ABSTRACT
AIM: Study adhesive activity of enterobacteria in the model of hemagglutination reaction with animal and avian erythrocytes and clarify structures responsible for adhesion in enterobacteria. MATERIALS AND METHODS: 58 cultures of enterobacteria were used, of which: 21 Escherichia coli strains, 13 Citrobacter spp., 11 Morganella morganii, 9 Proteus spp., 4 Hafnia alvei. Erythrocytes of various animals and birds were used in hemagglutination reaction. Electron-microscopical studies were carried out in JEM-100B (Japan) electron microscope. RESULTS: Use of avian erythrocytes as a target of adhesion determination, compared with animal erythrocytes, has shown that bacteria can cause D-mannose-sensitive hemagglutination reaction, linked with the presence of 110 - 420 nm long and 5.0 - 5.4 nm wide cilia in the microorganisms. CONCLUSION: Adhesion of enterobacteria was shown to be a complex process, depending on the presence of certain fimbrial structures, use of those results in specific interaction of the microbe with certain host cell receptors. Avian erythrocytes are a model target cells.
Subject(s)
Bacterial Adhesion/immunology , Enterobacteriaceae/pathogenicity , Erythrocytes/microbiology , Hemagglutination/immunology , Animals , Birds/microbiology , Enterobacteriaceae/immunology , Erythrocytes/pathology , Erythrocytes/ultrastructure , Fimbriae, Bacterial/immunology , Fimbriae, Bacterial/ultrastructure , Hemagglutination Tests , HumansABSTRACT
This investigation was undertaken to study trends in helminthiasis morbidity in the Republic of Bashkortostan in 2009-2011. A total of 1497 subjects who came to the Laboratory of the Department of Microbiology, Virology, and Immunology, Bashkir State Medical University, in 2009-2011, have been randomly selected for this investigation. IgG antibodies were identified in their blood. Enzyme immunoassay has revealed anti-helminth antibodies in 4.7, 4.9, and 4.6% of the examinees in 2009, 2010, and 2011, respectively. Antibodies against Ascaris, Ecchinococcus, Opisthorchis, and Toxocara were most common in the examinees. According to the official statistics, the Republic of Bashkiria showed a 26.4% decrease in helminthiasis morbidity, alterations in the structure of morbidity, and a reduction in the proportion of helminths habiting the intestine, and an increase in the proportion of tissue helminthiases in the period 2006 to 2011.
Subject(s)
Helminthiasis , Helminths/isolation & purification , Immunoglobulin G/blood , Adolescent , Adult , Animals , Bashkiria/epidemiology , Female , Helminthiasis/blood , Helminthiasis/epidemiology , Helminthiasis/parasitology , Helminths/immunology , Humans , Male , Middle AgedABSTRACT
This study was undertaken to analyze the nucleotide sequences of a marker fragment in the mitochondrial cox1 gene in polymorphic variants of G1 strain from the nucleotide sequence bank "Genbank" and to choose conditions for a polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) method to differentiate the G1 genotype in E.granulosus isolates. The analysis indicated that G1 genotype polymorphism was due to impact nucleotide replacements and to the varying length of the marker fragment of the coxl gene (by the presence of absence of the 5' GTGGCT 3' site with the coordinates 10275-10280). The procedure of PCR-RFLP was modified to identify the G1 variants due to the varying coxl length. New primers annealed to the variable coxl site of the following structure: 5' TGTGTTGATTTT-GCCTGG 3' (direct); 5' GCCACCACAAACCAAGTATC 3' (inverse) were chosen. Then the localizations of restriction sites were determined for the endonucleases R.Fok 1, R.Sfa NI, and R.Mael and the restriction fragment length was calculated for the RFLP analysis.
Subject(s)
Cyclooxygenase 1/genetics , Echinococcus granulosus/genetics , Helminth Proteins/genetics , Mitochondria/genetics , Polymerase Chain Reaction/methods , Polymorphism, Restriction Fragment Length , Animals , Base Sequence , DNA Primers , DNA, Mitochondrial/genetics , Echinococcosis/parasitology , Echinococcus granulosus/classification , Echinococcus granulosus/isolation & purification , Humans , Mitochondria/enzymology , Sequence Analysis, DNAABSTRACT
UNLABELLED: THE AIM of this study was to determine the effects of CYP2C19 polymorphism on H. pylori eradication in pediatric population in the Republic of Bashkortostan. METHODS: Fifty-nine children were entered into the study (age range: 12 to 17; 22 female). All the patients were infected with H. pylori and received the combination of omeprazole (1 mg/kg/day), furazolidone (10 mg/kg/day) and amoxicilline (25 mg/kg/day) or clarithromycin (7.5 mg/kg/day) for 10 days. The participants were classified into 3 groups according to CYP2C19 genotype; rapid metabolizers (RM) (54.2%), intermediate metabolizers (IM) (35.6%) and poor metabolizers (PM) (10.2%). H. pylori infection status was assessed before and after the treatment. RESULTS: The eradication rate was 65.6% for RM, 71.4% for IM, and 83.3% for PM. CONCLUSION: The present study confirmed the low eradication rate for RM and for the IM groups. Alternative regimens expected to be with a higher eradication rate should be recommended (rabeprazole-based treatment).
Subject(s)
Anti-Infective Agents/therapeutic use , Aryl Hydrocarbon Hydroxylases/genetics , Helicobacter Infections/drug therapy , Helicobacter pylori/drug effects , Polymorphism, Genetic , Proton Pump Inhibitors/pharmacokinetics , Adolescent , Anti-Infective Agents/administration & dosage , Anti-Infective Agents/pharmacokinetics , Child , Cytochrome P-450 CYP2C19 , Female , Helicobacter Infections/enzymology , Helicobacter Infections/microbiology , Helicobacter pylori/isolation & purification , Humans , Inactivation, Metabolic , Male , Proton Pump Inhibitors/administration & dosage , Proton Pump Inhibitors/therapeutic use , Treatment OutcomeABSTRACT
The study demonstrated a possibility to detect specific anti-CMV antibody activity in intravenous preparations of immunoglobulins by qualitative immunoenzyme analysis using parallel-line method. Independently of production technology, specificity, and the activity level, the preparations had a dose-response curve that was parallel to that of a standard sample with five-point linearity at double-step dilution. This makes it possible to use the test system DS-ELISA-ANTI-CMV-G to detect anti-CMV antibody activity in ready-for-use preparations.
Subject(s)
Antibodies, Viral/analysis , Cytomegalovirus Infections/drug therapy , Cytomegalovirus/immunology , Immunoglobulins, Intravenous/pharmacology , Immunologic Factors/pharmacology , Cytomegalovirus/drug effects , Cytomegalovirus Infections/virology , Enzyme-Linked Immunosorbent Assay , HumansABSTRACT
Nine larvocysts of Echinococcus granulosus isolated from nine patients and one cyst derived from a naturally infested cattle have been examined. Genomic typing was carried out in order to identify strains of E. granulosus. All DNA samples were shown to have the same genotype, E. granulosus G1.
Subject(s)
DNA, Helminth/genetics , Echinococcosis/genetics , Echinococcus granulosus/genetics , Adolescent , Animals , Cattle , Child , Echinococcosis/epidemiology , Female , Genotype , Humans , Male , RussiaABSTRACT
The comparative study of adhesive, hemolytic, DNA-ase, lecithinase, antilysozymic, anticomplementary activities of mono- and associated cultures of 57 Enterobacter spp., 61 Citrobacter spp. and 55 Serratia spp. strains, isolated from patients with pyoinflammatory, intestinal and urological diseases is carried out. Different variations of cocultivated bacteria including Enterobacter and Citrobacter, Enterobacter and Serratia, Citrobacter and Serratia are used. It was shown, that cocultivated Enterobacter, Citrobacter and Serratia bacteria increased the persistent properties of mixt cultures.
Subject(s)
Citrobacter/physiology , Enterobacter/physiology , Enterobacteriaceae Infections/microbiology , Serratia/physiology , Animals , Bacterial Adhesion/physiology , Citrobacter/pathogenicity , Complement Inactivator Proteins/metabolism , Deoxyribonucleases/metabolism , Enterobacter/pathogenicity , Enterobacteriaceae Infections/complications , Enterobacteriaceae Infections/pathology , Enterocolitis/microbiology , Hemolysin Proteins/metabolism , Humans , Inflammation/pathology , Muramidase/antagonists & inhibitors , Muramidase/metabolism , Phospholipases/metabolism , Serratia/pathogenicity , Symbiosis , Urinary Tract Infections/microbiology , Urinary Tract Infections/pathologyABSTRACT
Modern data on the molecular mechanisms of relationships between the host organism and the pathogenic representatives of the family Enterobacteriaceae in the host-parasite system are presented. The process of cytokine and eicosanoid regulation of the immune process of the host in the norm and pathology states are analyzed. The examples of the mechanisms of immune suppression, false antigenic stimulation and the mimicry of pathogens are given.
Subject(s)
Enterobacteriaceae Infections/microbiology , Enterobacteriaceae/physiology , Animals , Antigens, Bacterial/immunology , Cytokines/immunology , Eicosanoids/immunology , Enterobacteriaceae Infections/immunology , Epithelial Cells/immunology , Host-Parasite Interactions , Humans , Molecular MimicryABSTRACT
The nucleotide sequences connected with the production of thermostable enterotoxins (ST) by the representatives of Enterobacteriaceae were analyzed. The conservative area sized up to 30 pairs of nucleotides at the 3'-end of all ST-genes, present in the bank, and responsible for the enterotoxicity of ST-toxin molecules was detected. On its basis 3 oligonucleotides were synthesized; 2 of them were used as primers in experiments on the amplification of the DNA of enterotoxigenic strains of Citrobacter spp., Escherichia coli and Yersinia spp. and the third one was used as a probe in experiments on dot-blot hybridization with the DNA of the above-mentioned cultures. The universal diagnostic test system making it possible to detect the ST-enterotoxin of opportunistic enterobacteria irrespective of their species was proposed.
Subject(s)
Enterobacteriaceae/genetics , Enterotoxins/genetics , Genes, Bacterial , Temperature , Amino Acid Sequence , Drug Stability , Molecular Sequence Data , Polymerase Chain Reaction , Sequence Homology, Amino AcidABSTRACT
To obtain the profiles of randomly amplified DNA, isolated from bacteria of the genus Citrobacter, the method of polymerase chain reaction was used. Nine oligonucleotides were evaluated for the possibility of their use as primers for the amplification of random polymorphous sequences of DNA; of these, 2 oligonucleotides which generated profiles, sufficiently reproducible and typical for different C. freundii and C. diversus strains, were selected. The possibility of using the above oligonucleotides in pair for amplification of species-specific fragments of polymorphous bacterial DNA for typing was shown.