Your browser doesn't support javascript.
loading
Show: 20 | 50 | 100
Results 1 - 20 de 194
Filter
1.
Plant Cell Rep ; 43(6): 162, 2024 Jun 05.
Article in English | MEDLINE | ID: mdl-38837057

ABSTRACT

KEY MESSAGE: A robust agroinfiltration-mediated transient gene expression method for soybean leaves was developed. Plant genotype, developmental stage and leaf age, surfactant, and Agrobacterium culture conditions are important for successful agroinfiltration. Agroinfiltration of Nicotiana benthamiana has emerged as a workhorse transient assay for plant biotechnology and synthetic biology to test the performance of gene constructs in dicot leaves. While effective, it is nonetheless often desirable to assay transgene constructs directly in crop species. To that end, we innovated a substantially robust agroinfiltration method for Glycine max (soybean), the most widely grown dicot crop plant in the world. Several factors were found to be relevant to successful soybean leaf agroinfiltration, including genotype, surfactant, developmental stage, and Agrobacterium strain and culture medium. Our optimized protocol involved a multi-step Agrobacterium culturing process with appropriate expression vectors, Silwet L-77 as the surfactant, selection of fully expanded leaves in the VC or V1 stage of growth, and 5 min of vacuum at - 85 kPa followed by a dark incubation period before plants were returned to normal growth conditions. Using this method, young soybean leaves of two lines-V17-0799DT, and TN16-5004-were high expressors for GUS, two co-expressed fluorescent protein genes, and the RUBY reporter product, betalain. This work not only represents a new research tool for soybean biotechnology, but also indicates critical parameters for guiding agroinfiltration optimization for other crop species. We speculate that leaf developmental stage might be the most critical factor for successful agroinfiltration.


Subject(s)
Agrobacterium , Glycine max , Plant Leaves , Plants, Genetically Modified , Glycine max/genetics , Glycine max/microbiology , Glycine max/growth & development , Plant Leaves/genetics , Plant Leaves/metabolism , Agrobacterium/genetics , Gene Expression Regulation, Plant , Nicotiana/genetics , Genetic Vectors/genetics
2.
Front Plant Sci ; 15: 1346853, 2024.
Article in English | MEDLINE | ID: mdl-38495374

ABSTRACT

The impact of water-deficit (WD) stress on plant metabolism has been predominantly studied at the whole tissue level. However, plant tissues are made of several distinct cell types with unique and differentiated functions, which limits whole tissue 'omics'-based studies to determine only an averaged molecular signature arising from multiple cell types. Advancements in spatial omics technologies provide an opportunity to understand the molecular mechanisms underlying plant responses to WD stress at distinct cell-type levels. Here, we studied the spatiotemporal metabolic responses of two poplar (Populus tremula× P. alba) leaf cell types -palisade and vascular cells- to WD stress using matrix-assisted laser desorption/ionization-mass spectrometry imaging (MALDI-MSI). We identified unique WD stress-mediated metabolic shifts in each leaf cell type when exposed to early and prolonged WD stresses and recovery from stress. During water-limited conditions, flavonoids and phenolic metabolites were exclusively accumulated in leaf palisade cells. However, vascular cells mainly accumulated sugars and fatty acids during stress and recovery conditions, respectively, highlighting the functional divergence of leaf cell types in response to WD stress. By comparing our MALDI-MSI metabolic data with whole leaf tissue gas chromatography-mass spectrometry (GC-MS)-based metabolic profile, we identified only a few metabolites including monosaccharides, hexose phosphates, and palmitic acid that showed a similar accumulation trend at both cell-type and whole leaf tissue levels. Overall, this work highlights the potential of the MSI approach to complement the whole tissue-based metabolomics techniques and provides a novel spatiotemporal understanding of plant metabolic responses to WD stress. This will help engineer specific metabolic pathways at a cellular level in strategic perennial trees like poplars to help withstand future aberrations in environmental conditions and to increase bioenergy sustainability.

3.
Plant Cell Rep ; 43(3): 69, 2024 Feb 12.
Article in English | MEDLINE | ID: mdl-38345745

ABSTRACT

KEY MESSAGE: Water deficit-inducible synthetic promoters, SD9-2 and SD18-1, designed for use in the dicot poplar, are functional in the monocot crop, rice.


Subject(s)
Oryza , Oryza/genetics , Droughts , Plants, Genetically Modified/genetics , Promoter Regions, Genetic/genetics , Gene Expression Regulation, Plant
4.
Nat Commun ; 15(1): 1817, 2024 Feb 28.
Article in English | MEDLINE | ID: mdl-38418817

ABSTRACT

Plants and microbes communicate to collaborate to stop pests, scavenge nutrients, and react to environmental change. Microbiota consisting of thousands of species interact with each other and plants using a large chemical language that is interpreted by complex regulatory networks. In this work, we develop modular interkingdom communication channels, enabling bacteria to convey environmental stimuli to plants. We introduce a "sender device" in Pseudomonas putida and Klebsiella pneumoniae, that produces the small molecule p-coumaroyl-homoserine lactone (pC-HSL) when the output of a sensor or circuit turns on. This molecule triggers a "receiver device" in the plant to activate gene expression. We validate this system in Arabidopsis thaliana and Solanum tuberosum (potato) grown hydroponically and in soil, demonstrating its modularity by swapping bacteria that process different stimuli, including IPTG, aTc and arsenic. Programmable communication channels between bacteria and plants will enable microbial sentinels to transmit information to crops and provide the building blocks for designing artificial consortia.


Subject(s)
Arabidopsis , Microbiota , Pseudomonas putida , Solanum tuberosum , Arabidopsis/genetics , Crops, Agricultural
5.
Trends Plant Sci ; 29(2): 126-129, 2024 02.
Article in English | MEDLINE | ID: mdl-37778886

ABSTRACT

Plant metabolic engineering must take into consideration the heterogeneous cell types that play a role in metabolite production; cells do not participate equally. We posit that artificial intelligence (AI) developed for biomedical purposes can be applied to plant cell characterization to accelerate the development of metabolic engineering strategies in plants.


Subject(s)
Metabolic Engineering , Plant Cells , Plant Cells/metabolism , Artificial Intelligence , Plants/genetics , Plants/metabolism
6.
Plant Cell Rep ; 43(1): 22, 2023 Dec 27.
Article in English | MEDLINE | ID: mdl-38150091

ABSTRACT

KEY MESSAGE: A novel plant binary expression system was developed from the compactin biosynthetic pathway 27 of Penicillium citrinum ML-236B. The system achieved >fivefold activation of gene expression in 28 transgenic tobacco. A diverse and well-characterized genetic toolset is fundamental to achieve the overall goals of plant synthetic biology. To properly coordinate expression of a multigene pathway, this toolset should include binary systems that control gene expression at the level of transcription. In plants, few highly functional, orthogonal transcriptional regulators have been identified. Here, we describe the process of developing synthetic plant transcription factors using regulatory elements from the Penicillium citrinum ML-236B (compactin) pathway. This pathway contains several genes including mlcA and mlcC that are transcriptionally regulated in a dose-dependent manner by the activator mlcR. In Nicotiana benthamiana, we first expressed mlcR with several cognate synthetic promoters driving expression of GFP. Synthetic promoters contained operator sequences from the compactin gene cluster. Following identification of the most active synthetic promoter, the DNA-binding domain from mlcR was used to generate chimeric transcription factors containing variable activation domains, including QF from the Neurospora crassa Q-system. Activity was measured at both protein and RNA levels which correlated with an R2 value of 0.94. A synthetic transcription factor with a QF activation domain increased gene expression from its synthetic promoter up to sixfold in N. benthamiana. Two systems were characterized in transgenic tobacco plants. The QF-based plants maintained high expression in tobacco, increasing expression from the cognate synthetic promoter by fivefold. Transgenic plants and non-transgenic plants were morphologically indistinguishable. The framework of this study can easily be adopted for other putative transcription factors to continue improvement of the plant synthetic biology toolbox.


Subject(s)
Penicillium , Synthetic Biology , Nicotiana/genetics , Plants, Genetically Modified/genetics , Transcription Factors/genetics
7.
Account Res ; : 1-24, 2023 Jul 28.
Article in English | MEDLINE | ID: mdl-37482770

ABSTRACT

Scientists who manage research laboratories often face ethical dilemmas related to conflicts between their different roles, such as researcher, mentor, entrepreneur, and manager. It is not known how often uncertainty about conflicting role obligations leads scientists to engage in unethical conduct, but this probably occurs more often than many people would like to think. In this paper, we reflect on ethical decision-making in scientific laboratory management with special attention to how different roles create conflicting obligations and expectations that may produce moral uncertainty and lead to violations of research norms, especially when combined with self-interest and other factors that increase the risk of misbehavior. We also offer some suggestions and guidance for investigators and research institutions.

8.
Front Plant Sci ; 14: 1186292, 2023.
Article in English | MEDLINE | ID: mdl-37324708

ABSTRACT

Soybean (Glycine max) is an important crop in agricultural production where water shortage limits yields in soybean. Root system plays important roles in water-limited environments, but the underlying mechanisms are largely unknown. In our previous study, we produced a RNA-seq dataset generated from roots of soybean at three different growth stages (20-, 30-, and 44-day-old plants). In the present study, we performed a transcriptome analysis of the RNA-seq data to select candidate genes with probable association with root growth and development. Candidate genes were functionally examined in soybean by overexpression of individual genes using intact soybean composite plants with transgenic hairy roots. Root growth and biomass in the transgenic composite plants were significantly increased by overexpression of the GmNAC19 and GmGRAB1 transcriptional factors, showing up to 1.8-fold increase in root length and/or 1.7-fold increase in root fresh/dry weight. Furthermore, greenhouse-grown transgenic composite plants had significantly higher seed yield by about 2-fold than control plants. Expression profiling in different developmental stages and tissues showed that GmNAC19 and GmGRAB1 were most highly expressed in roots, displaying a distinct root-preferential expression. Moreover, we found that under water-deficit conditions, overexpression of GmNAC19 enhanced water stress tolerance in transgenic composite plants. Taken together, these results provide further insights into the agricultural potential of these genes for development of soybean cultivars with improved root growth and enhanced tolerance to water-deficit conditions.

9.
PLoS One ; 18(6): e0287094, 2023.
Article in English | MEDLINE | ID: mdl-37310961

ABSTRACT

Mammalian decomposition provides pulses of organic matter to the local ecosystem creating ephemeral hotspots of nutrient cycling. While changes to soil biogeochemistry in these hotspots have been described for C and N, patterns associated with deposition and cycling of other elements have not received the same attention. The goal of our study was to evaluate temporal changes to a broad suite of dissolved elements in soils impacted by human decomposition on the soil surface including: 1) abundant mineral elements in the human body (K, Na, S, P, Ca, and Mg), 2) trace elements in the human body (Fe, Mn, Se, Zn, Cu, Co, and B), and 3) Al which is transient in the human body but common in soils. We performed a four-month human decomposition trial at the University of Tennessee Anthropology Research Facility and quantified elemental concentrations dissolved in the soil solution, targeting the mobile and bioavailable fraction. We identified three groups of elements based on their temporal patterns. Group 1 elements appeared to be cadaver-derived (Na, K, P, S) and their persistence in soil varied based upon soluble organic forms (P), the dynamics of the soil exchange complex (Na, K), and gradual releases attributable to microbial degradation (S). Group 2 elements (Ca, Mg, Mn, Se, B) included three elements that have greater concentrations in soil than would be expected based on cadaver inputs alone, suggesting that these elements partially originate from the soil exchange (Ca, Mg), or are solubilized as a result of soil acidification (Mn). Group 3 elements (Fe, Cu, Zn, Co, Al) increased late in the decomposition process, suggesting a gradual solubilization from soil minerals under acidic pH conditions. This work presents a detailed longitudinal characterization of changes in dissolved soil elements during human decomposition furthering our understanding of elemental deposition and cycling in these environments.


Subject(s)
Anthropology , Ecosystem , Animals , Humans , Bicycling , Cadaver , Soil , Mammals
10.
Plants (Basel) ; 12(12)2023 Jun 15.
Article in English | MEDLINE | ID: mdl-37375944

ABSTRACT

Oilseed rape (Brassica napus L.) is an important cash crop, but transgenic oilseed rape has not been grown on a commercial scale in China. It is necessary to analyze the characteristics of transgenic oilseed rape before commercial cultivation. In our study, differential expression of total protein from the leaves in two transgenic lines of oilseed rape expressing foreign Bt Cry1Ac insecticidal toxin and their non-transgenic parent plant was analyzed using a proteomic approach. Only shared changes in both of the two transgenic lines were calculated. Fourteen differential protein spots were analyzed and identified, namely, eleven upregulated expressed protein spots and three downregulated protein spots. These proteins are involved in photosynthesis, transporter function, metabolism, protein synthesis, and cell growth and differentiation. The changes of these protein spots in transgenic oilseed rape may be attributable to the insertion of the foreign transgenes. However, the transgenic manipulation might not necessarily cause significant change in proteomes of the oilseed rape.

11.
Plants (Basel) ; 12(9)2023 May 04.
Article in English | MEDLINE | ID: mdl-37176936

ABSTRACT

Genome-editing has enabled rapid improvement for staple food crops, such as potato, a key beneficiary of the technology. In potato, starch contained within tubers represents the primary product for use in food and non-food industries. Starch granules are produced in the plastids of tubers with plastid size correlated with the size of starch grana. The division of plastids is controlled by proteins, including the tubulin-like GTPase FtsZ1. The altered expression of FtsZ1 has been shown to disrupt plastid division, leading to the production of "macro-plastid"-containing plants. These macro-chloroplast plants are characterized by cells containing fewer and enlarged plastids. In this work, we utilize CRISPR/Cas9 to generate FtsZ1 edited potato lines to demonstrate that genome-editing can be used to increase the size of starch granules in tubers. Altered plastid morphology was comparable to the overexpression of FtsZ1 in previous work in potato and other crops. Several lines were generated with up to a 1.98-fold increase in starch granule size that was otherwise phenotypically indistinguishable from wild-type plants. Further, starch paste from one of the most promising lines showed a 2.07-fold increase in final viscosity. The advantages of enlarged starch granules and the potential of CRISPR/Cas9-based technologies for food crop improvement are further discussed.

12.
Bio Protoc ; 13(8): e4660, 2023 Apr 20.
Article in English | MEDLINE | ID: mdl-37113331

ABSTRACT

Plant protoplasts are useful to study both transcriptional regulation and protein subcellular localization in rapid screens. Protoplast transformation can be used in automated platforms for design-build-test cycles of plant promoters, including synthetic promoters. A notable application of protoplasts comes from recent successes in dissecting synthetic promoter activity with poplar mesophyll protoplasts. For this purpose, we constructed plasmids with TurboGFP driven by a synthetic promoter together with TurboRFP constitutively controlled by a 35S promoter, to monitor transformation efficiency, allowing versatile screening of high numbers of cells by monitoring green fluorescent protein expression in transformed protoplasts. Herein, we introduce a protocol for poplar mesophyll protoplast isolation followed by protoplast transformation and image analysis for the selection of valuable synthetic promoters. Graphical overview.

13.
Front Plant Sci ; 14: 1129454, 2023.
Article in English | MEDLINE | ID: mdl-36875574

ABSTRACT

Trypsin inhibitors (TIs) are widely distributed in plants and are known to play a protective role against herbivores. TIs reduce the biological activity of trypsin, an enzyme involved in the breakdown of many different proteins, by inhibiting the activation and catalytic reactions of proteins. Soybean (Glycine max) contains two major TI classes: Kunitz trypsin inhibitor (KTI) and Bowman-Birk inhibitor (BBI). Both genes encoding TI inactivate trypsin and chymotrypsin enzymes, which are the main digestive enzymes in the gut fluids of Lepidopteran larvae feeding on soybean. In this study, the possible role of soybean TIs in plant defense against insects and nematodes was investigated. A total of six TIs were tested, including three known soybean trypsin inhibitors (KTI1, KTI2 and KTI3) and three genes encoding novel inhibitors identified in soybean (KTI5, KTI7, and BBI5). Their functional role was further examined by overexpression of the individual TI genes in soybean and Arabidopsis. The endogenous expression patterns of these TI genes varied among soybean tissues, including leaf, stem, seed, and root. In vitro enzyme inhibitory assays showed significant increase in trypsin and chymotrypsin inhibitory activities in both transgenic soybean and Arabidopsis. Detached leaf-punch feeding bioassays detected significant reduction in corn earworm (Helicoverpa zea) larval weight when larvae fed on transgenic soybean and Arabidopsis lines, with the greatest reduction observed in KTI7 and BBI5 overexpressing lines. Whole soybean plant greenhouse feeding bioassays with H. zea on KTI7 and BBI5 overexpressing lines resulted in significantly reduced leaf defoliation compared to non-transgenic plants. However, bioassays of KTI7 and BBI5 overexpressing lines with soybean cyst nematode (SCN, Heterodera glycines) showed no differences in SCN female index between transgenic and non-transgenic control plants. There were no significant differences in growth and productivity between transgenic and non-transgenic plants grown in the absence of herbivores to full maturity under greenhouse conditions. The present study provides further insight into the potential applications of TI genes for insect resistance improvement in plants.

15.
Front Plant Sci ; 13: 1011939, 2022.
Article in English | MEDLINE | ID: mdl-36330242

ABSTRACT

Abiotic stresses can cause significant damage to plants. For sustainable bioenergy crop production, it is critical to generate resistant crops to such stress. Engineering promoters to control the precise expression of stress resistance genes is a very effective way to address the problem. Here we developed stably transformed Populus tremula × Populus alba hybrid poplar (INRA 717-1B4) containing one-of-six synthetic drought stress-inducible promoters (SDs; SD9-1, SD9-2, SD9-3, SD13-1, SD18-1, and SD18-3) identified previously by transient transformation assays. We screened green fluorescent protein (GFP) induction in poplar under osmotic stress conditions. Of six transgenic lines containing synthetic promoter, three lines (SD18-1, 9-2, and 9-3) had significant GFP expression in both salt and osmotic stress treatments. Each synthetic promoter employed heptamerized repeats of specific and short cis-regulatory elements (7 repeats of 7-8 bases). To verify whether the repeats of longer sequences can improve osmotic stress responsiveness, a transgenic poplar containing the synthetic promoter of the heptamerized entire SD9 motif (20 bases, containing all partial SD9 motifs) was generated and measured for GFP induction under osmotic stress. The heptamerized entire SD9 motif did not result in higher GFP expression than the shorter promoters consisting of heptamerized SD9-1, 9-2, and 9-3 (partial SD9) motifs. This result indicates that shorter synthetic promoters (~50 bp) can be used for versatile control of gene expression in transgenic poplar. These synthetic promoters will be useful tools to engineer stress-resilient bioenergy tree crops in the future.

16.
Front Plant Sci ; 13: 988048, 2022.
Article in English | MEDLINE | ID: mdl-36160998

ABSTRACT

We previously identified cis-regulatory motifs in the soybean (Glycine max) genome during interaction between soybean and soybean cyst nematode (SCN), Heterodera glycines. The regulatory motifs were used to develop synthetic promoters, and their inducibility in response to SCN infection was shown in transgenic soybean hairy roots. Here, we studied the functionality of two SCN-inducible synthetic promoters; 4 × M1.1 (TAAAATAAAGTTCTTTAATT) and 4 × M2.3 (ATATAATTAAGT) each fused to the -46 CaMV35S core sequence in transgenic soybean. Histochemical GUS analyses of transgenic soybean plants containing the individual synthetic promoter::GUS construct revealed that under unstressed condition, no GUS activity is present in leaves and roots. While upon nematode infection, the synthetic promoters direct GUS expression to roots predominantly in the nematode feeding structures induced by the SCN and by the root-knot nematode (RKN), Meloidogyne incognita. There were no differences in GUS activity in leaves between nematode-infected and non-infected plants. Furthermore, we examined the specificity of the synthetic promoters in response to various biotic (insect: fall armyworm, Spodoptera frugiperda; and bacteria: Pseudomonas syringe pv. glycinea, P. syringe pv. tomato, and P. marginalis) stresses. Additionally, we examined the specificity to various abiotic (dehydration, salt, cold, wounding) as well as to the signal molecules salicylic acid (SA), methyl jasmonate (MeJA), and abscisic acid (ABA) in the transgenic plants. Our wide-range analyses provide insights into the potential applications of synthetic promoter engineering for conditional expression of transgenes leading to transgenic crop development for resistance improvement in plant.

18.
ACS Synth Biol ; 11(8): 2741-2755, 2022 08 19.
Article in English | MEDLINE | ID: mdl-35901078

ABSTRACT

While the installation of complex genetic circuits in microorganisms is relatively routine, the synthetic biology toolbox is severely limited in plants. Of particular concern is the absence of combinatorial analysis of regulatory elements, the long design-build-test cycles associated with transgenic plant analysis, and a lack of naming standardization for cloning parts. Here, we use previously described plant regulatory elements to design, build, and test 91 transgene cassettes for relative expression strength. Constructs were transiently transfected into Nicotiana benthamiana leaves and expression of a fluorescent reporter was measured from plant canopies, leaves, and protoplasts isolated from transfected plants. As anticipated, a dynamic level of expression was achieved from the library, ranging from near undetectable for the weakest cassette to a ∼200-fold increase for the strongest. Analysis of expression levels in plant canopies, individual leaves, and protoplasts were correlated, indicating that any of the methods could be used to evaluate regulatory elements in plants. Through this effort, a well-curated 37-member part library of plant regulatory elements was characterized, providing the necessary data to standardize construct design for precision metabolic engineering in plants.


Subject(s)
Nicotiana , Synthetic Biology , DNA/metabolism , Plant Leaves/genetics , Plant Leaves/metabolism , Plants, Genetically Modified/genetics , Synthetic Biology/methods , Nicotiana/genetics
19.
Front Plant Sci ; 13: 873480, 2022.
Article in English | MEDLINE | ID: mdl-35548302

ABSTRACT

Phytosensors are genetically engineered plant-based sensors that feature synthetic promoters fused to reporter genes to sense and report the presence of specific biotic and abiotic stressors on plants. However, when induced reporter gene output is below detectable limits, owing to relatively weak promoters, the phytosensor may not function as intended. Here, we show modifications to the system to amplify reporter gene signal by using a synthetic transcription factor gene driven by a plant pathogen-inducible synthetic promoter. The output signal was unambiguous green fluorescence when plants were infected by pathogenic bacteria. We produced and characterized a phytosensor with improved sensing to specific bacterial pathogens with targeted detection using spectral wavelengths specific to a fluorescence reporter at 3 m standoff detection. Previous attempts to create phytosensors revealed limitations in using innate plant promoters with low-inducible activity since they are not sufficient to produce a strong detectable fluorescence signal for standoff detection. To address this, we designed a pathogen-specific phytosensor using a synthetic promoter-transcription factor system: the S-Box cis-regulatory element which has low-inducible activity as a synthetic 4xS-Box promoter, and the Q-system transcription factor as an amplifier of reporter gene expression. This promoter-transcription factor system resulted in 6-fold amplification of the fluorescence after infection with a potato pathogen, which was detectable as early as 24 h post-bacterial infection. This novel bacterial pathogen-specific phytosensor potato plant demonstrates that the Q-system may be leveraged as a powerful orthogonal tool to amplify a relatively weak synthetic inducible promoter, enabling standoff detection of a previously undetectable fluorescence signal. Pathogen-specific phytosensors would be an important asset for real-time early detection of plant pathogens prior to the display of disease symptoms on crop plants.

20.
Front Plant Sci ; 13: 893610, 2022.
Article in English | MEDLINE | ID: mdl-35586220

ABSTRACT

Switchgrass (Panicum virgatum L.) has immense potential as a bioenergy crop with the aim of producing biofuel as an end goal. Nitrogen (N)-related sustainability traits, such as nitrogen use efficiency (NUE) and nitrogen remobilization efficiency (NRE), are important factors affecting switchgrass quality and productivity. Hence, it is imperative to develop nitrogen use-efficient switchgrass accessions by exploring the genetic basis of NUE in switchgrass. For that, we used 331 diverse field-grown switchgrass accessions planted under low and moderate N fertility treatments. We performed a genome wide association study (GWAS) in a holistic manner where we not only considered NUE as a single trait but also used its related phenotypic traits, such as total dry biomass at low N and moderate N, and nitrogen use index, such as NRE. We have evaluated the phenotypic characterization of the NUE and the related traits, highlighted their relationship using correlation analysis, and identified the top ten nitrogen use-efficient switchgrass accessions. Our GWAS analysis identified 19 unique single nucleotide polymorphisms (SNPs) and 32 candidate genes. Two promising GWAS candidate genes, caffeoyl-CoA O-methyltransferase (CCoAOMT) and alfin-like 6 (AL6), were further supported by linkage disequilibrium (LD) analysis. Finally, we discussed the potential role of nitrogen in modulating the expression of these two genes. Our findings have opened avenues for the development of improved nitrogen use-efficient switchgrass lines.

SELECTION OF CITATIONS
SEARCH DETAIL
...