ABSTRACT
Background and Aim: The nasal cavity of a pig serves as an entry point and a habitat for the colonization of commensal microbes and pathogenic bacteria. Based on biochemical and serological tests, Streptococcus b-hemolytic Group C was identified as the Gram-positive bacteria, which resulted in the 1994 outbreak and death of thousands of pigs in Bali. Furthermore, this agent is zoonotic and frequently results in the development of meningitis lesions in the infected pig. Recently, a meningitis outbreak in humans was also reported after the consumption of pig-derived foods at Sibang Kaja, Badung-Bali. This study aimed to identify and characterize Gram-positive ß-hemolytic organisms collected from nasal swab of pigs from the outbreak area, as well as to compare API Kit and 16S rRNA gene analysis methods. Materials and Methods: This study commenced with the cultivation of two isolates, Punggul Swab Nasal (PSN) 2 and PSN 19, which were characterized by ß-hemolysis activity. These samples were then conventionally and molecularly identified using Kit API 20 Strep and 16S ribosomal RNA (rRNA) gene primers, respectively. Results: Using the Kit API 20 Strep, both isolates were identified as Enterococcus faecium, which was previously classified as Group D Streptococci. Based on the 16S rRNA gene sequencing, PSN 2 and PSN 19 were molecularly confirmed to have 99 and 98.1% similarities with E. faecium (NR042054), respectively. Furthermore, both isolates share the same clade in the phylogenetic tree analysis. Conclusion: Using Kit API 20 Strep and 16S rRNA gene analysis, the PSN 2 and PSN 9 Gram-positive isolates with ß-hemolysis activity from pig nasal swabs were identified as E. faecium.
ABSTRACT
BACKGROUND AND AIM: Meatballs are a processed product of animal origin that is consumed cooked, usually with chicken, beef, or pork as the main ingredient. Unfortunately, some unscrupulous sellers in Indonesia may adulterate this product with rat meat to decrease production costs. Rat meat in any food is a critical public health issue and is prohibited under Indonesian food safety laws, as well as within Muslim communities. This study aimed to test the sensitivity of the polymerase chain reaction (PCR) method in the detection of rat meat contained in processed, cooked beef meatballs. MATERIALS AND METHODS: Beef meatballs were formulated with different concentrations of rat meat. Molecular detection of adulteration was initiated by DNA extraction of each cooked meatball formulation followed by PCR using a specific primer for mitochondrial DNA Cytochrome b gene of rat, which primer sequences, i.e., forward primer: 5'CATGGGGACGAGGACTATACTATG '3 and reverse primer: 5'GTAGTCCCAATGTAAGGGATAGCTG'3. RESULTS: Our study showed that the PCR method is sensitive in detecting 5% or greater rat meat adulteration of cooked beef meatballs. CONCLUSION: The PCR method can be used to detect most rat meat adulteration of cooked beef meatballs and offers a sensitive and effective means to protect food safety and religious requirements in Indonesia.
ABSTRACT
AIM: This study aimed to determine the molecular characteristics of Pasteurella multocida isolates originated from Sumba Island, East Nusa Tenggara Province. MATERIALS AND METHODS: The isolates of P. multocida stored in frozen storage were cultured in blood agar as a selective medium and identified conventionally. Molecular tests were initiated by DNA isolation and then followed by polymerase chain reaction tests with specific primers for the determination of P. multocida serotype A or B. Positive strain of serotype B was then confirmed molecularly using 16S rRNA gene primer and followed by the sequencing of nucleotides. RESULTS: The study showed that both P. multocida isolates from Sumba island, i.e. PM1 is isolated from East Sumba district, while PM2 isolated from West Sumba district have 99.6% homology. Both isolates also known have 99% similarities with P. multocida originated from India, Britain, and Japan, respectively. The isolates share the same clade in the phylogenetic tree. CONCLUSION: The 16S rRNA sequencing revealed a high similarity of P. multocida serotype B:2 isolated from Sumba island with the Indian isolates although the sample size is very small. Therefore, further molecular studies like multilocus sequence typing, VNTR need to be performed using a larger number of samples to establish the genetic relatedness observed in this study.
