Binding of LAG-3 to stable peptide-MHC class II limits T cell function and suppresses autoimmunity and anti-cancer immunity.

Lymphocyte activation gene-3 (LAG-3) is a potent inhibitory co-receptor; yet, its functional ligand remains elusive, with distinct potential ligands identified. Here, we investigated the relative contribution of potential ligands, stable peptide-MHC class II complexes (pMHCII) and fibrinogen-like protein 1 (FGL1), to LAG-3 activity in vitro and in vivo. Binding of LAG-3 to stable pMHCII but not to FGL1 induced T cell suppression in vitro. Consistently, LAG-3 mutants lacking FGL1-binding capacity but not those lacking stable pMHCII-binding capacity retained suppressive activity in vitro. Accordingly, targeted disruption of stable pMHCII- but not FGL1-binding capacity of LAG-3 in NOD mice recapitulated diabetes exacerbation by LAG-3 deficiency. Additionally, the loss of stable pMHCII-binding capacity of LAG-3 augmented anti-cancer immunity comparably with LAG-3 deficiency in C57BL/6 mice. These results identify stable pMHCII as a functional ligand of LAG-3 both in autoimmunity and anti-cancer immunity. Thus, stable pMHCII-LAG-3 interaction is a potential therapeutic target in human diseases.

PD-1 agonism by anti-CD80 inhibits T cell activation and alleviates autoimmunity.

Targeted blockade of the checkpoint molecule programmed cell death 1 (PD-1) can activate tumor-specific T cells to destroy tumors, whereas targeted potentiation of PD-1 is expected to suppress autoreactive T cells and alleviate autoimmune diseases. However, the development of methods to potentiate PD-1 remains challenging. Here we succeeded in eliciting PD-1 function by targeting the cis-PD-L1-CD80 duplex, formed by binding of CD80 to the PD-1 ligand PD-L1, that attenuates PD-L1-PD-1 binding and abrogates PD-1 function. By generating anti-CD80 antibodies that detach CD80 from the cis-PD-L1-CD80 duplex and enable PD-L1 to engage PD-1 in the presence of CD80, we demonstrate that the targeted dissociation of cis-PD-L1-CD80 duplex elicits PD-1 function in the condition where PD-1 function is otherwise restricted. We demonstrate using murine models that the removal of PD-1 restriction is effective in alleviating autoimmune disease symptoms. Our findings establish a method to potentiate PD-1 function and propose the removal of restraining mechanisms as an efficient strategy to potentiate the function of inhibitory molecules.

Restriction of PD-1 function by cis-PD-L1/CD80 interactions is required for optimal T cell responses.

Targeted blockade of PD-1 with immune checkpoint inhibitors can activate T cells to destroy tumors. PD-1 is believed to function mainly at the effector, but not in the activation, phase of T cell responses, yet how PD-1 function is restricted at the activation stage is currently unknown. Here we demonstrate that CD80 interacts with PD-L1 in cis on antigen-presenting cells (APCs) to disrupt PD-L1/PD-1 binding. Subsequently, PD-L1 cannot engage PD-1 to inhibit T cell activation when APCs express substantial amounts of CD80. In knock-in mice in which cis-PD-L1/CD80 interactions do not occur, tumor immunity and autoimmune responses were greatly attenuated by PD-1. These findings indicate that CD80 on APCs limits the PD-1 coinhibitory signal, while promoting CD28-mediated costimulation, and highlight critical components for induction of optimal immune responses.

Atypical motifs in the cytoplasmic region of the inhibitory immune co-receptor LAG-3 inhibit T cell activation.

T cell activation is tightly regulated by both stimulatory and inhibitory co-receptors and has been a focus in the development of interventions for managing cancer or autoimmune diseases. Targeting the inhibitory co-receptors programmed cell death 1 (PD-1) and cytotoxic T lymphocyte-associated protein 4 (CTLA-4) has successfully eradicated tumors but induced immune-related adverse events in humans and mice. The beneficial and adverse effects of targeting these co-receptors highlight their importance in cancer immunity and also autoimmunity. Although the therapeutic potencies of other inhibitory co-receptors are under extensive investigation, their inhibitory mechanisms and their functional differences are not well understood. Here we analyzed the inhibitory mechanisms of lymphocyte activation gene-3 (LAG-3), another inhibitory co-receptor, by using an in vitro T cell activation system and a high-affinity anti-LAG-3 antibody that strongly interferes with the binding of LAG-3 to its ligand. We found that the expression level of LAG-3 strongly correlates with the inhibitory function of LAG-3, suggesting that LAG-3 functions as a rheostat rather than as a breaker of T cell activation. By evaluating the inhibitory capacities of various LAG-3 variants relative to their expression levels, we found that LAG-3 transduces two independent inhibitory signals through an FXXL motif in the membrane-proximal region and the C-terminal EX repeat. These motifs have not been reported previously for inhibitory co-receptors, suggesting that LAG-3 inhibits T cell activation through a nonredundant inhibitory mechanisms along with the other inhibitory co-receptors. Our findings provide a rationale for combinatorial targeting of LAG-3 and the other inhibitory co-receptors to improve cancer immunotherapy.

LAG-3 inhibits the activation of CD4+ T cells that recognize stable pMHCII through its conformation-dependent recognition of pMHCII.

The success of tumor immunotherapy targeting the inhibitory co-receptors PD-1 and CTLA-4 has indicated that many other co-receptors might be potential druggable targets, despite limited information about their functional differences. Here we identified a unique target selectivity for the inhibitory co-receptor LAG-3 that was intrinsic to its immunoregulatory roles. Although LAG-3 has been reported to recognize major histocompatibility complex (MHC) class II, it did not recognize MHC class II universally; instead, we found that it selectively recognized stable complexes of peptide and MHC class II (pMHCII). LAG-3 did not directly interfere with interactions between the co-receptor CD4 and MHC class II or between the T cell antigen receptor and MHC class II. Instead, LAG-3 preferentially suppressed T cells responsive to stable pMHCII by transducing inhibitory signals via its intracellular region. Thus, LAG-3 might function more selectively than previously thought and thereby maintain tolerance to dominant autoantigens.

Growth strategy of the pathogenic yeast Cryptococcus neoformans submerged culture under different cultivation formats.

Growth patterns of Cryptococcus neoformans submerged culture in different culture volumes, intensity of agitation and types of sealing were evaluated to better understand the physiological role of hypoxia response in this yeast. When low intensity agitation was set at high culture volumes and air exchange between the cultivation vessel and external environment was not abolished completely, the cells proliferated slowly but steadily. On the other hand, when the intensity of agitation was high but the vessel was withheld from fresh air supply, the cells first proliferated rapidly, then arrested completely and finally died. Therefore, the central strategy of C. neoformans here seems to lie in its proliferation-rate adjustment to the available oxygen levels and not in its capacity to survive under anoxia. The data support the opinion that the cultures grown under limited aeration (even though not completely withheld from fresh air supply) are much closer to the real cryptococcal life in human tissues than conventional well-aerated exponential cultures.

Peculiar clusters of daughter cells observed in Cryptococcus neoformans grown in sealed microtiter plates.

Cryptococcus neoformans was grown in 96-well microtiter plates sealed by foil which is less than 0.01 % permeable to oxygen. On day 14 of the cultivation, we observed peculiar clusters of small droplike daughter cells arranged around < or = 4 % of mother cells. The fact that most of the other cells had died indicates that few cells had been able to survive hypoxic conditions and escape the cell-cycle arrest. However, their daughters were unable to separate from them and to continue their proliferation under such conditions.

The cytoskeleton in the unique cell reproduction by conidiogenesis of the long-neck yeast Fellomyces (Sterigmatomyces) fuzhouensis.

The morphology of conidiogenesis and associated changes in microtubules, actin distribution and ultrastructure were studied in the basidiomycetous yeast Fellomyces fuzhouensis by phase-contrast, fluorescence, and electron microscopy. The interphase cell showed a central nucleus with randomly distributed bundles of microtubules and actin, and actin patches in the cortex. The conidiogenous mother cell developed a slender projection, or stalk, that contained cytoplasmic microtubules and actin cables stretched parallel to the longitudinal axis and actin patches accumulated in the tip. The conidium was produced on this stalk. It contained dispersed cytoplasmic microtubules, actin cables, and patches concentrated in the cortex. Before mitosis, the nucleus migrated through the stalk into the conidium and cytoplasmic microtubules were replaced by a spindle. Mitosis started in the conidium, and one daughter nucleus then returned to the mother via an eccentrically elongated spindle. The cytoplasmic microtubules reappeared after mitosis. A strong fluorescence indicating accumulated actin appeared at the base of the conidium, where the cytoplasm cleaved eccentrically. Actin patches then moved from the stalk together with the retracting cytoplasm to the mother and conidium. No septum was detected in the long neck by electron microscopy, only a small amount of fine "wall material" between the conidium and mother cell. Both cells developed a new wall layer, separating them from the empty neck. The mature conidium disconnected from the empty neck at the end-break, which remained on the mother as a tubular outgrowth. Asexual reproduction by conidiogenesis in the long-neck yeast F. fuzhouensis has unique features distinguishing it from known asexual forms of reproduction in the budding and fission yeasts. Fellomyces fuzhouensis develops a unique long and narrow neck during conidiogenesis, through which the nucleus must migrate into the conidium for eccentric mitosis. This is followed by eccentric cytokinesis. We found neither an actin cytokinetic ring nor a septum in the long neck, from which cytoplasm retracted back to mother cell after cytokinesis. Both the conidium and mother were separated from the empty neck by the development of a new lateral wall (initiated as a wall plug). The cytoskeleton is clearly involved in all these processes.

Characterisation of the anticryptococcal effect of the FC-1 toxin produced by Filobasidium capsuligenum.

The basidiomycetous yeast Filobasidium capsuligenum produces a killer toxin (FC-1) which is highly effective against the opportunistic fungal pathogen Cryptococcus neoformans. The aim of this work was to study the effect of the toxin on C. neoformans cells. The sensitivities of strains representing eight molecular subtypes (VNI-IV and VGI-IV) of the C. neoformans species complex, and of an additional 50 clinical and environmental isolates were determined. Analysis of cellular DNA by laser scanning cytometry and fluorescein isothiocyanate (FITC) staining of the toxin-treated cells revealed that the killing mechanism of FC-1 is neither cell cycle- nor cell wall biosynthesis-dependent; rather it may act as an ionophoric protein that disrupts the cytoplasmic membrane function. The competition assay results suggest that beta-1,6-glucan in the cell wall may provide the binding site for the killer protein. This anticryptococcal toxin has the potential to be applied as a therapeutic agent for the treatment of cryptococcosis.

DNA sequence diversity of intergenic spacer I region in the non-lipid-dependent species Malassezia pachydermatis isolated from animals.

The non-lipid-dependent species Malassezia pachydermatis is frequently isolated from animals. We analyzed the DNA sequences of the intergenic spacer (IGS) 1 region, which is the most variable region in the rRNA gene, of 43 M. pachydermatis strains obtained from dogs or cats. The lengths of the IGS 1 regions ranged from 552 to 898 bp and, based on the nucleotide sequence, these IGS 1 regions were divided into three major groups with 10 subtypes. Group 1 (552-601 bp long) was characterized by the short sequence repeat (CAGCA)n and had four to 14 repeats, and Group 3 (749-898 bp long), which included the neotype strain of M. pachydermatis, was characterized by the sequence (CAGCATAACATAACACACAACA)n in the IGS1 region. Group 2 possessed partial sequences of both Groups 1 and 3. Each group shared only 41.7-55.4% similarity in the IGS1 region with the other groups. The internal transcribed spacer (ITS) region and D1/D2 26S rDNA in the rRNA gene were also sequenced for representative strains in each IGS group. The groups were distinguished by both ITS (698-712 bp long including 5.8S rDNA) and D1/D2 26S rDNA (624 bp long) sequences with sequence similarities of 91.7-96.0% and 99.7-99.0%, respectively. Our results indicate that the sequence of the IGS region of M. pachydermatis has a remarkable intraspecies diversity, compared with ITS or D1/D2 26S rDNA, and that multiple genotypic strains of M. pachydermatis colonize animal skin.

Chemiluminescent visualization of superoxide generated by Candida albicans.

The high toxicity of reactive oxygen species (ROS) suggested a possible role in the pathogenicity of human pathogenic fungi. We previously reported a chemiluminescence method for measuring ROS generation in Candida albicans. In the present study, we attempted to visualize the ROS, superoxide anion radical (O2-), generated by paraquat (PQ)-stimulated C. albicans using methyl-Cypridina-luciferin analog (MCLA) as a chemiluminescence probe. Colonies of a wild-type C. albicans parent strain and its respiration-deficient mutant grown on agar plates were overlaid with a mixture of PQ and MCLA solutions. MCLA-dependent light emission from the colonies was recorded with a Hamamatsu ultralow-light-imaging apparatus with a CCD camera in a light-tight box. In the wild-type strain, marginal regions of growing colonies were strongly illuminated. The light emission from the colonies was extinguished by superoxide dismutase (SOD), proving that the light emission was strictly due to the superoxide anion. However, colonies of the respiration-deficient mutant poorly generated superoxide. Chemiluminecence measurements by a luminometer showed vigorous superoxide generation by the exponential phase cells of the parent strain but weak generation by the stationary phase cells. In the mutant, superoxide generation was weak compared with the parent strain. These results indicate that expansion of the colonies was due to the actively respiring cells located in the marginal regions. To our knowledge, the present report is the first chemiluminescent visualization of ROS including superoxide generated by C. albicans.

Chemiluminescence of superoxide generated by Candida albicans: differential effects of the superoxide generator paraquat on a wild-type strain and a respiratory mutant.

We previously reported that a respiration-competent parent strain (K) of Candida albicans was more susceptible to the intracellular superoxide radical (O2-) generator paraquat (PQ) than was a respiration-deficient mutant (KRD-19), although both showed a similar sensitivity to extracellularly generated O2-. To clarify the cause of the differential PQ lethality, we developed a chemiluminescence method for measuring O2- generated by C. albicans cells by using the probe methyl-Cypridina-luciferin analogue (MCLA), and examined the effects of PQ on O2- generation in both parent and mutant strains. Endogenous O2- generation without stimulation by PQ was unexpectedly low in both strains. PQ-induced O2- generation in the parent strain was maximal in logarithmic phase cells and lowered in stationary phase cells. In contrast, O2- generation in the mutant remained low throughout the growth phase, even when stimulated by PQ. The extent of PQ-induced O2- generation in the parent strain depended on the carbon source added to the assay mixture; in decreasing order, glucose, glycerol, no carbon source. The inhibitor of the cytochrome respiratory chain, antimycin A, suppressed almost completely the PQ-induced O2- generation in the parent strain. It has been established that PQ is converted to its radical form (PQ+) by receiving a single electron in cells. PQ+ then reduces molecular oxygen to O2- by redox cycling. Thus, the high tolerance to PQ of the respiration-deficient mutant can be explained by minimal PQ+/O2- production due to the limited supply of electrons from the impaired respiratory system.

Deficit in oxygen causes G(2) budding and unbudded G(2) arrest in Cryptococcus neoformans.

Cryptococcus neoformans exhibited diphasic growth when grown under limited aeration. First, it grew exponentially, but at OD 1, the concentration of dissolved oxygen in culture decreased to 1 mg l(-1) and a second phase of slow growth was started. This phase was characterized by a shift of budding from S to G(2), a sharp decrease in budding index and a sharp increase in the proportion of unbudded G(2) cells to 80%. Thus, a deficit in oxygen was demonstrated to delay the timing of budding, prolong the G(2) phase and cause accumulation of cells after DNA synthesis, but before commitment to budding.

Microtubules and actin cytoskeleton in Cryptococcus neoformans compared with ascomycetous budding and fission yeasts.

Actin cytoskeleton and microtubules were studied in a human fungal pathogen, the basidiomycetous yeast Cryptococcus neoformans (haploid phase of Filobasidiella neoformans), during its asexual reproduction by budding using fluorescence and electron microscopy. Staining with rhodamine-conjugated phalloidin revealed an F-actin cytoskeleton consisting of cortical patches, cables and cytokinetic ring. F-actin patches accumulated at the regions of cell wall growth, i. e. in sterigma, bud and septum. In mother cells evenly distributed F-actin patches were joined to F-actin cables, which were directed to the growing sterigma and bud. Some F-actin cables were associated with the cell nucleus. The F-actin cytokinetic ring was located in the bud neck, where the septum originated. Antitubulin TAT1 antibody revealed a microtubular cytoskeleton consisting of cytoplasmic and spindle microtubules. In interphase cells cytoplasmic microtubules pointed to the growing sterigma and bud. As the nucleus was translocated to the bud for mitosis, the cytoplasmic microtubules disassembled and were replaced by a short intranuclear spindle. Astral microtubules then emanated from the spindle poles. Elongation of the mitotic spindle from bud to mother cell preceded nuclear division, followed by cytokinesis (septum formation in the bud neck). Electron microscopy of ultrathin sections of chemically fixed and freeze-substituted cells revealed filamentous bundles directed to the cell cortex. The bundles corresponded in width to the actin microfilament cables. At the bud neck numerous ribosomes accumulated before septum synthesis. We conclude: (i) the topology of F-actin patches, cables and rings in C. neoformans resembles ascomycetous budding yeast Saccharomyces, while the arrangement of interphase and mitotic microtubules resembles ascomycetous fission yeast Schizosaccharomyces. The organization of the cytoskeleton of the mitotic nucleus, however, is characteristic of basidiomycetous yeasts. (ii) A specific feature of C. neoformans was the formation of a cylindrical sterigma, characterized by invasion of F-actin cables and microtubules, followed by accumulation of F-actin patches around its terminal region resulting in development of an isodiametrical bud.

Bud emergence is gradually delayed from S to G2 with progression of growth phase in Cryptococcus neoformans.

The G2 index of the yeast Cryptococcus neoformans determined by laser scanning cytometer was 2-3 times higher than the budding index during transition to the stationary phase of the culture, indicating that buds emerged in the G2 phase of the cell cycle. To clarify whether buds also emerge in G2 during exponential growth of the culture, DNA content for each cell was measured with a fluorescence microscope equipped with a photomultiplier. The DNA content of cells having tiny buds varied rather widely, depending on growth phases and strains used. Typically, buds of C. neoformans emerged soon after initiation of DNA synthesis in the early exponential phase. However, bud emergence was delayed to G2 during transition to the stationary phase, and in the early stationary phase budding scarcely occurred, although roughly half of the cells completed DNA synthesis. Thus, the timing of budding in C. neoformans was actually shifted to later cell cycle points with progression of the growth phase of the culture.

Malassezia pachydermatis isolated from a South American sea lion (Otaria byronia) with dermatitis.

A fungus was isolated from the skin of an Otaria byronia and from the water of the pool in which the animal was kept. It formed creamy colonies with soft texture on Dixon agar and grew well without supplements of long-chain fatty acids. Cells were ovoid to cylindrical in shape, budded from a broad base, and budded and divided at the same location. Thus, the isolate was identified as M. pachydermatis. We compared this very rare isolate from a marine mammal with four strains of M. pachydermatis using the freeze-etching electron-microscopy technique. The cells showed the same characteristic ring-swellings on the protoplasmic membrane on the neck site between the mother and the daughter parts, and the same accumulation of circumvallate bulgings in a small area near the straight sections of spiral grooves as four reference strains. Thus, in terms of morphology and ultrastructure, the isolate could be regarded as a typical M. pachydermatis.

Cells of different ploidy are often present together in Cryptococcus neoformans strains.

We examined the ploidy of C. neoformans strains using both laser scanning cytometry and a fluorescence microscope equipped with a photomultiplier. Haploid strains consisted of normal-sized cells with a haploid DNA amount. In the cell population there were also large-sized cells with a diploid DNA amount. These large cells in haploid strains were isolated using a Skerman micromanipulator, cultivated, and were able to generate diploid clones. Even after only 3-5 transfers on slants, haploid cells were present in all the diploid clones examined. Conversely, haploid clones obtained by single-cell-isolation of normal-sized cells from haploid strains were also shown to contain diploid cells after 3-5 transfers. Fresh haploid isolates from the environment similarly contained diploid cells after 3-5 transfers. Thus, a cellular ploidy shift was shown to occur widely in C. neoformans strains.

Simple detection method for distinguishing dead and living yeast colonies.

A rapid and simple assay was developed for detection of yeast colonies containing dying or dead cells. Methylene blue, phloxin B, rose bengal and trypan blue at concentrations of 5-10 micromol l(-1) were shown to stain non-viable cells in colonies of Saccharomyces cerevisiae, Schizosaccharomyces pombe, Candida albicans and Filobasidium capsuligenum without staining or affecting the viability of living cells of the colonies.

Inhibitory effect of essential oils on apical growth of Aspergillus fumigatus by vapour contact.

The inhibitory effect of seven essential oils on the apical growth of hyphae of Aspergillus fumigatus was studied using a bio cell tracer by vapour contact in a sealed vessel. Based on the inhibitory pattern, these essential oils were classified into three groups. The first group, composed of citron, lavender and tea tree oils, stopped the apical growth in a loading dose of 63 micrograms ml-1 air, but allowed the regrowth of the hyphae after removal of the vapour, indicating fungistatic action. The second group, consisting of perilla and lemon-grass oils, stopped the apical growth in a loading dose of 6.3 micrograms ml-1 air, and did not allow the regrowth after gaseous contact at 63 micrograms ml-1 air, indicative of fungicidal action. The third group, consisting of cinnamon bark and thyme oils, retarded the growth in a dose of 6.3 micrograms ml-1 air, stopped it in a dose of 63 micrograms ml-1 air, and incompletely suppressed regrowth of the hyphae. Gas chromatographic analysis revealed that vapours of essential oils were absorbed on fungal mycelia and agar medium most abundantly by the first group, followed by the second and third groups, reflecting the volatility of the respective groups. Suppression of the apical growth by vapour contact was ascribed to the direct deposition of essential oils on fungal mycelia, together with an indirect effect via the agar medium absorbed.

Role of cell shape in determination of the division plane in Schizosaccharomyces pombe: random orientation of septa in spherical cells.

The establishment of growth polarity in Schizosaccharomyces pombe cells is a combined function of the cytoplasmic cytoskeleton and the shape of the cell wall inherited from the mother cell. The septum that divides the cylindrical cell into two siblings is formed midway between the growing poles and perpendicularly to the axis that connects them. Since the daughter cells also extend at their ends and form their septa at right angles to the longitudinal axis, their septal (division) planes lie parallel to those of the mother cell. To gain a better understanding of how this regularity is ensured, we investigated septation in spherical cells that do not inherit morphologically predetermined cell ends to establish poles for growth. We studied four mutants (defining four novel genes), over 95% of whose cells displayed a completely spherical morphology and a deficiency in mating and showed a random distribution of cytoplasmic microtubules, Tea1p, and F-actin, indicating that the cytoplasmic cytoskeleton was poorly polarized or apolar. Septum positioning was examined by visualizing septa and division scars by calcofluor staining and by the analysis of electron microscopic images. Freeze-substitution, freeze-etching, and scanning electron microscopy were used. We found that the elongated bipolar shape is not essential for the determination of a division plane that can separate the postmitotic nuclei. However, it seems to be necessary for the maintenance of the parallel orientation of septa over the generations. In the spherical cells, the division scars and septa usually lie at angles to each other on the cell surface. We hypothesize that the shape of the cell indirectly affects the positioning of the septum by directing the extension of the spindle.