Albumin-to-alkaline phosphatase ratio as a novel prognostic indicator in patients undergoing peritoneal dialysis: a propensity score matching analysis.

Background: Though the albumin-to-alkaline phosphatase ratio (AAPR) is used as a biomarker in various diseases, little is known about its effect on outcomes after peritoneal dialysis (PD). Methods: This multicenter retrospective study comprised 357 incident PD patients stratified according to the AAPR. Propensity score matching (PSM) was performed to identify 85 patients for a well-matched comparison of all-cause and cardiovascular mortality. Using Cox regression, we performed univariate and multivariate analyses to investigate the prognostic value of the AAPR and established a Kaplan-Meier curve-predicted nomogram to estimate expected overall survival (OS). We assessed the predictive accuracy using the concordance index (c-index). Results: We found that the optimal cut-off of the AAPR to predict mortality was 0.36. In the present cohort of patients undergoing PD, a low AAPR strongly correlated with worse OS. In the multivariate analysis, the AAPR was shown to be an independent marker predicting reduced OS both before [hazard ratio (HR) 1.68, 95% confidence interval (CI) 1.08-2.60, P = 0.020] and after PSM (HR 1.96, 95% CI 1.06-3.62, P = 0.020). We also observed significant differences in OS in several subgroups, but not the group of patients with comorbidities. A nomogram was established to predict overall survival, with a c-index for prediction accuracy was 0.71 after PSM. Conclusion: AAPR has potential as an independent prognostic biomarker in patients undergoing PD.

Pharmacokinetic/Pharmacodynamic assessment of the structural refinement of clopidogrel focusing on the balance between bioactivation and deactivation.

The delicate balance between ischemic and bleeding risks is a significant consideration in the administration of antiplatelet therapy. Clopidogrel and prasugrel, both members of the thienopyridine class of antiplatelet drugs, are well established for their variability in individual responsiveness and for a high number of bleeding events, respectively. The current study focuses on evaluating the pharmacokinetics and pharmacodynamics of a series of deuterated clopidogrel derivatives, leveraging insights gained from the structure-pharmacokinetic relationships in the development of thienopyridine drugs. Our approaches were based on the molecular skeleton of clopidogrel and adopted the C2-pharmacophore design from prasugrel. The selected C2-pharmacophore distinguishes itself from the acetyloxy substituent of prasugrel by exhibiting a moderated hydrolysis rate, resulting in a gentler formation of the active metabolite. An excessive and burst release of the active metabolite are therefore to be avoided, as it is believed to be associated with an increased risk of bleeding. Our proposed structural modification maintains the hydrolysis-sensitive methyl ester of clopidogrel but replaces it with a deuterated methyl group, which has been shown to effectively reduce metabolic deactivation. The evaluation of the clopidogrel derivatives has been primarily based on the criteria related to the exposure to active metabolites. Three promising compounds demonstrate higher biotransformation efficiency, similar Cmax, delayed Tmax, enhanced antiplatelet activity, and a lower risk of bleeding compared to clopidogrel, when administered at a dosage resulting in a similar exposure to the active metabolites. Significance Statement The pharmacokinetics and pharmacodynamics of a series of newly designed clopidogrel derivatives were assessed to validate the rationale for their structural modifications. Three promising compounds displayed balanced pharmacokinetics, characterized by slower deactivation compared to clopidogrel and a more gradual bioactivation than prasugrel. Under similar exposure to active metabolites, these compounds have demonstrated enhanced antiplatelet activity and a diminished risk of bleeding compared to clopidogrel. The D3-clopidogrel-ozagrel conjugate was found to exert a synergistic therapeutic effect.

Duhamel and transanal endorectal pull-throughs for Hirschsprung disease: a Bayesian network meta-analysis.

BACKGROUND: To comprehensively compare the effects of open Duhamel (OD), laparoscopic-assisted Duhamel (LD), transanal endorectal pull-through (TEPT), and laparoscopic-assisted endorectal pull-through (LEPT) in Hirschsprung disease. METHODS: PubMed, Embase, Cochrane Library, Web of Science, CNKI, WanFang, and VIP were comprehensively searched up to August 4, 2022. The outcomes were operation-related indicators and complication-related indicators. The Grading of Recommendations Assessment, Development and Evaluation (GRADE) approach was used to evaluate the quality of evidence. Network plots, forest plots, league tables and rank probabilities were drawn for all outcomes. For measurement data, weighted mean differences (WMDs) and 95% credibility intervals (CrIs) were reported; for enumeration data, relative risks (RRs) and 95%CrIs were calculated. RESULTS: Sixty-two studies of 4781 patients were included, with 2039 TEPT patients, 1669 LEPT patients, 951 OD patients and 122 LD patients. Intraoperative blood loss in the OD group was more than that in the LEPT group (pooled WMD = 44.00, 95%CrI: 27.33, 60.94). Patients lost more blood during TEPT versus LEPT (pooled WMD = 13.08, 95%CrI: 1.80, 24.30). In terms of intraoperative blood loss, LEPT was most likely to be the optimal procedure (79.76%). Patients undergoing OD had significantly longer gastrointestinal function recovery time, as compared with those undergoing LEPT (pooled WMD = 30.39, 95%CrI: 16.08, 44.94). The TEPT group had significantly longer gastrointestinal function recovery time than the LEPT group (pooled WMD = 11.49, 95%CrI: 0.96, 22.05). LEPT was most likely to be the best operation regarding gastrointestinal function recovery time (98.28%). Longer hospital stay was observed in patients with OD versus LEPT (pooled WMD = 5.24, 95%CrI: 2.98, 7.47). Hospital stay in the TEPT group was significantly longer than that in the LEPT group (pooled WMD = 1.99, 95%CrI: 0.37, 3.58). LEPT had the highest possibility to be the most effective operation with respect to hospital stay. The significantly reduced incidence of complications was found in the LEPT group versus the LD group (pooled RR = 0.24, 95%CrI: 0.12, 0.48). Compared with LEPT, OD was associated with a significantly increased incidence of complications (pooled RR = 5.10, 95%CrI: 3.48, 7.45). Patients undergoing TEPT had a significantly greater incidence of complications than those undergoing LEPT (pooled RR = 1.98, 95%CrI: 1.63, 2.42). For complications, LEPT is most likely to have the best effect (99.99%). Compared with the LEPT group, the OD group had a significantly increased incidence of anastomotic leakage (pooled RR = 5.35, 95%CrI: 1.45, 27.68). LEPT had the highest likelihood to be the best operation regarding anastomotic leakage (63.57%). The incidence of infection in the OD group was significantly higher than that in the LEPT group (pooled RR = 4.52, 95%CrI: 2.45, 8.84). The TEPT group had a significantly increased incidence of infection than the LEPT group (pooled RR = 1.87, 95%CrI: 1.13, 3.18). LEPT is most likely to be the best operation concerning infection (66.32%). Compared with LEPT, OD was associated with a significantly higher incidence of soiling (pooled RR = 1.91, 95%CrI: 1.16, 3.17). Patients with LEPT had the greatest likelihood not to develop soiling (86.16%). In contrast to LD, LEPT was significantly more effective in reducing the incidence of constipation (pooled RR = 0.39, 95%CrI: 0.15, 0.97). LEPT was most likely not to result in constipation (97.81%). LEPT was associated with a significantly lower incidence of Hirschprung-associated enterocolitis (HAEC) than LD (pooled RR = 0.34, 95%CrI: 0.13, 0.85). The OD group had a significantly higher incidence of HAEC than the LEPT group (pooled RR = 2.29, 95%CrI: 1.31, 4.0). The incidence of HAEC was significantly greater in the TEPT group versus the LEPT group (pooled RR = 1.74, 95%CrI: 1.24, 2.45). LEPT was most likely to be the optimal operation in terms of HAEC (98.76%). CONCLUSION: LEPT may be a superior operation to OD, LD and TEPT in improving operation condition and complications, which might serve as a reference for Hirschsprung disease treatment.

Identification of novel variations in three cases with rare inherited neuromuscular disorder.

Inherited neuromuscular disorder (IND) is a broad-spectrum, clinically diverse group of diseases that are caused due to defects in the neurosystem, muscles and related tissue. Since IND may originate from mutations in hundreds of different genes, the resulting heterogeneity of IND is a great challenge for accurate diagnosis and subsequent management. Three pediatric cases with IND were enrolled in the present study and subjected to a thorough clinical examination. Next, a genetic investigation was conducted using whole-exome sequencing (WES). The suspected variants were validated through Sanger sequencing or quantitative fluorescence PCR assay. A new missense variant of the Spastin (SPAST) gene was found and analyzed at the structural level using molecular dynamics (MD) simulations. All three cases presented with respective specific clinical manifestations, which reflected the diversity of IND. WES detected the diagnostic variants in all 3 cases: A compound variation comprising collagen type VI α3 chain (COL6A3) (NM_004369; exon19):c.6322G>T(p.E1208*) and a one-copy loss of COL6A3:exon19 in Case 1, which are being reported for the first time; a de novo SPAST (NM_014946; exon8):c.1166C>A(p.T389K) variant in Case 2; and a de novo Duchenne muscular dystrophy (NM_004006; exon11):c.1150-17_1160delACTTCCTTCTTTGTCAGGGGTACATGATinsC variant in Case 3. The structural and MD analyses revealed that the detected novel SPAST: c.1166C>A(p.T389K) variant mainly altered the intramolecular hydrogen bonding status and the protein segment's secondary structure. In conclusion, the present study expanded the IND mutation spectrum. The study not only detailed the precise diagnoses of these cases but also furnished substantial grounds for informed consultations. The approach involving the genetic evaluation strategy using WES for variation screening followed by validation using appropriate methods is beneficial due to the considerable heterogeneity of IND.

Noninvasive therapy of brain cancer using a unique systemic delivery methodology with a cancer terminator virus.

Primary, glioblastoma, and secondary brain tumors, from metastases outside the brain, are among the most aggressive and therapeutically resistant cancers. A physiological barrier protecting the brain, the blood-brain barrier (BBB), functions as a deterrent to effective therapies. To enhance cancer therapy, we developed a cancer terminator virus (CTV), a unique tropism-modified adenovirus consisting of serotype 3 fiber knob on an otherwise Ad5 capsid that replicates in a cancer-selective manner and simultaneously produces a potent therapeutic cytokine, melanoma differentiation-associated gene-7/interleukin-24 (MDA-7/IL-24). A limitation of the CTV and most other viruses, including adenoviruses, is an inability to deliver systemically to treat brain tumors because of the BBB, nonspecific virus trapping, and immune clearance. These obstacles to effective viral therapy of brain cancer have now been overcome using focused ultrasound with a dual microbubble treatment, the focused ultrasound-double microbubble (FUS-DMB) approach. Proof-of-principle is now provided indicating that the BBB can be safely and transiently opened, and the CTV can then be administered in a second set of complement-treated microbubbles and released in the brain using focused ultrasound. Moreover, the FUS-DMB can be used to deliver the CTV multiple times in animals with glioblastoma  growing in their brain thereby resulting in a further enhancement in survival. This strategy permits efficient therapy of primary and secondary brain tumors enhancing animal survival without promoting harmful toxic or behavioral side effects. Additionally, when combined with a standard of care therapy, Temozolomide, a further increase in survival is achieved. The FUS-DMB approach with the CTV highlights a noninvasive strategy to treat brain cancers without surgery. This innovative delivery scheme combined with the therapeutic efficacy of the CTV provides a novel potential translational therapeutic approach for brain cancers.

Muscle ultrasound to identify prednisone-induced muscle damage in adults with nephrotic syndrome.

Steroid myopathy is a non-inflammatory toxic myopathy that primarily affects the proximal muscles of the lower limbs. Due to its non-specific symptoms, it is often overshadowed by patients' underlying conditions. Prolonged or high-dosage use of glucocorticoids leads to a gradual decline in muscle mass. There are no tools available to identify the course of steroid myopathy before the patient displays substantial clinical symptoms. In this study, we investigated individuals with nephrotic syndrome receiving prednisone who underwent muscle ultrasound to obtain cross-sectional and longitudinal pictures of three major proximal muscles in the lower limbs: the vastus lateralis, tibialis anterior, and medial gastrocnemius muscles. Our findings revealed that grip strength was impaired in the prednisolone group, creatine kinase levels were reduced within the normal range; echo intensity of the vastus lateralis and medial gastrocnemius muscles was enhanced, the pennation angle was reduced, and the tibialis anterior muscle exhibited increased echo intensity and decreased thickness. The total dose of prednisone and the total duration of treatment impacted the degree of muscle damage. Our findings indicate that muscle ultrasound effectively monitors muscle structure changes in steroid myopathy. Combining clinical symptoms, serum creatine kinase levels, and grip strength improves the accuracy of muscle injury evaluation.

Differences in insomnia-related self-reported outcomes among elderly hospitalized patients.

BACKGROUND: Insomnia is among the most common sleep disorders worldwide. Insomnia in older adults is a social and public health problem. Insomnia affects the physical and mental health of elderly hospitalized patients and can aggravate or induce physical illnesses. Understanding subjective feelings and providing reasonable and standardized care for elderly hospitalized patients with insomnia are urgent issues. AIM: To explore the differences in self-reported outcomes associated with insomnia among elderly hospitalized patients. METHODS: One hundred patients admitted to the geriatric unit of our hospital between June 2021 and December 2021 were included in this study. Self-reported symptoms were assessed using the Athens Insomnia Scale (AIS), Generalized Anxiety Disorder Scale-7 (GAD-7), Geriatric Depression Scale-15 (GDS-15), Memorial University of Newfoundland Scale of Happiness (MUNSH), Barthel Index Evaluation (BI), Morse Fall Scale (MFS), Mini-Mental State Examination, and the Short Form 36 Health Survey Questionnaire (SF-36). Correlation coefficients were used to analyze the correlation between sleep quality and self-reported symptoms. Effects of insomnia was analyzed using Logistic regression analysis. RESULTS: Nineteen patients with AIS ≥ 6 were included in the insomnia group, and the incidence of insomnia was 19% (19/100). The remaining 81 patients were assigned to the non-insomnia group. There were significant differences between the two groups in the GDA-7, GDS-15, MUNSH, BI, MFS, and SF-36 items (P < 0.05). Patients in the insomnia group were more likely to experience anxiety, depression, and other mental illnesses, as well as difficulties with everyday tasks and a greater risk of falling (P < 0.05). Subjective well-being and quality of life were poorer in the insomnia group than in the control group. The AIS scores positively correlated with the GAD-7, GDS-15, and MFS scores in elderly hospitalized patients with insomnia (P < 0.05). Logistic regression analysis showed that GDS-15 ≥ 5 was an independent risk factor for insomnia in elderly hospitalized patients (P < 0.05). CONCLUSION: The number of self-reported symptoms was higher among elderly hospitalized patients with insomnia. Therefore, we should focus on the main complaints of patients to meet their care needs.

Alzheimer-like behavior and synaptic dysfunction in 3 × Tg-AD mice are reversed with calcineurin inhibition.

Alzheimer's disease is a progressive neurodegenerative disorder characterized by impairments in synaptic plasticity and cognitive performance. Current treatments are unable to achieve satisfactory therapeutic effects or reverse the progression of the disease. Calcineurin has been implicated as part of a critical signaling pathway for learning and memory, and neuronal calcineurin may be hyperactivated in AD. To investigate the effects and underlying mechanisms of FK506, a calcineurin inhibitor, on Alzheimer-like behavior and synaptic dysfunction in the 3 × Tg-AD transgenic mouse model of Alzheimer's disease, we investigated the effect of FK506 on cognitive function and synaptic plasticity in the 3 × Tg-AD transgenic mouse model of Alzheimer's disease. The results showed that FK506 treatment ameliorated cognitive deficits, as indicated by the decreased latency in the water maze, and attenuated tau hyperphosphorylation in 3 × Tg-AD mice. Treatment with FK506 also reduced the levels of certain markers of postsynaptic deficits, including PSD-95 and NR2B, and reversed the long-term potentiation deficiency and dendritic spine impairments in 3 × Tg-AD mice. These findings suggest that treatment with calcineurin inhibitors such as FK506 can be an effective therapeutic strategy to rescue synaptic deficit and cognitive impairment in familial Alzheimer's disease and related tauopathies.

Metal telluride nanosheets by scalable solid lithiation and exfoliation.

Transition metal tellurides (TMTs) have been ideal materials for exploring exotic properties in condensed-matter physics, chemistry and materials science1-3. Although TMT nanosheets have been produced by top-down exfoliation, their scale is below the gram level and requires a long processing time, restricting their effective application from laboratory to market4-8. We report the fast and scalable synthesis of a wide variety of MTe2 (M = Nb, Mo, W, Ta, Ti) nanosheets by the solid lithiation of bulk MTe2 within 10 min and their subsequent hydrolysis within seconds. Using NbTe2 as a representative, we produced more than a hundred grams (108 g) of NbTe2 nanosheets with 3.2 nm mean thickness, 6.2 µm mean lateral size and a high yield (>80%). Several interesting quantum phenomena, such as quantum oscillations and giant magnetoresistance, were observed that are generally restricted to highly crystalline MTe2 nanosheets. The TMT nanosheets also perform well as electrocatalysts for lithium-oxygen batteries and electrodes for microsupercapacitors (MSCs). Moreover, this synthesis method is efficient for preparing alloyed telluride, selenide and sulfide nanosheets. Our work opens new opportunities for the universal and scalable synthesis of TMT nanosheets for exploring new quantum phenomena, potential applications and commercialization.

Genetic or pharmacologic blockade of mPGES-2 attenuates renal lipotoxicity and diabetic kidney disease by targeting Rev-Erbα/FABP5 signaling.

Diabetic kidney disease (DKD) is one of the most common complications of diabetes, and no specific drugs are clinically available. We have previously demonstrated that inhibiting microsomal prostaglandin E synthase-2 (mPGES-2) alleviated type 2 diabetes by enhancing ß cell function and promoting insulin production. However, the involvement of mPGES-2 in DKD remains unclear. Here, we aimed to analyze the association of enhanced mPGES-2 expression with impaired metabolic homeostasis of renal lipids and subsequent renal damage. Notably, global knockout or pharmacological blockage of mPGES-2 attenuated diabetic podocyte injury and tubulointerstitial fibrosis, thereby ameliorating lipid accumulation and lipotoxicity. These findings were further confirmed in podocyte- or tubule-specific mPGES-2-deficient mice. Mechanistically, mPGES-2 and Rev-Erbα competed for heme binding to regulate fatty acid binding protein 5 expression and lipid metabolism in the diabetic kidney. Our findings suggest a potential strategy for treating DKD via mPGES-2 inhibition.

Protein C deficiency with venous and arterial thromboembolic events.

Protein C (PC) is a key component of the vitamin K-dependent coagulation pathway. It exerts anticoagulant effects by inactivating factors V and VIII. Acquired or inherited PC deficiency results in a prothrombotic state, with presentations varying from asymptomatic to venous thromboembolism. However, there has been an increasing number of reports linking PC deficiency to arterial thromboembolic events, such as myocardial infarction and ischemic stroke. This editorial focuses on the association between PC deficiency and thromboembolism, which may provide some insights for treatment strategy and scientific research.

Gold nanoparticles exhibit anti-osteoarthritic effects via modulating interaction of the "microbiota-gut-joint" axis.

Osteoarthritis (OA) is a common degenerative joint disease that can cause severe pain, motor dysfunction, and even disability. A growing body of research indicates that gut microbiota and their associated metabolites are key players in maintaining bone health and in the progression of OA. Short-chain fatty acids (SCFAs) are a series of active metabolites that widely participate in bone homeostasis. Gold nanoparticles (GNPs) with outstanding anti-bacterial and anti-inflammatory properties, have been demonstrated to ameliorate excessive bone loss during the progression of osteoporosis (OP) and rheumatoid arthritis (RA). However, the protective effects of GNPs on OA progression are not clear. Here, we observed that GNPs significantly alleviated anterior cruciate ligament transection (ACLT)-induced OA in a gut microbiota-dependent manner. 16S rDNA gene sequencing showed that GNPs changed gut microbial diversity and structure, which manifested as an increase in the abundance of Akkermansia and Lactobacillus. Additionally, GNPs increased levels of SCFAs (such as butyric acid), which could have improved bone destruction by reducing the inflammatory response. Notably, GNPs modulated the dynamic balance of M1/M2 macrophages, and increased the serum levels of anti-inflammatory cytokines such as IL-10. To sum up, our study indicated that GNPs exhibited anti-osteoarthritis effects via modulating the interaction of "microbiota-gut-joint" axis, which might provide promising therapeutic strategies for OA.

Gut microbially produced tryptophan metabolite melatonin ameliorates osteoporosis via modulating SCFA and TMAO metabolism.

Osteoporosis (OP) is a severe global health issue that has significant implications for productivity and human lifespan. Gut microbiota dysbiosis has been demonstrated to be closely associated with OP progression. Melatonin (MLT) is an important endogenous hormone that modulates bone metabolism, maintains bone homeostasis, and improves OP progression. Multiple studies indicated that MLT participates in the regulation of intestinal microbiota and gut barrier function. However, the promising effects of gut microbiota-derived MLT in OP remain unclear. Here, we found that OP resulted in intestinal tryptophan disorder and decreased the production of gut microbiota-derived MLT, while administration with MLT could mitigate OP-related clinical symptoms and reverse gut microbiota dysbiosis, including the diversity of intestinal microbiota, the relative abundance of many probiotics such as Allobaculum and Parasutterella, and metabolic function of intestinal flora such as amino acid metabolism, nucleotide metabolism, and energy metabolism. Notably, MLT significantly increased the production of short-chain fatty acids and decreased trimethylamine N-oxide-related metabolites. Importantly, MLT could modulate the dynamic balance of M1/M2 macrophages, reduce the serum levels of pro-inflammatory cytokines, and restore gut-barrier function. Taken together, our results highlighted the important roles of gut microbially derived MLT in OP progression via the "gut-bone" axis associated with SCFA metabolism, which may provide novel insight into the development of MLT as a promising drug for treating OP.

Molecular Characterization of Non-H5 and Non-H7 Avian Influenza Viruses from Non-Mallard Migratory Waterbirds of the North American Flyways, 2006-2011.

The surveillance of migratory waterbirds (MWs) for avian influenza virus (AIV) is indispensable for the early detection of a potential AIV incursion into poultry. Surveying AIV infections and virus subtypes in understudied MW species could elucidate their role in AIV ecology. Oropharyngeal-cloacal (OPC) swabs were collected from non-mallard MWs between 2006 and 2011. OPC swabs (n = 1158) that molecularly tested positive for AIV (Cts ≤ 32) but tested negative for H5 and H7 subtypes were selected for virus isolation (VI). The selected samples evenly represented birds from all four North American flyways (Pacific, Central, Mississippi, and Atlantic). Eighty-seven low pathogenic AIV isolates, representing 31 sites in 17 states, were recovered from the samples. All isolates belonged to the North American lineage. The samples representing birds from the Central Flyway had the highest VI positive rate (57.5%) compared to those from the other flyways (10.3-17.2%), suggesting that future surveillance can focus on the Central Flyway. Of the isolates, 43.7%, 12.6%, and 10.3% were obtained from blue-winged teal, American wigeon, and American black duck species, respectively. Hatch-year MWs represented the majority of the isolates (70.1%). The most common H and N combinations were H3N8 (23.0%), H4N6 (18.4%), and H4N8 (18.4%). The HA gene between non-mallard and mallard MW isolates during the same time period shared 85.5-99.5% H3 identity and 89.3-99.7% H4 identity. Comparisons between MW (mallard and non-mallard) and poultry H3 and H4 isolates also revealed high similarity (79.0-99.0% and 88.7-98.4%), emphasizing the need for continued AIV surveillance in MWs.

Long-term efficacy of liposomal nanocarriers of preassembled glycocalyx in restoring cerebral endothelial glycocalyx in sepsis.

The endothelial glycocalyx (EG) undergoes early degradation in sepsis. Our recent work introduced a novel therapeutic approach involving liposomal nanocarriers of preassembled glycocalyx (LNPG) to restore EG in lipopolysaccharide (LPS)-induced sepsis model of mice. While short-term effects were promising, this study focuses on the long-term impact of LNPG on mouse cerebral microcirculation. Utilizing cranial window, we assessed the stability of vascular density (VD) and perfused boundary region (PBR), an index of EG thickness, over a five-day period in normal control mice. In septic groups (LPS, LPS + 1-dose LNPG, and LPS + 2-dose LNPG), the exposure of mice to LPS significantly reduced VD and increased PBR within 3 h. Without LNPG treatment, PBR returned to the normal control level by endogenous processes at 48 h, associated with the recovery of VD to the baseline level at 72 h. However, mice receiving LNPG treatment significantly reduced the increment of PBR at 3 h. The therapeutic effect of 1-dose LNPG persisted for 6 h while the 2-dose LNPG treatment further reduced PBR and significantly increased VD at 12 h compared to LPS group. This study provides valuable insights into the potential therapeutic benefits of LNPG in mitigating EG degradation in sepsis.

Xianlian Jiedu Decoction alleviates colorectal cancer by regulating metabolic profiles, intestinal microbiota and metabolites.

BACKGROUND: Xianlian Jiedu Decoction (XLJDD) has been used for the treatment of colorectal cancer (CRC) for several decades because of the prominent efficacy of the prescription. Despite the clear clinical efficacy of XLJDD, the anti-CRC mechanism of action is still unclear. PURPOSE: The inhibitory effect and mechanism of XLJDD on CRC were investigated in the azoxymethane/dextran sulfate sodium (AOM/DSS)-induced mice. METHODS: The AOM/DSS-induced mice model was adopted to evaluate the efficacy after administering the different doses of XLJDD. The therapeutic effects of XLJDD in treating AOM/DSS-induced CRC were investigated through histopathology, immunofluorescence and ELISA analysis methods. In addition, metabolomics profile and 16S rRNA analysis were used to explore the effective mechanisms of XLJDD on CRC. RESULTS: The results stated that the XLJDD reduced the number of tumor growth on the inner wall of the colon and the colorectal weight/length ratio, and suppressed the disease activity index (DAI) score, meanwhile XLJDD also increased body weight, colorectal length, and overall survival rate. The treatment of XLJDD also exhibited the ability to lower the level of inflammatory cytokines in serum and reduce the expression levels of ß-catenin, COX-2, and iNOS protein in colorectal tissue. The findings suggested that XLJDD has anti-inflammatory properties and may provide relief for those suffering from inflammation-related conditions. Mechanistically, XLJDD improved gut microbiota dysbiosis and associated metabolic levels of short chain fatty acids (SCFAs), sphingolipid, and glycerophospholipid. This was achieved by reducing the abundance of Turicibacter, Clostridium_sensu_stricto_1, and the levels of sphinganine, LPCs, and PCs. Additionally, XLJDD increased the abundance of Enterorhabdus and Alistipes probiotics, as well as the content of butyric acid and isovaleric acid. CONCLUSION: The data presented in this article demonstrated that XLJDD can effectively inhibit the occurrence of colon inner wall tumors by reducing the level of inflammation and alleviating intestinal microbial flora imbalance and metabolic disorders. It provides a scientific basis for clinical prevention and treatment of CRC.

Glutamine supplementation improves the activity and immunosuppressive action of induced regulatory T cells in vitro and in vivo.

BACKGROUND: Glutamine is crucial for the activation and efficacy of T cells, and may play a role in regulating the immune environment. This study aimed to investigate the potential role of glutamine in the activation and proliferation of induced regulatory T cells (iTregs). METHODS: CD4+CD45RA+T cells were sorted from peripheral blood mononuclear cells and cultured to analyze iTreg differentiation. Glutamine was then added to the culture system to evaluate the effects of glutamine on iTregs by determining oxidative phosphorylation (OXPHOS), apoptosis, and cytokine secretion. Additionally, a humanized murine graft-versus-host disease (GVHD) model was constructed to confirm the efficacy of glutamine-treated iTregs in vivo. RESULTS: After being cultured in vitro, glutamine significantly enhanced the levels of Foxp3, CTLA-4, CD39, CD69, IL-10, TGF-ß, and Ki67 (CTLA-4, IL-10, TGF-ß are immunosuppressive markers of iTregs) compared with that of the control iTregs (P < 0.05). Furthermore, the growth curve showed that the proliferative ability of glutamine-treated iTregs was better than that of the control iTregs (P < 0.01). Compared with the control iTregs, glutamine supplementation significantly increased oxygen consumption rates and ATP production (P < 0.05), significantly downregulated Annexin V and Caspase 3, and upregulated BCL2 (P < 0.05). However, GPNA significantly reversed the effects of glutamine (P < 0.05). Finally, a xeno-GVHD mouse model was successfully established to confirm that glutamine-treated iTregs increased the mice survival rate, delayed weight loss, and alleviated colon injury. CONCLUSION: Glutamine supplementation can improve the activity and immunosuppressive action of iTregs, and the possible mechanisms by which this occurs are related to cell proliferation, apoptosis, and OXPHOS.

Notch3 as a novel therapeutic target for the treatment of ADPKD by regulating cell proliferation and renal cyst development.

Autosomal dominant polycystic kidney disease (ADPKD) is a common monogenic kidney disease. Emerging research indicates that the Notch signaling pathway plays an indispensable role in the pathogenesis of numerous kidney diseases, including ADPKD. Herein, we identified that Notch3 but not other Notch receptors was overexpressed in renal tissues from mice with ADPKD and ADPKD patients. Inhibiting Notch3 with γ-secretase inhibitors, which block a proteolytic cleavage required for Notch3 activation, or shRNA knockdown of Notch3 significantly delayed renal cyst growth in vitro and in vivo. Subsequent mechanistic study elucidated that the cleaved intracellular domain of Notch3 (N3ICD) and Hes1 could bind to the PTEN promoter, leading to transcriptional inhibition of PTEN. This further activated the downstream PI3K-AKT-mTOR pathway and promoted renal epithelial cell proliferation. Overall, Notch3 was identified as a novel contributor to renal epithelial cell proliferation and cystogenesis in ADPKD. We envision that Notch3 represents a promising target for ADPKD treatment.

The Value of Computer Vision in Identifying the Bone of Dialysis Patients.

BACKGROUND: In the end stage of kidney disease, abnormal levels of blood calcium, phosphorus, and parathyroid hormone lead to bone metabolism disorders, manifesting as osteoporosis or fibrocystic osteoarthritis. X-ray, CT, and MR are useful for detecting bone lesions in dialysis patients, but currently, computer vision has not yet been used for this purpose. METHODS: ResNet is a powerful deep CNN model, which has not yet been used to distinguish between the bones of dialysis patients and healthy people. Therefore, this study aimed to investigate the ability of the Resnet50 model to identify the bone of dialysis patients from normal bone. RESULTS: CT images of 200 cases (100 dialysis patients and 100 healthy people aged 31-72 years with male:female ratio of 51:49) were randomly divided into the training and testing groups at the ratio of 8:2. The module of 'torch' was used to train the model of Resnet50 for the current task of image classification. In the test cohort, the accuracy, sensitivity, and specificity with hyper-parameter=0 were 60%, 65%, and 55%, respectively. When the hyper-parameter was 0.6 or 0.7 versus 0, the accuracy was significantly higher (P<0.05). When the hyper-parameter was another number, the accuracy was not significantly different from that with no hyper-parameter (P>0.05). CONCLUSION: This study has indicated computer vision to be suitable for identifying bone changes caused by dialysis; a hyper-parameter has been found necessary for improving model accuracy. The ResNet50 model with hyper-parameter = 0.7 has exhibited 90% sensitivity in identifying the bone of dialysis patients.

Therapeutic effects and mechanisms of isoxanthohumol on DSS-induced colitis: regulating T cell development, restoring gut microbiota, and improving metabolic disorders.

Ulcerative colitis (UC) is a severe hazard to human health. Since pathogenesis of UC is still unclear, current therapy for UC treatment is far from optimal. Isoxanthohumol (IXN), a prenylflavonoid from hops and beer, possesses anti-microbial, anti-oxidant, anti-inflammatory, and anti-angiogenic properties. However, the potential effects of IXN on the alleviation of colitis and the action of the mechanism is rarely studied. Here, we found that administration of IXN (60 mg/kg/day, gavage) significantly attenuated dextran sodium sulfate (DSS)-induced colitis, evidenced by reduced DAI scores and histological improvements, as well as suppressed the pro-inflammatory Th17/Th1 cells but promoted the anti-inflammatory Treg cells. Mechanically, oral IXN regulated T cell development, including inhibiting CD4+ T cell proliferation, promoting apoptosis, and regulating Treg/Th17 balance. Furthermore, IXN relieved colitis by restoring gut microbiota disorder and increasing gut microbiota diversity, which was manifested by maintaining the ratio of Firmicutes/Bacteroidetes balance, promoting abundance of Bacteroidetes and Ruminococcus, and suppressing abundance of proteobacteria. At the same time, the untargeted metabolic analysis of serum samples showed that IXN promoted the upregulation of D-( +)-mannose and L-threonine and regulated pyruvate metabolic pathway. Collectively, our findings revealed that IXN could be applied as a functional food component and served as a therapeutic agent for the treatment of UC.