in the promoters of several other T-cell-expressed human cytokines (interleukins 4, 5, and 13). The corresponding elements in GM-CSF and interleukin 5 promoters compete for the same proteins in band-retardation assays. The palindromic elements in these genes are larger than the core sequence, suggesting that some of the interacting proteins may be different for different genes. Considering the strong positive regulatory effect and their presence in several T-cell-expressed cytokine genes, these elements may be involved in the coordinated expression of these cytokines in T-helper cells.

Regulation of interleukin-5 and granulocyte-macrophage colony-stimulating factor expression.

This review concerns the regulation of expression of the two main eosinophil differentiating factors, interleukin-5 (IL-5) and granulocyte-macrophage colony-stimulating factor (GM-CSF). The latter, GM-CSF, is expressed in a wide variety of differentiated and non-differentiated cell types: T cells, monocytes, macrophages, fibroblasts, and endothelial cells. On the other hand, IL-5 is only expressed by a limited number of fully differentiated cells: eosinophils, mast cells, and a subset of T cells. Activation of GM-CSF in T cells and non-T cells occurs by different mechanisms, regulated both transcriptionally and post-transcriptionally. The transcriptional activation of GM-CSF via protein kinase C pathway and via viral transactivating proteins involves different regulatory elements of its promoter. Although one of these cis acting elements is common to IL-5, the activation of IL-5 apparently proceeds via different mechanism(s).

Chemical mutational analysis of the human glucocorticoid receptor cDNA in glucocorticoid-resistant bronchial asthma.

Corticosteroid-resistant (CR) asthma is not caused by altered bioavailability of the administered drug, altered ligand-binding characteristics, or altered nuclear translocation of the activated human glucocorticoid receptor (hGR) complex. We have tested the hypothesis that CR asthma results from a consistent polymorphism in the functionally diverse hGR cDNA using the sensitive screening technique of polymerase chain reaction (PCR) amplification and chemical mutational analysis. Total RNA was extracted from peripheral blood monocytes derived from six corticosteroid-sensitive (CS) and six CR asthmatic subjects. The RNA was reverse transcribed, and overlapping hGR cDNA fragments were amplified by nested PCR. Double-stranded hGR cDNA fragments were hybridized to corresponding 32P-5'-labeled wild-type fragments, chemically modified with osmium and hydroxylamine, and cleaved with piperidine. The resultant cleaved strands were detected by autoradiography. As controls, single base pair mutated hGR cDNA fragments sensitive to hydroxylamine and osmium modification were used. Using this technique, we did not detect any base pair mismatch between the six CS and six CR patients and the corresponding wild-type hGR, despite a 100% detection of control mutations. We conclude that the defect in CR asthma does not lie in the structure of the hGR.

Elimination of IgE regulatory rat CD8+ T cells in vivo increases the co-ordinate expression of Th2 cytokines IL-4, IL-5 and IL-10.

Immunization of rats with soluble antigen (ovalbumin) and the castor bean toxin, ricin, eliminates a subpopulation of CD8+ T cells which suppress IgE responses in vivo. This treatment also reduces the ability of splenic T cells to produce interferon-gamma (IFN-gamma) and enhances their capacity to make interleukin-4 (IL-4). In this report we describe the effect of immunization with ricin and antigen on the expression of mRNA for other T-helper type 2 (Th2) cytokines--IL-5 and IL-10--and their relationship to serum IgE and IL-4 mRNA expression. Splenocytes were taken from rats at different times after immunization with antigen or ricin and antigen and activated in vitro with phorbol myristate acetate (PMA) and ionomycin for 6 hr and total RNA extracted and reverse transcribed. Cytokine gene expression was detected using a quantitative polymerase chain reaction (PCR). Expression of IL-4, IL-5, and IL-10 was increased 7-20-fold 11 days after immunization with ricin and antigen (from 0.107% to 0.769% beta-actin for IL-4, from 0.0167% to 0.381% beta-actin for IL-5, and from 0.0581% to 0.954% beta-actin for IL-10), and preceded maximum serum IgE levels by 4-5 days. There was no increase in IgE or mRNA for these cytokines in rats immunized with antigen alone. The level of IL-4, IL-5, and IL-10 expression declined rapidly after 12 days. Our results suggest that immunization with antigen and ricin preferentially induces a Th2 response, and that CD8+ T cells may play a part in down-regulating the development of Th2 T cells.

Generation of rat Th2-like cells in vitro is interleukin-4-dependent and inhibited by interferon-gamma.

Differentiation of naive T cells into effector cells producing T helper type 1 (Th1) and Th2 cytokines is regulated by the presence of specific cytokines in the T-cell microenvironment. The effect of interferon-gamma (IFN-gamma) and interleukin-4 (IL-4) on Th1- and Th2-like cell development was investigated in cultures of mixed rat spleen cells. These cells were cultured for 4 days in medium containing concanavalin A (Con A) with or without additional IL-2, IFN-gamma or IL-4. The cells were then washed and their capacity to produce IL-4, IL-5 and IFN-gamma determined following stimulation with phorbol 12-myristate 13-acetate (PMA) and ionomycin. Freshly isolated cells stimulated with PMA and ionomycin expressed detectable levels of IL-4 and IL-5 mRNA as measured by a quantitative polymerase chain reaction (PCR) procedure and much higher levels of IFN-gamma mRNA. Cells cultured with Con A for 4 days, washed, and restimulated with PMA + ionomycin were unable to express detectable levels of IL-4 and IL-5 mRNA, but produced high levels of IFN-gamma mRNA. Addition of IL-4, or anti-IFN-gamma antibody, to Con A-driven splenocyte cultures restored the ability of restimulated cells to express IL-4 and IL-5. CD4+ T cells isolated from these cultures also showed an increased capacity to secrete IL-4 and IL-5 when anti-IFN-gamma and IL-4 were present in the culture medium. When cultured for 4 days with Con-A, IL-4 and anti-IFN-gamma splenocytes showed an increased capacity to proliferate in response to recombinant IL-2 and proliferated in response to IL-4 alone. IL-2 had no effect on cytokine production by cultured splenocytes. These results indicate that: (1) IL-4 is essential for the generation of Th2-like cells; (2) IFN-gamma inhibits IL-4 production by mixed spleen cells and suppresses generation of IL-4 responsive T cells; (3) in mixed spleen cell cultures mitogenic stimulation favours differentiation of naive rat T cells into effector cells expressing a Th1, and not Th2, cytokine profile.

Elimination of IgE regulatory rat CD8+ T cells in vivo differentially modulates interleukin-4 and interferon-gamma but not interleukin-2 production by splenic T cells.

Intraperitoneal immunization of Hooded Lister rats with a soluble antigen such as bee venom phospholipase A2 (PLA2), or ovalbumin (OVA) together with the toxic lectin, ricin, eliminates a population of early-activated CD8+ T cells which regulate IgE production. These early-activated CD8+ T cells are eliminated because they bear increased ricin-binding glycoproteins on their surface. This immunization regimen produces a vigorous and long-lived IgE response. The effect of this treatment on the capacity of splenic T cells to secrete interferon-gamma (IFN-gamma), interleukin-2 (IL-2) and to generate IL-4 RNA message was assessed. IFN-gamma production by phytohaemagglutinin (PHA)- or ionomycin and phorbol myristate acetate (PMA)-stimulated splenocytes or purified splenic T cells from animals immunized with antigen and ricin was substantially reduced as compared with animals which were given saline or antigen alone (P < 0.001 Student's t-test). At the height of the primary IgE response IFN-gamma production by PHA-stimulated splenocytes was positively correlated with the number of CD8+ T cells (r = 0.90, P < 0.001) and inversely related to the level of serum IgE (r = -0.77, P < 0.020); serum IgE was inversely related to the number of CD8+ T cells (r = -0.92, P < 0.001). The reduced capacity of spleen cells from ricin and antigen immunized rats to produce IFN-gamma was first seen 7 days after immunization. The fall in the ability of splenocytes to secrete IFN-gamma closely paralleled the rise in serum IgE. IL-2 was assayed using an IL-2-dependent cell line which responded to rat IL-2 but not IL-4. Production of IL-2 by splenocytes taken from rats immunized with ricin+antigen was not significantly different to that produced by comparable cells obtained from animals immunized with antigen alone or saline. However, the levels of IL-4 mRNA, detected in ionomycin and PMA-stimulated splenocytes using a quantitative polymerase chain reaction (PCR) procedure, were three- to fourfold higher in ricin and antigen immunized animals as compared with control animals. Following boosting with antigen and ricin the levels of IL-4 message detected increased a further three- to fourfold. These data show that the potentiated IgE response produced by immunization with antigen+ricin is associated with a decreased ability of splenocytes to produce IFN-gamma and an increased capacity to make IL-4.

Expression of interleukin-5 and granulocyte-macrophage colony-stimulating factor in human peripheral blood mononuclear cells after activation with phorbol myristate acetate.

The expression of interleukin-5 (IL-5) and granulocyte-macrophage colony-stimulating factor (GM-CSF) was studied in peripheral blood mononuclear cells (PBMC) from atopic and non-atopic subjects after activation with phorbol 12-myristate 13-acetate (PMA). The levels of IL-5 and GM-CSF mRNA were monitored by quantitative polymerase chain reaction (PCR). IL-5 and GM-CSF mRNA was undetectable in quiescent cells. Following PMA stimulation, some atopic patients showed considerably higher levels of IL-5 and GM-CSF mRNA expression than the non-atopic subjects, and there was a significant correlation between the levels of these two cytokines. It was found that activation of IL-5 expression in PBMC requires protein synthesis as does activation of GM-CSF expression, and that PMA is only required during the first few hours of activation. The kinetics of activation indicated that the level of both mRNA increased over 15 hr and remained constant for another 20 hr. The accumulation of IL-5 mRNA lagged about 3 hr behind GM-CSF mRNA accumulation, suggesting that the expression of these two genes is regulated separately. However, GM-CSF expression was not required for IL-5 activation.

Footprinting of linker histones H5 and H1 on the nucleosome.

DNase I has been used to footprint the linker histones H5 and H1 on the nucleosome of chicken erythrocyte chromatin. Rate constants have been derived for digestion at the principal sites of attack on chromatosome length DNA (168 bp), located about 10 bp apart, and compared with those observed for linker histone-depleted chromatosomes. Complete protection was found for site S7 on the dyad axis and decreasing partial protection seen at symmetrically positioned sites on each side of S7. Strong, but not complete protection was noted at S14, the site corresponding to the end of the core particle, situated less than 1/4 of a turn away from the dyad. Uniform partial protection was observed for sites S2, S3, S4 and S10, S12 on the far side of the chromatosome. The simplest interpretation of these results is that the globular domain of H5/H1 is responsible for the protection at S7, whilst extended N- and C-domains give rise to the partial protection at sites away from the dyad axis.

Nuclease digestion patterns as a criterion for nucleosome orientation in the higher order structure of chromatin.

Nuclease digestion patterns have been used to discriminate between possible orientations of nucleosomes in the higher order structure of chromatin. Computer simulations were done assuming 3 basically different orientations of nucleosomes which include all proposed models for the '30 nm fibre'. It is found that only alternating exposure of consecutive nucleosomes can explain the DNase I and DNase II digestion patterns.