Chronic glucocorticoid management in neuromuscular disease: A survey of neuromuscular neurologists.

INTRODUCTION/AIMS: Glucocorticoids (GC) are first-line therapy for many neuromuscular diseases. There is a lack of guidelines regarding the prevention and management of GC complications in the context of neuromuscular disease, introducing the potential for practice variation, that may compromise quality of care. Our aim was to evaluate the practice patterns among Canadian adult neuromuscular neurologists on the screening, management, and treatment of GC-related complications and to identify variances in practice. METHODS: A web-based anonymous questionnaire was disseminated to 99 Canadian adult neuromuscular neurologists. Questions addressed patterns of screening, prevention, monitoring, and treatment of GC-induced adverse events, including infection prophylaxis, vaccination, bone health, hyperglycemia, and other complications. RESULTS: Seventy-one percent completed the survey. Of those, 52% perform screening blood work prior to initiating GC, 56% screen for infections, and 18% for osteoporosis. The majority monitor glycemic control and blood pressure (>85%). Thirty-two (46%) reported that they do not primarily monitor GC complications, but rather provide recommendations to the primary care physician. Pneumocystis jiroveci pneumonia prophylaxis was never used by 29%, and 29% recommend vaccinations prior to GC initiation. Calcium supplementation was recommended by 80% to prevent osteoporosis. Only 36% were aware of any existing guidelines for preventing GC complications, and 91% endorsed a need for neurology-specific guidelines. DISCUSSION: There is substantial variability in the management of GC adverse effects among neuromuscular neurologists, often not corresponding to limited published literature. Our results support the need for improved education and neurology-specific guidelines to help standardize practice and improve and prevent complications.

Binding of l-Argininamide to a DNA Aptamer: A Volumetric Study.

We use a combination of volumetric and spectroscopic techniques to characterize the binding of l-argininamide to its aptamer, the 24-base DNA hairpin 5'-d(GATCGAAACGTAGCGCCTTCGATC)-3'. The binding causes increases in volume, Δ V, and adiabatic compressibility, Δ KS, of 12 ± 7 cm3 mol-1 bar and (73 ± 8) × 10-4 cm3 mol-1 bar-1, respectively. These volumetric results combined with structural data reveal that the binding is accompanied by release of 73 ± 27 waters from the hydration shells of the interacting molecules to the bulk. We use the estimated change in hydration to estimate the hydration, Δ Shyd, and configurational, Δ Sconf, contributions to the binding entropy. The large and unfavorable change in configurational entropy, Δ Sconf, is nearly compensated by a favorable change in the hydration contribution, Δ Shyd.

Effect of urea on protein-ligand association.

We combine experimental and theoretical approaches to investigate the influence of a cosolvent on a ligand-protein association event. We apply fluorescence measurements to determining the affinity of the inhibitor tri-N-acetylglucosamine [(GlcNAc)3] for lysozyme at urea concentrations ranging from 0 to 8M. Notwithstanding that, at room temperature and neutral pH, lysozyme retains its native conformation up to the solubility limit of urea, the affinity of (GlcNAc)3 for the protein steadily decreases as the concentration of urea increases. We analyze the urea dependence of the binding free energy within the framework of a simplified statistical thermodynamics-based model that accounts for the excluded volume effect and direct solute-solvent interactions. The analysis reveals that the detrimental action of urea on the inhibitor-lysozyme binding originates from competition between the free energy contributions of the excluded volume effect and direct solute-solvent interactions. The free energy contribution of direct urea-solute interactions narrowly overcomes the excluded volume contribution thereby resulting in urea weakening the protein-ligand association. More broadly, the successful application of the simple model employed in this work points to the possibility of its use in quantifying the stabilizing/destabilizing action of individual cosolvents on biochemical folding and binding reactions.