Genetic variation and evolutionary characteristics of Echovirus 11: new variant within genotype D5 associated with neonatal death found in China.

Echovirus 11 (E11) has gained attention owing to its association with severe neonatal infections. From 2018 to 2023, a surge in severe neonatal cases and fatalities linked to a novel variant of genotype D5 was documented in China, France, and Italy. However, the prevention and control of E11 variants have been hampered by limited background data on the virus circulation and genetic variance. Therefore, the present study investigated the circulating dynamics of E11 and the genetic variation and molecular evolution of genotype D5 through the collection of strains from the national acute flaccid paralysis (AFP) and hand, foot, and mouth disease (HFMD) surveillance system in China during 2000-2022 and genetic sequences published in the GenBank database. The results of this study revealed a prevalent dynamic of E11 circulation, with D5 being the predominant genotype worldwide. Further phylogenetic analysis of genotype D5 indicated that it could be subdivided into three important geographic clusters (D5-CHN1: 2014-2019, D5-CHN2: 2016-2022, and D5-EUR: 2022-2023). Additionally, variant-specific (144) amino acid mutation sites and positive-selection pressure sites (132, 262) were identified in the VP1 region. Cluster-specific recombination patterns were also identified, with CVB5, E6, and CVB4 as the major recombinant viruses. These findings provide a preliminary landscape of E11 circulation worldwide and basic scientific data for further study of the pathogenicity of E11 variants.

Comparison of New and Old Versions of Guidelines for Diagnosis and Treatment of Thyroid Nodules and Differentiated Thyroid Carcinoma in China from A Surgical Perspective / 肿瘤防治研究

The set of guidelines for the diagnosis and treatment of thyroid nodules and differentiated thyroid cancer (the second edition) was published in 2023 in China. Based on the first (2012) edition, the current set was revised jointly by nearly 100 experts in endocrinology, thyroid surgery, oncology, nuclear medicine, ultrasound medicine, and pathology from seven national societies for one year. The new version of the guideline is still divided into two parts, namely, thyroid nodules and differentiated thyroid cancer. The writing mode of asking clinical questions, explaining and giving recommendations is adopted, and a total of 117 recommendations are provided. This article aims to compare the variations in the differentiation of benign and malignant thyroid nodules and surgical treatment of differentiated thyroid cancer between the new and old versions from the perspective of surgery. The author's own understanding and experiences are also discussed.

Observation on the distribution of macular cone in healthy adult using adaptive optics scanning laser ophthalmoscope system / 国际眼科杂志(Guoji Yanke Zazhi)

AIM: To observe the distribution of cone in the macular of healthy adult in different ages using adaptive optics scanning laser ophthalmoscope(AO-SLO)system, and analyze its relationship with age.METHODS: A total of 100 healthy examinees(200 eyes)in our hospital from June to July 2023 were selected, and they were divided into four groups according to their age, with 25 cases(50 eyes)in each group, including 18-30 years in group A, 31-40 years in group B, 41-50 years in group C, 51-65 years in group D. AO-SLO was performed in both eyes and cone density was measured.RESULTS: The density of cone in the foveal eccentricity of 3° and 2.4°×2.4° in each group was different(P<0.001), and the cone density in each area showed a relatively regular distribution characteristics, with the highest density in the temporal side, and the temporal>nasal>inferior>superior sides from high to low. The mean cone density in the macular area of both eyes was 14 144.38±1 082.40, 13 241.24±535.32, 12 930.29±727.73, and 10 907.50±490.86 cell/mm2, respectively(P<0.001), indicating that the cone density decreased with age. The correlation analysis showed that the mean cone density in the macular area was negatively correlated with age(r=-0.578, P<0.001).CONCLUSION: AO-SLO is a quantitative non-invasive detection of cones, and there is a negative correlation between cone density and age in healthy human. Furthermore, density of cone in healthy people over 50 years was significantly decreased.

Global quantitative proteomic analysis profiles of host protein expression in response to enterovirus A71 infection in bronchial epithelial cells based on tandem mass tag (TMT) peptide labeling coupled with LC-MS/MS uncovers the key role of proteasome in virus replication.

Enterovirus A71 (EV-A71) is a neurotropic human pathogen which mainly caused hand, foot and mouth disease (HFMD) mostly in children under 5 years-old. Generally, EV-A71-associated HFMD is a relatively self-limiting febrile disease, but there will still be a small percentage of patients with rapid disease progression and severe neurological complications. To date, the underlying mechanism of EV-A71 inducing pathological injury of central nervous system (CNS) remains largely unclear. It has been investigated and discussed the changes of mRNA, miRNA and circRNA expression profile during infection by EV-A71 in our previous studies. However, these studies were only analyzed at the RNA level, not at the protein level. It's the protein levels that ultimately do the work in the body. Here, to address this, we performed a tandem mass tag (TMT) peptide labeling coupled with LC-MS/MS approach to quantitatively identify cellular proteome changes at 24 h post-infection (hpi) in EV-A71-infected 16HBE cells. In total, 6615 proteins were identified by using TMT coupled with LC-MS/MS in this study. In the EV-A71- and mock-infected groups, 210 differentially expressed proteins were found, including 86 upregulated and 124 downregulated proteins, at 24 hpi. To ensure the validity and reliability of the proteomics data, 3 randomly selected proteins were verified by Western blot and Immunofluorescence analysis, and the results were consistent with the TMT results. Subsequently, functional enrichment analysis indicated that the up-regulated and down-regulated proteins were individually involved in various biological processes and signaling pathways, including metabolic process, AMPK signaling pathway, Neurotrophin signaling pathway, Viral myocarditis, GABAergic synapse, and so on. Moreover, among these enriched functional analysis, the "Proteasome" pathway was up-regulated, which has caught our attention. Inhibition of proteasome was found to obviously suppress the EV-A71 replication. Finally, further in-depth analysis revealed that these differentially expressed proteins contained distinct domains and localized in different subcellular components. Taken together, our data provided a comprehensive view of host cell response to EV-A71 and identified host proteins may lead to better understanding of the pathogenic mechanisms and host responses to EV-A71 infection, and also to the identification of new therapeutic targets for EV-A71 infection.

Sustained release silicon from 3D bioprinting scaffold using silk/gelatin inks to promote osteogenesis.

Repairing extensive bone defects that cannot self-heal has been a clinical challenge. The construction of scaffolds with osteogenic activity through tissue engineering can provide an effective strategy for bone regeneration. This study utilized gelatin, silk fibroin, and Si3N4 as scaffold materials to prepare silicon-functionalized biomacromolecules composite scaffolds using three-dimensional printing (3DP) technology. This system delivered positive outcomes when Si3N4 levels were 1 % (1SNS). The results showed that the scaffold had a porous reticular structure with a pore size of 600-700 µm. The Si3N4 nanoparticles were distributed uniformly in the scaffold. The scaffold could release Si ions for up to 28 days. In vitro experiments showed that the scaffold had good cytocompatibility, promoting the osteogenic differentiation of mesenchymal stem cells (MSCs). In vivo experiments on bone defects in rats showed that the 1SNS group facilitated bone regeneration. Therefore, the composite scaffold system showed potential for application in bone tissue engineering.

Clinical characteristics and effect of anti-vascular endothelial growth factor therapy in retinopathy of prematurity in Sichuan province / 中华眼底病杂志

Objective:To analyze the clinical characteristics and evaluate the effect and safety of anti-vascular endothelial growth factor (VEGF) therapy in retinopathy of prematurity (ROP) in Sichuan province.Methods:A retrospective study. From January 2013 to January 2022, 156 patients (306 eyes) with ROP who received intravitreal anti-VEGF therapy for the first time in the Department of Ophthalmology, West China Hospital of Sichuan University were selected. According to the type of anti-VEGF drugs, the children were divided into intravitreal injection of ranibizumab (IVR) group and intravitreal injection of conbercept (IVC) group; IVC group was divided into hospital group and referral group according to the different paths of patients. After treatment, the patients were followed up until the disease degenerated (vascular degeneration or complete retinal vascularization) or were hospitalized again for at least 6 months. If the disease recurred or progressed, the patients were re-admitted to the hospital and received anti-VEGF drug treatment, laser treatment or surgical treatment according to the severity of the disease. Clinical data of these children was collected, including general clinical characteristics: gender, gestational age at birth (GA), birth weight (BW), history of oxygen inhalation; pathological condition: ROP stage, zone, whether there were plus lesions; treatment: treatment time, postmenstrual gestational age at the time of the first anti-VEGF drug treatment; prognosis: re-treat or not, time of re-treatment, mode of re-treatment; adverse events: corneal edema, lens opacity, endophthalmitis, retinal injury, and treatment-related systemic adverse reactions. The measurement data between groups were compared by t test, and the count data were compared by χ2 test or rank sum test. Results:Of the 306 eyes of 156 children with ROP, 74 were male (47.44%, 74/156) and 82 were female (52.56%, 82/156). Each included child had a history of oxygen inhalation at birth. The GA was (28.43±2.19) (23.86-36.57) weeks, BW was (1 129±335) (510-2 600) g, and the postmenstrual gestational age was (39.80±3.04) (31.71-49.71) weeks at the time of the first anti-VEGF drug treatment. All patients were diagnosed as type 1 ROP, including 26 eyes (8.50%, 26/306) of aggressive ROP (A-ROP), 39 eyes (12.74%, 39/306) of zone Ⅰ lesions, and 241 eyes (78.76%, 241/306) of zone Ⅱ lesions. The children were treated with intravitreal injection of anti-VEGF drugs within 72 hours after diagnosis. Among them, 134 eyes (43.79%, 134/306) of 68 patients were treated with IVR, and 172 eyes (56.21%, 172/306) of 88 patients were treated with IVC. In IVC group, 67 eyes of 34 patients (38.95%, 67/172) were in the hospital group and 105 eyes of 54 patients (61.05%, 105/172) were in the referral group. 279 eyes (91.18%, 279/306) were improved after one treatment, 15 eyes (4.90%, 15/306) were improved after two treatments, and 12 eyes (3.92%, 12/306) were improved after three treatments. The one-time cure rate of IVR group was lower than that of IVC group, but the difference was not statistically significant ( χ2=1.665, P=0.197). In different ROP categories, IVC showed better therapeutic effect in A-ROP, and its one-time cure rate was higher than that in IVR group, with statistically significant difference ( χ2=7.797, P<0.05). In the hospital group of IVC group, the GA, BW and the postmenstrual gestational age at first time of anti-VEGF drug treatment were lower than those in the referral group, and the difference was statistically significant ( t=-2.485, -2.940, -3.796; P<0.05). The one-time cure rate of the hospital group and the referral group were 94.94%, 92.38%, respectively. The one-time cure rate of the hospital group was slightly higher than that of the referral group, but the difference was not statistically significant ( χ2=0.171, P=0.679). In this study, there were no ocular and systemic adverse reactions related to drug or intravitreal injection in children after treatment. Conclusions:Compared with the characteristics of ROP in developed countries, the GA, BW and postmenstrual gestational age of the children in Sichuan province are higher. Both IVR and IVC can treat ROP safely and effectively. There is no significant difference between the two drugs in the overall one-time cure effect of ROP, but IVC performed better in the treatment of A-ROP in this study.

Phenotype and genotype analysis of progressive familial intrahepatic cholestasis type 4 / 中华实用儿科临床杂志

Objective:To improve the understanding of progressive familial intrahepatic cholestasis type 4 (PFIC4).Methods:Clinical characteristics in a 10-year-old boy with PFIC4 at the Second Hospital of Hebei Medical University in February 2020 were retrospectively analyzed, and the TJP2 gene mutations were analyzed. Results:The proband was a 10-year-old boy with a slow onset of intrahepatic cholestasis[normal γ-glutamyl transpeptidase(GGT)], hepatosplenomegaly and hepatic fibrosis.Laboratory tests showed elevated levels of total bilirubin, especially the direct bilirubin increased.Alanine aminotransferase, aspartate transaminase acid and total bile acid were elevated, while GGT remained in a normal range.Oral medication of ursodeoxycholic acid initially improved liver biochemical parameters, but later fluctuated.Adenosine dehydrogenase, coagulation indicators and hepatic fibrosis indexes were persistently abnormal.The average shear wave velocity of liver was 1.9 times of the upper limit of normal value.Compound heterozygous mutations c. 334G>A(p.A112T)/c.580_639delGACCGGAGCCGTGGCCGGAGCCTGGAGCGGGG-CCTGGACCAAGACCATGCGCGCACCCGA (p.194_213delDRSRGRSLERGLDQDHARTR) were found in the TJP2 gene.The deletion mutation of the TJP2 gene was reported for the first time throughout the world.Both of his parents carried a heterozygous mutation. Conclusions:PFIC should be considered in intrahepatic cholestasis patients with a normal range of GGT.The detection of TJP2 gene mutation is of great value in the clinical diagnosis of PFIC4.The presence of TJP2 gene mutation may be a risk factor for patient developing cirrhosis of liver and primary liver cancer in early childhood.It is necessary for children with PFIC4 to be closely followed up.

Biomanufacturing of bioactive compounds: current situation, challenges, and future perspectives / 生物工程学报

Biomanufacturing uses biological systems, including cells, microorganisms, and enzymes, to produce natural or synthetic molecules with biological activities for use in various industries, such as pharmaceuticals, cosmetics, and agriculture. These bioactive compounds are expected to play important roles in improving the quality of life and prolonging its length. Fortunately, recent advances in synthetic biology and automation technologies have accelerated the development of biomanufacturing, enabling us to create new products and replace conventional methods in a more sustainable manner. As of now, the role of biomanufacturing in the growth and innovation of bioeconomy is steadily increasing, and this techbology becomes a prevalent technology in global markets. To gain a comprehensive understanding of this field, this article presents a retrospective review of Bloomage Biotechnology's Research and Development and briefly reviews the developments of biomanufacturing and offers insights into the futre prospects. In conclusion, biomanufacturing will continue to be an important, environmentally friendly, and sustainable production mode in the ongoing development of bioeconomy.

Alleviation of isoproterenol-induced myocardial fibrosis in mice by autophagy regulated by Astragaloside Ⅳ through activating ROCK/JNK pathway / 药学实践杂志

Objective To investigate the effect and mechanism of astragaloside Ⅳ(AS-Ⅳ) activating ROCK/JNK to regulate autophagy in improving isoproterenol (ISO) induced myocardial fibrosis (MF) in mice. Methods The mice were randomly divided into control operation group (Control group), ISO induced myocardial fibrosis group (MF group), AS-Ⅳ treatment group (AS-Ⅳ group) and combination group of astragaloside IV and Y-33075 (ROCK inhibitor) (astragaloside IV+Y-33075 group). After repeated administration for 30 days. The serum levels of LDH, BNP, CTGF in each group were detected. The cardiac function was detected by ultrasound. Myocardial structure and tissue fibrosis degree in each group were detected by Sirius Red and Masson staining. Oxidative stress (ROS) levels in myocardial tissue of each group were detected by DHE staining and the expression of ROCK, JNK, Atg5, Beclin 1, and LC3 Ⅰ/Ⅱ in myocardial tissue were detected by Western blotting. Results Compared with AS-Ⅳ group, the EF value of AS-Ⅳ+Y-33075 group decreased and the degree of myocardial fibrosis increased (P<0.05). The serum level of LDH, BNP, CTGF increased and the level of ROS in myocardial tissue increased while the expression of ROCK, JNK, Atg5, Beclin 1, LC3 Ⅰ/Ⅱ decreased (P<0.05). Y-33075 could block the protective effect of AS-Ⅳ on myocardial injury induced by MF and inhibit the regulation of AS-Ⅳ on ROCK and JNK. Conclusion AS-Ⅳ could attenuate myocardial fibrosis in mice by activating ROCK/JNK signal and promoting autophagy.

The future of blended teaching: The minimalist BASIC reform model / 中华医学教育探索杂志

Under the influence of the coronavirus disease 2019 epidemic, the disadvantages of traditional blended teaching, which has been developed for 20 years, are gradually being revealed. With the help of modern network technology and under the guidance of minimalism, the new blended teaching model adheres to the principle of systematic, holistic, ecological, and collaborative reform and thus can not only efficiently realize the teaching goal of "improvement in self-learning ability and high-order thinking ability", but also achieve innovation and inheritance of "excellent teaching concepts and methods". On this basis, this study forms the "151 framework and BASIC mechanism", which will promote the reform and upgrading of blended teaching from point to surface and then to a three-dimensional structure and ensure that blended teaching has stronger vitality in the new era.

Screening and analysis of ferroptosis-related genes impacting the prognosis of colorectal adenocarcinoma patients based on bioinformatics / 肿瘤研究与临床

Objective:To screen and analyze ferroptosis-related genes (FRG) impacting the prognosis of colorectal adenocarcinoma patients based on bioinformatics.Methods:RNA sequencing data including the clinical information of 545 colorectal adenocarcinoma patients and 602 data sets were downloaded from the Cancer Genome Atlas (TCGA) database. FRG gene sets were downloaded from FerrDb database. FRG expression dataset could be obtained after taking the intersection between FRG gene sets and TCGA database gene sets. Differentially expressed FRG and prognosis-related genes between colorectal adenocarcinoma tissues and the adjacent tissues were screened by using R software, and finally FRG influencing the prognosis of colorectal adenocarcinoma were obtained. According to protein-protein interaction networks, the interaction and the expression association of proteins were analyzed. LASSO regression analysis was used to build a risk model for patients' 5-year overall survival rate. The risk value was calculated for 509 colorectal adenocarcinoma samples in the TCGA database, and then the median risk value was taken as the cut-off value. All patients were divided into the high-risk group (≥ median risk value) and the low-risk group (< median risk value), and the survival curves of the two groups were drawn. The receiver operating characteristic (ROC) curve was drawn for predicting the 5-year overall survival rate of colorectal adenocarcinoma patients in a time-dependent way in TCGA database according to the risk value of FRG prognosis model. Cox proportional risk model was used to make univariate and multivariate survival analysis in order to screen factors affecting the prognosis. The pathway enrichment analysis of prognosis-related FRG of colorectal adenocarcinoma was performed based on gene ontology (GO) database and Kyoto Encyclopedia of Genes and Genomes (KEGG) database.Results:The clinical information of 545 patients and 602 datasets were extracted from the database. A total of differential expressed 199 FRG in colorectal adenocarcinoma and 28 prognosis-related FRG were identified. After taking the intersection, 21 FRG affecting the prognosis of colorectal adenocarcinoma patients were identified. DUOX2, NOX4, NOX1, DDIT3, JDP2, ATP6V1G2, ULK1, ATG3 were probably associated with WIPI1; expressions of NOX4, NOX5, PLIN4 were positively correlated with ATP6V1G2, while the expression of ULK1 was negatively correlated with MAPK1, MYB, FANCD2, ATG3 and ATP5MC3. LASSO regression analysis showed that 15 FRG were finally screened out (ATP5MC3, NOX4, NOX5, ALOX12B, ATG3, WIPI1, MAPK1, MYB, AKR1C1, DDIT3, JDP2, ATP6V1G2, DRD4, SLC2A3, PLIN4), and the risk model was constructed by calculating the risk value, and the risk value = NOX4×0.139-ATP5M3×0.108+NOX5×1.486+ALOX12B×0.475-ATG3×0.030-WIPI1×0.170-MAPK1×0.271-MYB×0.063+AKR1C1×0.021+DDIT3×0.186+JDP2×0.292+ATP6V1G2×0.777+DRD4×0.294+SLC2A3×0.059+PLIN4×0.113. The overall survival of patients in the high-risk group was worse than that in the low-risk group ( P < 0.001). The 5-year overall survival rate was 48.2% in the high-risk group and 76.8% in the low-risk group. Multivariate survival showed that the age and risk value were independent affecting factors of the prognosis. ROC curves revealed that the risk model constructed by using prognosis-related FRG could well predict the 5-year overall survival rate of patients (the area under the curve was 0.728). The differential expressed genes of both groups may be associated with genetic pathways such as extracellular matrix composition, extracellular structure composition and focal adhesion. Conclusions:The prognostic risk model constructed by the screened FRG can better evaluate the prognosis of colorectal adenocarcinoma patients. These FRG are expected to become new candidate biomarkers related to the prognosis of colorectal adenocarcinoma.

Comparison of blood uric acid levels among employees with different mental states / 中华健康管理学杂志

Objective:To compare the serum uric acid levels among employees with different psychological states.Methods:From January 2019 to August 2021, 200 in-service employees of various enterprises and public institutions receiving health screening in PLA General Hospital were selected as the participants for this study. Based on the scores of psychological stress, anxiety, and depression scale, each of the three psychological states was divided into four groups from mild to severe. The baseline data, serum uric acid level, creatinine level, and urea nitrogen level of participants were studied to explore the relationship between different psychological states and changes serum uric acid level.Results:According to the degree of psychological stress, anxiety, and depression, serum uric acid levels were 198.52±30.24 μmol/L, 256.52±10.33 μmol/L, 354.20±15.54 μmol/L, and 399.20±20.20 μmol/L ( F value 694.662, P<0.001), respectively. There was statistical difference in serum uric acid level of employees with different psychological statuses; with the aggravation of psychological status, the serum uric acid level showed a trend of gradually increasing from low to high. There was a positive correlation between the scores of different psychological states and uric acid level ( r=0.885, 0.780, 0.794, P<0.05), and no correlation between uric acid level and creatinine and urea nitrogen levels ( r=1.869, 3.887, 5.798, P>0.05). Conclusions:The serum uric acid level of employees varied with different types of psychological states. The greater the psychological stress is,the more serious the degree of depression and anxiety and the higher the serum uric acid level would be. The increase in uric acid level has no relationship with creatinine and urea nitrogen level.

An eye-tracking study of dynamic threatening and non-threatening emotional faces in children with autism spectrum disorders / 中华行为医学与脑科学杂志

Objective:To investigate the gaze characteristics of children with autism spectrum disorder (ASD) on dynamic threatening (fear, anger) and non-threatening emotional (sadness, happiness) faces, and to explore the correlation between their eye-tracking data and autism symptomatology scores to provide a basis for the treatment and rehabilitation of children with ASD.Methods:From November 2020 to June 2021, 26 children with ASD and 30 age-and sex-matched normally developing children (typical developmental, TD) who met the enrollment criteria were included, and children with ASD were assessed for symptoms by the childhood autism rating scale (CARS). The SMI-red portable eye-tracking recording system was used to record the eye-movement gaze characteristics of children in both groups during free viewing of dynamic threatening and non-threatening emotional face segments.Statistical processing was performed by SPSS 21.0 software.The independent sample t-test and chi square test were used for the data conforming to the normal distribution, and the non parametric test was used for the data not conforming to the normal distribution, and Pearson correlation analysis was used to analyze the correlation between eye-tracking data and symptomatology scores. Results:The total CARS score of the ASD group was (32.64±7.42). The eye tracking data for children with ASD showed gaze aversion characteristics.Children with ASD spent significantly less time gazing at the eye area of threatening emotional faces in fear (2.41(0.26, 10.65)s) and anger (2.17(0.13, 6.13)s) than children with TD (8.81(2.54, 12.11)s, 5.21(3.80, 12.49)s), with statistically significant differences (fear: Z=-2.252, P<0.05.anger: Z=-2.793, P<0.01). Children with ASD spent significantly less time gazing at the mouth area of all four emotional faces (sad: 3.56(0.44, 7.16)s, fear: 2.68(0.42, 4.78)s, anger: 2.13(0.35, 4.20)s, happiness: 2.93(0.46, 5.71)s) than children with TD (sad: 11.43(6.97, 14.22) s, fear: 6.73(3.65, 10.10)s, anger: 6.86(4.55, 12.33)s, happiness: 11.72(7.22, 14.39)s), with statistically significant differences (sad: Z=-4.502, P<0.01.fear: Z=-3.493, P<0.01.anger: Z=-4.025, P<0.01.happiness: Z=-4.699, P<0.01). Correlation analysis revealed that the time spent gazing at emotional faces in children with ASD was negatively correlated with the total CARS score ( r=-0.476, P<0.05), and further analysis of different emotional faces revealed that the time spent gazing at fearful faces in children with ASD was negatively correlated with the total CARS score ( r=-0.455, P<0.05). Conclusions:Eye tracking in children with ASD show a gaze profile with less gaze time to threatening emotional faces compared with TD children, and the more severe the symptoms in children with ASD, the less gaze time to fearful faces.

A preliminary study on index system construction of the merging reform of doctoral degree education in clinical medicine with the standardized training of specialists / 中华医学教育探索杂志

Objective:To explore the reform plan for the integration of doctoral degree education in clinical medicine and standardized training for specialists.Methods:Using the literature analysis method and expert interview method, the preliminary framework of the merger training program was initially constructed, and Delphi method was used to determine the final index system. Excel 2010 was used to make data entry, and SPSS 19.0 was used for statistical analysis.Results:After two rounds of inquiry, the preliminary framework of the merger training program was finally determined from six aspects: enrollment methods, training resources, training content, training methods, training assessment and quality control, including 6 first-level indicators, 26 second-level indicators and 72 third-level indicators.Conclusion:By scientifically formulating systematic training programs, establishing the core training content and comprehensive evaluation system with post competency, and using flexible academic system, it provides a basis for carrying out the reform of the integration of doctoral education of clinical medicine and standardized training of specialists.

Clinical significance of NRSN2-AS1 expression in ovarian cancer and its biological effect in vitro / 中华内分泌外科杂志

Objective:To investigate the clinical significance and biological effect of long non-coding RNA (lncRNA) NRSN2-AS1 in ovarian cancer.Methods:The expression of NRSN2-AS1 was detected by real-time quantitative PCR (RT-qPCR) in 84 cases of ovarian cancer tissues and corresponding normal adjacent tissues, and the relationship between NRSN2-AS1 expression and clinical data of patients was analyzed. Human ovarian epithelial cells HOSEpiC and human ovarian cancer cells A2780 and OVCAR3 were cultured in vitro, and overexpression or interference of NRSN2-AS1 and control plasmids were respectively transfected into A2780 and OVCAR3 cells as the blank group, overexpression group and control group, interference group. CCK-8 assay was used to detect cell proliferation, while transwell invasion and migration assay were used to detect the change of cell metastasis ability, RT-qPCR and Western blot were used to detect the expressions of SRY related HMG box transcription factor 12 (SOX12), a potential downstream gene of NRSN2-AS1.Results:The expressions of NRSN2-AS1 in ovarian cancer tissues and cells were significantly higher than normal adjacent tissues, and the high expression of NRSN2-AS1 was significantly correlated with poor prognosis, lymph node metastasis and high clinical stage ( P<0.05). In the blank and overexpression group, the expressions of NRSN2-AS1 were 1.00±0.08 and 5.78±0.41, the expressions of SOX12 mRNA were 1.00±0.10 and 3.08±0.23, the expression of SOX12 protein were 1.00±0.08 and 7.26±0.39, the invasion cells per field were 22.7±4.9 and 79.0±6.2, and the migration cells per field were 26.5±4.1 and 43.5±4.5. In the control and interference group, the expression of NRSN2-AS1 were 1.00±0.11 and 0.37±0.04, the expressions of SOX12 mRNA were 1.00±0.07 and 0.59±0.05, the expression of SOX12 protein were 1.00±0.07 and 0.36±0.03, the invasion cells per field were 68.3±6.1 and 30.6±5.5, and the migration cells per field were 85.2±7.0 and 22.7±4.2. Compared with the blank group, the expression of SOX12 mRNA and protein in the overexpression group was significantly increased ( P<0.05), and the cell proliferation and metastasis ability were significantly enhanced ( P<0.05). Compared with the control group, the expression of SOX12 mRNA and protein in the interference group was significantly decreased, and the ability of cell proliferation and metastasis was suppressed significantly ( P<0.05) . Conclusion:The expression of NRSN2-AS1 is up-regulated in ovarian cancer, which is closely related to poor prognosis and progression of ovarian cancer. NRSN2-AS1 can promote the expression of SOX12 and the malignant behavior of ovarian cancer cells in vitro.

Bibliometric analysis of research on the moral culture construction of the healthcare industry in China / 中华医院管理杂志

Objective:To analyze the current situation of research on the moral culture construction of the healthcare industry in China, and provide reference for further promoting such construction.Methods:Relevant literature on the moral culture construction of the healthcare industry published from 2012 to April 18, 2022 were retrieved on CNKI, and bibliometric analysis was made on the temporal distribution, sources, institutional cooperation, keyword clustering, etc. of the literature through CiteSpace 5.8.R3 software.Results:A total of 126 effective documents were included, and the highest number of published articles was 23 in 2018. The top 5 journals were all non-core journals with a total of 45 articles(35.71%). The number of papers issued by 11 research institutions was 2, and the other 102 were all 1. The overall density of the knowledge map network of research institutions was 0. The top three keywords in terms of frequency were " moral culture construction" , " hospital" and " medical ethics" , of which the heart rate was>0.1.The results of cluster analysis of subject research showed that the research subjects of the moral culture construction of the healthcare industry mainly focus on the construction of hospital moral culture and medical ethics. Most of the research subjects focused on hospitals, and focus on the construction of public hospitals′ moral culture. The research content was related to medical ethics, party conduct, and doctor-patient relationship.Conclusions:Medical and health institutions should pay more attention to the construction and research of moral culture, expand the depth of research, enhance the influence of this research field, and pay attention to the construction of moral culture of healthcare institutions outside hospitals.

A BRD4 PROTAC nanodrug for glioma therapy via the intervention of tumor cells proliferation, apoptosis and M2 macrophages polarization

Glioma is a primary aggressive brain tumor with high recurrence rate. The poor efficiency of chemotherapeutic drugs crossing the blood‒brain barrier (BBB) is well-known as one of the main challenges for anti-glioma therapy. Moreover, massive infiltrated tumor-associated macrophages (TAMs) in glioma further thwart the drug efficacy. Herein, a therapeutic nanosystem (SPP-ARV-825) is constructed by incorporating the BRD4-degrading proteolytic targeting chimera (PROTAC) ARV-825 into the complex micelle (SPP) composed of substance P (SP) peptide-modified poly(ethylene glycol)-poly(d,l-lactic acid)(SP-PEG-PDLLA) and methoxy poly(ethylene glycol)-poly(d,l-lactic acid) (mPEG-PDLLA, PP), which could penetrate BBB and target brain tumor. Subsequently, released drug engenders antitumor effect via attenuating cells proliferation, inducing cells apoptosis and suppressing M2 macrophages polarization through the inhibition of IRF4 promoter transcription and phosphorylation of STAT6, STAT3 and AKT. Taken together, our work demonstrates the versatile role and therapeutic efficacy of SPP-ARV-825 micelle against glioma, which may provide a novel strategy for glioma therapy in future.

Brief interpretation of the consensus nomenclature for reporting neovascular age-related macular degeneration data / 中华眼底病杂志

With the rapid development of fundus imaging technology, it is of great significance to establish a new naming system for neovascular age-related macular degeneration (nAMD) based on the multi-mode imaging. In 2020, an international panel of retina specialists, imaging and image reading center experts, and ocular pathologists reached a consensus after repeated discussions, a new name for nAMD subtype and related lesions was established based on the previous knowledge of fundus fluorescein angiography and pathology, combining indocyanine green angiography, optical coherence tomography and optical coherence tomography angiography with current pathological knowledge, in order to help ophthalmologists to study nAMD. The consensus proposed the term "macular neovascularization" and classified it into type 1, type 2 and type 3. Many lesions related to macular neovascularization, such as pigment epithelial detachment, hemorrhage, fibrosis, rip of retinal pigment epithelium and so on, were named. The new designation will help improve clinical communication between different studies, establish standard definitions and terms between reading centers and researchers, and further promote the understanding and communication of nAMD among ophthalmologists.

Application of sensory integration therapy in cerebral palsy rehabilitation: a systematic review / 中国康复理论与实践

@#Objective To systematically review the research progress of sensory integration therapy in the rehabilitation of children with cerebral palsy. Methods The literatures related to the application of sensory integration therapy in the rehabilitation of children with cerebral palsy was retrieved from Web of Sciences, PubMed, CNKI, Wanfang data, and VIP databases until November 27, 2021, using subject search. And the contents of the literatures were extracted to review the implementation plan of sensory integration therapy and the effectiveness of its application in the rehabilitation of children with cerebral palsy. Results Six literatures were included. The main focus was on the research of sensory integration therapy on postural control, gross motor function, intelligence level and cognitive function, and treatment modalities in children with cerebral palsy. Conclusion Sensory integration therapy is effective on motor function, posture control and intelligence in children with cerebral palsy. To maximize the effect of sensory integration therapy, a suitable rehabilitation treatment plan should be formulated according to the degree of sensory integration disorder and the age, gender and tolerance of children.

Clinical study of using constant temperature vaginal mould to prevent radiation vaginal stenosis in patients with cervical cancer treated with radiotherapy / 中国辐射卫生

Objective to investigate the clinical effect of constant temperature vaginal mould in preventing vaginal stricture in patients with cervical cancer treated with radiotherapy. Methods from January 2017 to December 2018, 80 patients with cervical cancer were selected and divided into vaginal irrigation control group (n = 40) and observation group (n = 40). The incidence of vaginal stricture was compared between the two groups. Results the incidence of vaginal stenosis was 32.50% in the observation group and 70.00% in the control group (P < 0.05). Conclusion vaginal mould is helpful to reduce the incidence of vaginal stenosis caused by external irradiation and close irradiation, which is worth popularizing in the future.