ABSTRACT
In 2009, Pittosporum tobira (Thunb.) Ait. plants showing virus-like symptoms were observed in two ornamental greenhouses in two regions of the eastern coast of Spain (Tarragona and Valencia). Affected plants showed veinal yellowing and interveinal yellow mottling on the leaves. In addition, surveys conducted in 2010 in three public gardens in Valencia revealed 4% of P. tobira plants grown as hedges showed similar, but less severe symptoms. Five symptomatic and five asymptomatic P. tobira leaves were collected and analyzed by double antibody sandwich-ELISA using polyclonal antisera for Alfalfa mosaic virus (AMV) (SEDIAG S.A.S., Longvic, France) and Eggplant mottled dwarf virus (EMDV) (Deutsche Sammlung von Mikroorganismen und Zellkulturen Gmbh [DSMZ], Braunschweig, Germany). Samples were considered positive only if the mean absorbance value of duplicate wells was more than three times the mean absorbance of healthy control leaf samples. Only the five symptomatic samples tested positive for EMDV in the serological analyses. To confirm the results, a pair of EMDV-specific primers was designed using the published sequence of a fragment of the EMDV polymerase gene available in GenBank (Accession No. AM922322): EMDV-D (5' TATGCGAGAATTGGGAGTGGGTAGT 3') and EMDV-R (5' CATTGTTATCCCGGGAAGTATTT 3') targeting a 400-bp fragment. Total RNA was extracted from the symptomatic leaves and tested by reverse transcription (RT)-PCR assay with specific primers for AMV (4) and the primer pair designed for EMDV. The type isolate (EMDV-PV-0031, DSMZ) was used as a positive control sample in the serological and molecular analyses. None of the samples tested positive for AMV. The same five symptomatic samples that tested positive in the serological assays also tested positive for EMDV in the RT-PCR assay. Two RT-PCR products amplified from RNA of symptomatic P. tobira leaves and one from the type isolate were purified and directly sequenced. BLAST analyses of two sequences from infected P. tobira leaves (Accession Nos. HM636918 and HM636919) revealed 90% nucleotide identity to both the EMDV-Egg isolate (Accession No. AM922322) and the type isolate (EMDV-PV-0031, DSMZ), and 98% similarity among the P. tobira isolates. EMDV was first reported in the Canary Islands, Spain (3), and later was detected in the northeastern peninsular Spain on cucumber and eggplant (1). Although EMDV has been described as affecting P. tobira in countries such as Italy, Libya, and the former Yugoslavia (3), to our knowledge, this is the first report of EMDV infecting P. tobira in Spain. EMDV is generally considered of minor importance. However, P. tobira infection might have epidemiological consequences for susceptible cultivated crops such as eggplant or cucumber. Moreover, where P. tobira is used as a vegetatively propagated ornamental plant, EMDV could be transmitted from infected plants by the leafhopper vector (2). References: (1) J. Aramburu et al. Plant Pathol. 55:565, 2006. (2) G. H. Babaie and K. Izadpanah. J. Phytopathol. 151:679, 2003. (3) A. A. Brunt et al. Plant Viruses Online: Descriptions and Lists from the VIDE Database. Version: 20. Retrieved from http://biology.anu.edu.au/Groups/MES/vide/ , August, 1996. (4) L. Martínez-Priego et al. Plant Dis. 88:908, 2004.
ABSTRACT
During the spring of 2007, pea plants (Pisum sativum L.) (cvs. Utrillo and Floreta) showing virus-like symptoms were observed in several commercial fields in the southern and eastern regions of Catalonia, Spain. Incidence of symptomatic plants ranged from 5 to 15% and was distributed in both small and large patches. Infected plants exhibited yellow mosaic leaf symptoms that later became translucent. Leaves gradually curled and in some cases developed enations near the veins on the abaxial surface. Plants were "bushy" and had shortened internodes. Infection prior to pod formation resulted in pods that were distorted and stunted (1). The infected leaves and pods were tested by indirect-ELISA with a potyvirus-specific antibody (Agdia, Elkhart, IN) and double-antibody sandwich (DAS)-ELISA with antibodies specific to Pea enation mosaic virus (PEMV), Broad bean wilt virus 1 (BBWV-1), Beet western yellow virus (BWYV), Bean yellow mosaic virus (BYMV), Alfalfa mosaic virus (AMV), and Tomato spotted wilt virus (TSWV) (Loewe Biochemica GmbH, Sauerlach, Germany). PEMV was detected in all 24 symptomatic samples that were collected from 10 locations between March 2007 and March 2008. Thirteen of these samples also tested positive for BWYV, but no differences in symptom expression were observed in plants infected with both viruses or PEMV alone. PEMV was also identified in seven broad bean plants (Vicia faba L.) from three additional locations. These plants expressed interveinal yellow mosaic on leaves and deformed pods. The genomic sequence of PEMV-1 (GenBank Accession No. L04573) was used to design primers to amplify a 451-nt segment of the polymerase gene by reverse transcription (RT)-PCR; PEMV-D (5'-TGACCATGAGTCCACTGAGG-3'), PEMV-R (5'-AGTATCTTCCAACAACCACAT-3'). One ELISA-positive sample was analyzed and the expected size amplicon was generated. Direct sequencing (GenBank Accession No. EU652339) revealed that PEMV-1 and our pea isolate have nucleotide sequence identities of 95%. To our knowledge, this is the first report of PEMV in Spain, which might cause important economical losses since PEMV is an important viral disease of pea and other legumes worldwide. Reference: (1) J. S. Skaf and G. A. Zoeten. No. 372 (No. 257 revised) in: Description of Plant Viruses. AAB, Kew, Surrey, England, 2000.
