Surgical maneuvers for long-segment Hirschsprung pull-through in unique patients.

PURPOSE: Patients with Hirschsprung disease affecting the splenic flexure or more proximal segments present a surgical challenge. Mobilizing the transverse colon to the pelvis during a pull-through may obstruct the distal ileum, or the length may be insufficient to reach the lower pelvis. This retrospective study aimed to describe two surgical techniques that facilitate mobilization of the transverse colon and their outcome. METHODS: We included patients operated on between April 2017 and April 2024 and analyzed sex, comorbidities, type of pull- through, age at pull-through, history of previous surgeries, cause of the proximal transverse colon pull-through, technique used (Deloyers or Turnbull), complications , postoperative outcome and follow-up. The first technique used was the maneuver described by Turnbull. This operation creates a mesenteric defect and mobilizes the colon into this mesenteric window at the distal ileum level. The second technique was described by Deloyers and involves a 180-degree rotation of the right colon by dissecting the right colon attachment and the hepatocolic ligament. The cecum and the ileocecal valve are placed in the right upper quadrant, and the distal colon is mobilized into the pelvis. RESULTS: We included 13 patients, 12 boys and 1 girl. Eight patients had previous surgeries in another hospital: five had an initial transverse colostomy, and three had an ileostomy. The remaining five had the initial operation in our hospital: two had an ileostomy, two had a colostomy, and one had a primary pull-through. The median age at pull-through was 16 months (4-59 months). We used the Turnbull technique in four patients whose aganglionosis was limited to the middle transverse colon. The Deloyers technique was used in the remaining patients, with ganglion cells in the proximal transverse colon. We left a protective ileostomy in five patients. The median follow-up was 4.5 years (3 months to 10 years). The stoma takedown is pending in one patient. CONCLUSION: The Turnbull and Deloyers techniques were helpful in patients with aganglionosis affecting the transverse colon.

Standardization of radiograph readings during bowel management week.

INTRODUCTION: During "bowel management week," abdominal radiographs are used to monitor the amount and location of stool. A radiologist familiar with the treatment plan can provide an improved interpretation. The goal of this paper is to standardize the radiological reports during a bowel management week. METHODS: We saw 744 patients during bowel management week from May 2016 until March 2023. Diagnosis included: anorectal malformation (397), idiopathic constipation (180), Hirschsprung disease (89), and spina bifida (78). Laxatives were the treatment for 51% of patients, and 49% received enemas. Characteristic radiographs were selected for each treatment group for a proposed reading standardization. RESULTS: When the stool is visualized, it is crucial to report its location. Having a contrast enema helps with the correct interpretation of the colonic anatomy. It is also essential to always compare the amount of stool with the radiograph from the previous day to determine if there is an increase or decrease in stool. Examples of radiographs are shown to guide the use of the preferred proposed terminology. CONCLUSION: Providing information regarding which treatment modality the patient is receiving and stating that a patient is on a bowel management week treatment is crucial for the radiologist to provide adequate interpretation. The radiologist must be familiar with the treatment goals and purpose of the daily radiograph.

Sequence analysis of exons 30 and 31 of LAMA3 gene variants and its association with human papillomavirus infection predisposition: no evidence was found.

OBJECTIVE: Human papillomavirus (HPV) is associated with cervical cancer. For the infection to occur, most HPV types depend on interactions with heparan sulfate proteoglycans (HSPGs); however, non-HSPGs receptors are also involved. Laminin 332 is a crucial component of the epidermis's base membrane. It has shown interactions with HPV that suggest its function as a transient viral receptor in the extracellular matrix (ECM). We provide new information about Laminin 332 and HPV by identifying LAMA3 gene allelic variants from exons 30 and 31 and their distribution among women with and without HPV infection. PATIENTS AND METHODS: We included 192 cervical cancer scrape samples from two groups of patients, 96 samples from patients with a low-grade squamous intraepithelial lesion (LSIL) and 96 samples from HPV-negative samples without LSIL. Identification of the HPV type was performed using an LCD-Array kit. Exons 30 and 31 of LAMA3 were amplified by PCR and analyzed by Sanger's sequencing. RESULTS: We identified a wide range of HPV types. The most frequent low-risk (lrHPV) HPV types were 6, 42, 44, and 90. For high-risk (hrHPV) HPV were 16, 31, 56, and 66. Only the genetic variant rs1131521 was identified in both groups. However, no significant association was observed between rs1131521 and the study groups. CONCLUSIONS: A single silent polymorphism was identified in both groups with similar frequency, whereas no mutations related to increased epithelial friability were identified.

Incidence of medullary thyroid carcinoma and Hirschsprung disease based on the cosmos database.

PURPOSE: Multiple endocrine neoplasia Type 2A (MEN2A) can occur with Hirschsprung disease (HD) due to mutation in the RET proto-oncogene, with the majority developing medullary thyroid carcinoma (MTC). Given the comorbidity, many parents have contacted us to share concerns and unfortunate experiences about the prevalence rates of MEN2A/MTC in patients with HD. The aim is to determine the prevalence rate of patients with HD and MEN2A or medullary thyroid carcinoma, respectively. METHODS: This is a cross-sectional study of the COSMOS database from January 01, 2017, to March 08, 2023. The database was searched for patients diagnosed with MEN2A, MTC, and HD. IRB exemption was provided (COMIRB #23-0526). RESULTS: The database contained 183,993,122 patients from 198 contributing organizations. The prevalence of HD and MEN2A was 0.00002%, and for HD and MTC was 0.000009%. One in 66 patients (1.5%) with MEN2A also had HD. One in 319 patients (0.3%) in the HD group had MEN2A. One in 839 patients (0.1%) within the HD population had MTC. CONCLUSION: The prevalence of MTC and HD or MEN2A and HD in the study population was low. Considering that almost all MEN2A patients have a positive family history, this data does not support the general genetic testing of HD patients.

An event-based adaptation of the relay feedback experiment for frequency response identification of stable processes.

An event-based modification of the classical relay feedback experiment without the inclusion of additional elements (integrator, time delay, …) for identification of the spectrum of stable processes between zero and the phase cross-over frequency is presented. By inserting an event-based sampler in the control loop, the natural behaviour of a classical relay is simulated and the system is forced to work in two modes. The event-based sampler activates the first mode by sending control actions to the process every time the error signal crosses zero; this mode is to discover the approximated value of the cross-over frequency [Formula: see text] . During the second mode, the event-based sampler sends samples to the process simulating that the error signal crosses zero at [Formula: see text] where N is the number of points to identify in the range [Formula: see text] . One advantage of this procedure is that the logic used in an already existing relay feedback experiment to fit a transfer function model or tune a controller could be maintained just replacing the relay block by the event-based sampler block presented in the paper. Simulations and experiments with different processes and in presence of noise demonstrate the effectivity of the procedure.

Detección temprana de deterioro cognitivo leve en personas mayores durante la pandemia: protocolo cribado online / Early detection of mild cognitive impairment in older people during the pandemic: online screening protocol

Introducción: la pandemia COVID-19 ha tenido un gran impacto en la vida y en especial en las personas mayores. El objetivo del presente estudio fue explorar un protocolo de cribado online para detectar tempranamente Deterioro Cognitivo Leve en personas mayores. Métodos: fue de tipo cuantitativo y cualitativo. La muestra fue de 22 personas mayores de las comunas de Coronel y Lota, Región del Bio-bio. El protocolo estaba compuesto por: Cuestionario sociodemográfico, Test del Reloj Versión Cacho, Moca versión validada en Chile, Escala Depresión Yesavage y Test Acentuación de Palabras. El procedimiento consistió en la aplicación del protocolo a través de un Tablet o Laptop. Resultados: se encontró que la mayoría no presentaba deterioro cognitivo, pero si depresión. Conclusiones: se discute sobre la aplicación de un protocolo de diagnóstico online en personas mayores y los indicadores de depresión que podrían estar dado por la situación actual de pandemia.

The COVID-19 pandemic has had a great impact in the world, more so in the lives of elderly people. The objective of this study was to explore an online screening protocol to detect early Mild Cognitive Impairment. The method was both quantitative and qualitative, the sample included 22 elderly people from the Coronel y Lota, Biobio region. The protocol was integrated with a sociodemographic questionnaire, the Clock Drawing Test (Cacho Version), MOCA (validated in Chile version), Yesavage Depression Scale (Reduced version) and the Word Accentuation Test. The evaluation involved applying the protocol online in a tele neuropsychological assessment. The results showed that most of the elder people evaluated did not present cognitive impairment but did have depression. The application of an online diagnostic protocol in older people and the indicators of depression that could be given by the current pandemic situation are discussed.

Do adult patients with congenital colorectal conditions know their diagnosis?

PURPOSE: Limited research exists about the knowledge that adult patients have about their congenital colorectal diagnosis. METHODS: This was an IRB approved, prospective study of patients in the Adult Colorectal Research Registry who completed surveys between October 2019 and March 2022. Surveys were administered through REDCap after patients consented to being contacted for research purposes. Patients provided demographic data, which was linked to surgical records, and the diagnoses provided by patients were compared with diagnoses recorded by the original surgeons. RESULTS: One hundred and thirty-one questionnaires were collected, 115 patients had anorectal malformations (ARM) and 16 had Hirschsprung disease (HD). Seven patients who had ARM were unaware that they had an ARM or HD. The type of ARM recorded by the surgeon was unavailable for comparison with the patient's reported diagnosis in four cases. Of the 111 remaining patients with ARM, only 32 of them (29%) knew what their own type of anomaly was. Female patients recalled their diagnosis more often than male patients (42.4% vs 13.5%). All 16 participants with HD correctly identified their diagnosis severity as HD with or without total colonic aganglionosis. CONCLUSION: The results of this study demonstrate patient's limited understanding of their type of ARM and highlight the urgent need to enhance communication and education strategies, such as issuing patients with medical diagnosis identification cards. It is critical for clinicians to better communicate with patients to ensure that they and their relatives truly understand their precise diagnosis. Adequately informed patients can better advocate for themselves, adhere to treatments and precautionary recommendations and navigate the complexities of transitional care. Consequently they can more effectively manage their lifelong complications.

Fetal hemoglobin regulating genetic variants identified in homozygous (HbSS) and heterozygous (HbSA) subjects from South Mexico.

Hemoglobin S is caused by a nucleotide change in HBB gene (HBB:c.20A>T, p.Glu6Val), is presented in diverse forms: simple carriers (HbSA), homozygotes (HbSS) also known as sickle cell anemia, and compound heterozygotes with other ß-hemoglobinopathies. It is worldwide distributed, in Mexico, is frequently observed in the southern states Guerrero, Oaxaca and Chiapas. Elevated fetal hemoglobin (HbF) is associated with mild phenotype; single-nucleotide variants (SNVs) in modifier genes, such as BCL11A, HBG2, HBBP1 pseudogene and HBS1L-MYB intergenic region, upregulate HbF synthesis. The aim of this study was to identify HbF regulating genetic variants in HbSS and HbSA Mexican subjects. We studied 39 individuals (HbSS = 24, 61%, HbSA = 15, 39%) from Chiapas (67%) and Guerrero (33%), peripheral blood was collected in ethylenediamine tetraacetic acid (EDTA) for molecular and hematological studies, DNA was isolated by salting-out technic and genotyping was performed through allelic discrimination by real time polymerase chain reaction (RT-PCR) using Taqman® probes for 15 SNV (in BCL11A: rs6706648, rs7557939, rs4671393, rs11886868, rs766432, rs7599488, rs1427407; HBS1L-MYB: rs28384513, rs7776054, rs9399137, rs4895441, rs9402686, rs1320963; HBG2: rs7482144; and HBBP1: rs10128556). The obtained data were analyzed using IMB SPSS v.22.0 software. All minor alleles were observed in frequencies over 0.05, the most frequent was rs9402686 (0.82), while the less frequent was rs101028556 (0.08). In HbSS group, the mean fetal hemoglobin was 11.9 ± 5.9% and was significantly elevated in BCL11A rs11886868 wildtype homozygotes and in carriers of HBS1L-MYB intergenic region rs7776054 (p = 0.04 and p = 0.03, respectively). In conclusion, in HbSS Mexican patients, two SNVs were observed related to increased HbF; BCL11A rs11886868 and HBS1L-MYB rs7776054.

Sickle cell anemia (SCA) is one of the most common types of hemoglobinopathies in people of African ancestry, it is caused by homozygosity of HbS mutation (HBB:c.20A>T). It is known that fetal hemoglobin plays a key role in decreasing HbS polymerization which damages the erythrocyte structure and is responsible for the characteristic hemolytic crises endured by these patients. Single-nucleotide variant (SNV) in genes that regulate fetal hemoglobin (HbF) after birth have been associated with its increment, thus ameliorating the hematologic phenotype of this pathology and other ß-hemoglobinopathies. Therefore, in this study, we identified, for the first time in Mexican patients with SCA (HbSS) and HbS carriers (HbSA), the presence of 15 SNVs on BCL11A, HBS1L-MYB and HBG2; all HbSS patients had anemia and elevated HbF; 2 variants were related to increased HbF rs11688888C of BCL11A and rs7776054G of HBSIL-MYB; and finally, all minor alleles were found at a frequency higher than 0.05.

Mutational spectrum of the iduronate-2-sulfatase gene in Mexican patients with Hunter syndrome.

OBJECTIVE: Hunter syndrome, or mucopolysaccharidosis type II (MPS II), is caused by deficiency of the lysosomal enzyme iduronate-2-sulfatase (IDS), which is responsible for degrading heparan and dermatan sulfate. The IDS gene is located on chromosome Xq28; pathological variants in this gene mostly consist of missense mutations and small and larger deletions, which produce different phenotypes. However, there is only one record in our population concerning the molecular mechanism of this disease; a genotype-phenotype description is not available. PATIENTS AND METHODS: There were included 24 unrelated male patients; clinical features were recorded at a database, fluorometric IDS enzyme activity testing was done for each individual, followed by Sanger sequencing to identify mutations. RESULTS: The mutational spectrum was found in 16 out of 24 Mexican patients with MPS II, and its range of phenotypes was described. The most frequent variants were of the missense type. The most affected exons were exon 3 (c.275T>G, c.284_287del, c.325T>C), exon 8 (c.1035G>C, c.550G>A), exon 9 (c.1403G>C, c.1229_1229del), and exon 7 (c.979A>C; this variant has not been previously reported). Exon 5 (c.438C>T, a non-pathogenic variant) was the least frequent. It was also found that the most severely affected patients were those with large deletions (2 out of 24) [rsaIDS: IDSP1 (P164)x0, FMR1, AFF2 (P164)x2] involving genes and pseudogenes. We found 2 patients with a synonymous mutation in exon 4. CONCLUSIONS: Our results confirmed reports in the literature, since the most frequent variants were reported in exons 3 and 8. However, this result varies from one previous report in our population, which mentions large deletions and rearrangements as the most frequent alterations, since complex rearrangements were not found. According to what has been previously found, the most severely affected patients are those in which a whole gene has been deleted.

Social determinants in the access to health care for Chagas disease: A qualitative research on family life in the "Valle Alto" of Cochabamba, Bolivia.

INTRODUCTION: Chagas disease is caused by the Trypanosoma cruzi infection. It is a neglected tropical disease with considerable impact on the physical, psychological, familiar, and social spheres. The Valle Alto of Cochabamba is a hyperendemic region of Bolivia where efforts to control the transmission of the disease have progressed over the years. However, many challenges remain, above all, timely detection and health-care access. METHODS: Following the Science Shop process, this bottom-up research emerged with the participation of the civil society from Valle Alto and representatives of the Association of Corazones Unidos por el Chagas from Cochabamba. The aim of this study is to explore the social determinants in the living realities of those affected by Chagas disease or the silent infection and how families in the Valle Alto of Cochabamba cope with it. An interdisciplinary research team conducted a case study of the life stories of three families using information from in-depth interviews and performed a descriptive qualitative content analysis and triangulation processes. FINDINGS: Findings provide insights into social circumstances of the research subjects' lives; particularly, on how exposure to Trypanosoma cruzi infection affects their daily lives in terms of seeking comprehensive health care. Research subjects revealed needs and shared their experiences, thus providing an understanding of the complexity of Chagas disease from the socioeconomic, sociocultural, political, and biomedical perspectives. Results enlighten on three dimensions: structural, psychosocial, and plural health system. The diverse perceptions and attitudes toward Chagas within families, including the denial of its existence, are remarkable as gender and ethnocultural aspects. Findings support recommendations to various stakeholders and translation materials. CONCLUSIONS: Intersectional disease management and community involvement are essential for deciding the most appropriate and effective actions. Education, detection, health care, and social programs engaging family units ought to be the pillars of a promising approach.

Antarctic ascidians under increasing sedimentation: Physiological thresholds and ecosystem hysteresis.

Glacier melting sediment inputs affect coastal ecosystems on the Antarctic Peninsula. In Potter Cove (South Shetland Islands, Antarctica), the shift from an "ascidian dominated" to a "mixed" assemblage has been linked to sedimentation. However, in recently described newly ice-free areas ascidians became dominant in spite of total suspended particulate matter (TSPM) concentrations, which are the highest measured in Potter Cove. Here, we compared the gut content and energy reserve of three ascidian species at three stations under different TSPM regimes. All analysed species had a higher gut content with lower %OM at these newly areas. A theoretical relationship between the scope for growth for the targeted ascidians and TSPM explained assemblages' recorded change but failed to explain current ascidians distribution. The results may indicate the existence of a TSPM threshold that allows the spatial coexistence of alternative stable states at benthic Potter Cove system.

Comparison of the performance of a high voltage generator insulated by gas or liquid dielectric.

A module of a wireless high voltage generator was tested immersed in both gaseous and liquid environments providing electrical insulation. The overall performance of the module as well as a detailed performance of the key components are reported, and a comparison between the results in gas and liquid is given. The tests performed on the liquid dielectric show that it is a valid alternative to high pressure gas electrical insulation.

Error traps and culture of safety in Hirschsprung disease.

Hirschsprung disease affects many children every year around the world. Currently, there is an extensive menu of diagnostic methods, and surgical treatments. This situation compels the physicians to follow the rationale of these interventions. The comprehensive diagnosis and treatment of Hirschsprung disease need singular procedures. The clear understanding of how to perform each of these techniques, as well as to read the results is mandatory. Otherwise, the medical team may perform unconscious errors and fall into traps. Many errors still happen in patients with Hirschsprung, resulting in a spectrum of problems; from delayed diagnosis to unnecessary colectomies. In other patients, the damage to the anal canal results in fecal incontinence. When this is established, it is an unreversed and devastating social problem. This article describes why these errors occur and how to prevent them.

Guidelines for the management of postoperative soiling in children with Hirschsprung disease.

Although most children with Hirschsprung disease ultimately achieve functional and comfortable stooling, some will experience a variety of problems after pull-through surgery. The most common problems include soiling, obstructive symptoms, enterocolitis, and failure to thrive. The purpose of this guideline is to present a rational approach to the management of postoperative soiling in children with Hirschsprung disease. The American Pediatric Surgical Association Hirschsprung Disease Interest Group engaged in a literature review and group discussions. Expert consensus was then used to summarize the current state of knowledge regarding causes, methods of diagnosis, and treatment approaches to children with soiling symptoms following pull-through for Hirschsprung disease. Causes of soiling after pull-through are broadly categorized as abnormalities in sensation, abnormalities in sphincter control, and "pseudo-incontinence." A stepwise algorithm for the diagnosis and management of soiling after a pull-through for Hirschsprung disease is presented; it is our hope that this rational approach will facilitate treatment and optimize outcomes.

Valorization and extraction of cellulose nanocrystals from North African grass: Ampelodesmos mauritanicus (Diss).

The aim of this research activity was based on the revalorization of Amplodesmos mauritanicus (Diss), an African grass largely presented in the Algerian territory. Diss stems were selected as native botanic material for the extraction of cellulose nanocrystals (CNC). Two different pretreatment steps were carried out to extract CNC from Amplodesmos mauritanicus stems and the following acidic hydrolysis procedure allowed to extract/obtain cellulose nanocrystals in aqueous suspension. The effect of the two different pretreatments, based essentially on chemical or enzymatic treatments, were deeply investigated and the properties compared. Field emission scanning electron microscopy (FESEM), thermogravimetric analysis (TGA), Fourier transform infrared (FTIR) spectroscopy and X-ray diffraction (XRD) were considered for the characterization of raw material, chemical or enzymatic treated Diss stems and CNC extracted from both chemical and enzymatic pretreated cellulose.

Actitud, hábitos de estudio y rendimiento académico: Abordaje desde la teoría de la acción razonada / Attitudes, study habits, and academic performance: Addressing them from the theory of the reasoned action / Atitude, hábitos de estudo e rendimento académico: Abordagem desde a teoria da ação racional

Introducción Las actitudes y los hábitos hacia el estudio y el aprendizaje son un factor de suma importancia en la determinación del rendimiento académico. Objetivo Analizar la correlación entre actitud y hábitos de estudio con el rendimiento académico en estudiantes universitarios. Metodología Es una investigación de corte cuantitativo, transversal, correlacional y analítico, participaron 286 estudiantes de manera voluntaria. Para medir las variables se utilizaron el Inventario de Hábitos de Estudio y el Cuestionario de Evaluación de Actitudes ante el Aprendizaje en Estudiantes Universitarios. Los datos se analizaron mediante el programa estadístico STATA v.11.1, se realizaron pruebas de comparación de frecuencias (chi-cuadrada), de correlación (r de Pearson) y análisis de regresión logística. Resultados Del total de los participantes (n=286), 75.8% fueron del sexo femenino; 43.7% (n=125) tuvieron alto rendimiento académico, con promedio general de 9 o más. En cuanto a los hábitos de estudio, 66.4% (n=190) obtuvieron puntajes en la clasificación de adecuados, 25.2% (n=72) presentaron actitudes positivas hacia el estudio; Se obtuvo una asociación altamente significativa (p=0.001,) entre hábitos y actitudes ante el estudio mediante una prueba de chi-cuadrada. La correlación entre hábitos de estudio y actitudes hacia el estudio fue moderada pero significativa (r=0.461, p < 0.05); el análisis de regresión logística, reveló asociaciones positivas entre actitudes y rendimiento académico. Conclusiones Este estudio demuestra que las actitudes y los hábitos de estudio, tienen un fuerte impacto en el rendimiento académico.

Introduction Attitudes and habits towards studying and learning are important factors while determining academic performance. Objective To analyze the correlation between attitude and study habits, with academic performance among university students. Methodology This is a quantitative, transversal, correlational and analytical research where 286 students voluntarily participated. In order to estimate the variables, the Study Habits Inventory, and the Assessment of Attitudes towards Learning among University Students scale were used. Data were analyzed using the STATA v.11.1 program. Frequency comparison tests (chi-square), correlations (Pearson r), and logistic regression were calculated. Results From the total of participants (n=286), 75.8% were female, while 43.7% (n=125) showed high academic performance with a 9/10 or higher grade average. Regarding the study habits, and 66.4% (n=190) obtained an adequate classification score; and 25.2% (n=72) showed positive attitudes towards studying. The correlation related to habits and attitudes towards studying was found to be r=0.461, p < 0.05; while the logistic regression analysis revealed positive associations between study attitudes and academic performance. Conclusions This study shows that attitudes and habits towards studying have a strong impact on academic performance.

Introdução As atitudes e os hábitos em direção ao estudo e à aprendizagem são um fator de suma importância na determinação do desempenho académico. Objetivo Analisar a correlação entre atitude e hábitos de estudo com o desempenho académico em estudantes universitários. Metodologia É uma pesquisa de corte quantitativo, transversal, correlacional e analítico, participaram 286 estudantes de maneira voluntária. Para medir as variáveis utilizaram-se o Inventario de Hábitos de Estudo e o Questionário de Avaliação de Atitudes ante a Aprendizagem em Estudantes Universitários. Os dados analisaram-se mediante o programa estatístico STATA v.11.1, realizaram-se provas de comparação de frequências (chi-quadrado), de correlação (r de Pearson) e análise de regressão logística. Resultados Do total dos participantes (n=286), 75.8% foram do sexo feminino; 43.7% (n=125) tiveram alto rendimento académico, com média geral de 9 ou mais. A respeito dos hábitos de estudo, 66.4% (n=190) obtiveram pontuações na classificação de adequados, 25.2% (n=72) apresentaram atitudes positivas para o estudo; obteve-se uma associação altamente significativa (p=0.001,) entre hábitos e atitudes ante o estudo mediante uma prova de chi-quadrado. A correlação entre hábitos de estudo e atitudes para o estudo foi moderada, mas significativa (r=0.461, p < 0.05); a análise de regressão logística, revelou associações positivas entre atitudes e rendimento académico. Conclusões Este estudo demonstra que as atitudes e os hábitos de estudo, tem um forte impacto no desempenho académico.

Follicular Development and Secretion of Ovarian Hormones during the Juvenile and Adult Reproductive Lives of the Myelin Mutant taiep Rat: An Animal Model of Demyelinating Diseases.

Infertility and reproductive problems have been reported in women with several neurological disorders, for example, demyelination. However, the physiology of such problems has remained unknown so far. The taiep rats are an animal neurological model that initially shows a hypomyelination followed by a progressive demyelination of the central nervous system. This animal has reproductive problems, and the aim of this work is to characterize the follicular development, secretion of ovarian hormones, and presence of noradrenaline in the ovaries of the female taiep rats in the juvenile and adult stages. The taiep rats have low body weight (approximately 19% less than that of SD rats), a delay of 4 days in the age of vaginal opening, and an irregularity in the estrous cycle by the absence or prolongation of some estral cycle stage. In the juvenile stage, we observed a decrease of approximately 44% in the total number of follicles with a 15% increase of atresia and an 80% decrease in the fluorescence intensity of catecholamines in the ovaries, with a 21% increment in plasma concentrations of testosterone. In the adult stage, we observed follicular cysts and a 50% decrease in fluorescence intensity of catecholamines in the ovaries, with changes in the secretion of ovarian hormones, an increase of 20 times in progesterone, and a decrement of a half in estradiol. The demyelination in taiep rats affects follicular development and steroidogenesis in the early stages of the animal's life, and this is maintained until adulthood.

Polyvinyl alcohol/chitosan hydrogels with enhanced antioxidant and antibacterial properties induced by lignin nanoparticles.

Polyvinyl alcohol/chitosan (PVA/Ch) hydrogels containing 1 and 3wt% of lignin nanoparticles (LNPs) were prepared through a freezing-thaw procedure. Results from microstructural, thermal and mechanical characterization of LNPs based PVA/Ch demonstrated that the lowest amount of LNPs (1wt%) was beneficial, whereas the presence of agglomerates at higher LNP content limited the effect. Moreover, a different swelling behaviour was observed for hydrogels containing LNPs with respect of PVA/Ch, due to the formation of a porous honeycomb-like structure. A synergic effect of Ch and LNPs was revealed in terms of antioxidative response by DPPH (1,1-Diphenyl-2-picryl-hydrazyl) activity of migrated substances, whereas results from antimicrobial tests confirmed LNPs as effective against Gram negative bacteria (E. coli) when compared to Gram positive (S.aureus and S. epidermidis) strains. The obtained results suggested the possible use of produced PVA/Ch hydrogels incorporating LNPs in many different sectors, such as drug delivery, food packaging, wound dressing.

Three novel HBB mutations, c.-140C>G (-90 C>G), c.237_256delGGACAACCTCAAGGGCACCT (FS Cd 78/85 -20 bp), and c.315+2T>G (IVS2:2 T>G). Update of the mutational spectrum of ß-Thalassemia in Mexican mestizo patients.

INTRODUCTION: Beta-thalassemia (ß-thal) is frequent in Mexican patients with microcytosis and hypochromia. We report three novel mutations and analyze the actual mutational spectrum in Mexican population. METHODS: One hundred and forty-nine ß-thal Mexican mestizo patients were studied (154 alleles). ARMS-PCR was performed to identify Cd39C>T, IVS1:1G>A, IVS1:110G>A, -28A>C, initiation codonA>G and IVS1:5G>A mutations, and gap-PCR for δß-thal Spanish type. DNA sequencing of HBB gene was carried out in negative samples for the initial screening. RESULTS: Fifteen different HBB gene mutations were observed in 148 alleles; three of them are novel: -90C>G, 20 bp deletion (at codons 78/85), and IVS2:2T>G; the mutation IVS1:6T>C that was observed for first time in our population; and eleven previously described mutations. Six alleles showed normal HBB sequence. To date, a total of 21 different mutations have been observed in Mexican patients; the four most frequent mutations are of Mediterranean origin: Cd39C>T (37.2%), IVS1:1G>A (17.3%), IVS1:110G>A (13.9%), and δß-thal Spanish type (9.0%), which represent 77.4% of the total studied alleles. CONCLUSION: Considering the novel mutations -90C>G, -20 bp Cd78/85, IVS2:2T>G and the first observation of IVS1:6T>C, the molecular spectrum of ß-thal in Mexicans comprises 21 different mutations, confirming the high allelic heterogeneity in Mexicans.