Genomic Analysis and Development of Infectious Clone of a Novel Carlavirus Infecting Blueberry.

A new blueberry virus was discovered using high-throughput sequencing. Using sequence identity values, phylogenetics, and serological and biological properties, we propose the virus, putatively named blueberry virus S (BluVS), to be a distinct species within the genus Carlavirus (family Betaflexiviridae). The genome was analyzed in depth, and an infectious clone was developed to initiate studies on virus pathogenicity. Agroinfiltration of the binary vector construct produced severe systemic symptoms in Nicotiana occidentalis. Back-inoculation using sap from agroinfiltrated N. occidentalis produced identical symptoms to the recipient plants (N. occidentalis), and virus purification yielded flexuous carlavirus-like particles. However, unlike blueberry scorch virus (BlScV), BluVS caused symptomless infection in Chenopodium quinoa and reacted weakly to BlScV antibodies in an enzyme-linked immunosorbent assay. Collectively, the results provide evidence for the distinct speciation of BluVS. The availability of an infectious clone provides tools for future studies on the biology of the virus.

Comparison of High Throughput Sequencing to Standard Protocols for Virus Detection in Berry Crops.

We completed a comprehensive study comparing virus detection between high throughput sequencing (HTS) and standard protocols in 30 berry selections (12 Fragaria, 10 Vaccinium, and eight Rubus) with known virus profiles. The study examined temporal detection of viruses at four sampling times encompassing two growing seasons. Within the standard protocols, reverse transcription (RT) PCR proved better than biological indexing. Detection of known viruses by HTS and RT-PCR nearly mirrored each other. HTS provided superior detection compared with RT-PCR on a wide spectrum of variants and discovery of novel viruses. More importantly, in most cases in which the two protocols showed parallel virus detection, 11 viruses in 16 selections were not consistently detected by both methods at all sampling points. Based on these data, we propose a testing requirement of four sampling times over two growing seasons for berry and potentially other crops, to ensure that no virus remains undetected independent of titer, distribution, or other virus-virus or virus-host interactions.

Economic Studies Reinforce Efforts to Safeguard Specialty Crops in the United States.

Pathogen-tested foundation plant stocks are the cornerstone of sustainable specialty crop production. They provide the propagative units that are used to produce clean planting materials, which are essential as the first-line management option of diseases caused by graft-transmissible pathogens such as viruses, viroids, bacteria, and phytoplasmas. In the United States, efforts to produce, maintain, and distribute pathogen-tested propagative material of specialty crops are spearheaded by centers of the National Clean Plant Network (NCPN). Agricultural economists collaborated with plant pathologists, extension educators, specialty crop growers, and regulators to investigate the impacts of select diseases caused by graft-transmissible pathogens and to estimate the return on investments in NCPN centers. Economic studies have proven valuable to the NCPN in (i) incentivizing the use of clean planting material derived from pathogen-tested foundation plant stocks; (ii) documenting benefits of clean plant centers, which can outweigh operating costs by 10:1 to 150:1; (iii) aiding the development of disease management solutions that are not only ecologically driven but also profit maximizing; and (iv) disseminating integrated disease management recommendations that resonate with growers. Together, economic studies have reinforced efforts to safeguard specialty crops in the United States through the production and use of clean planting material.

Raspberry leaf blotch emaravirus in Bosnia and Herzegovina: population structure and systemic movement.

Raspberry leaf blotch virus (RLBV) is the putative agent of the homonymous disease and even though Bosnia and Herzegovina is a major producer worldwide there is no report of the virus presence in the country. We studied the virus population structure and assessed its ability to move systemically. RLBV is widespread in production areas and has a homogeneous population structure; leading to the hypothesis that the primary mode of dissemination is propagation material. The ability of the virus to move systemically eliminates propagation of root cuttings as a viable option to obtain RLBV-free plants, leaving RT-PCR screening as the better option to propagate RLBV- free plants in the absence of clean-up facilities or certification programs in the country.

High Throughput Sequencing For Plant Virus Detection and Discovery.

Over the last decade, virologists have discovered an unprecedented number of viruses using high throughput sequencing (HTS), which led to the advancement of our knowledge on the diversity of viruses in nature, particularly unraveling the virome of many agricultural crops. However, these new virus discoveries have often widened the gaps in our understanding of virus biology; the forefront of which is the actual role of a new virus in disease, if any. Yet, when used critically in etiological studies, HTS is a powerful tool to establish disease causality between the virus and its host. Conversely, with globalization, movement of plant material is increasingly more common and often a point of dispute between countries. HTS could potentially resolve these issues given its capacity to detect and discover. Although many pipelines are available for plant virus discovery, all share a common backbone. A description of the process of plant virus detection and discovery from HTS data are presented, providing a summary of the different pipelines available for scientists' utility in their research.

First Report of Olive mild mosaic virus and Sowbane mosaic virus in Spinach in Greece.

Uncommon, viruslike symptoms (yellowing, line patterns, leaf deformation, and necrosis), were observed in spinach fields in the Marathon area, Greece in 2004. Seedlings from the same seed lot, grown in the greenhouse, also developed the same viruslike symptoms, indicating that the causal agent(s) of the disorder is seed-transmissible. Spinach seedlings of the same variety but a different lot and herbaceous indicators (Chenopodium quinoa, C. amaranticolor, Sonchus oleraceus, and Nicotiana benthamiana) were mechanically inoculated with infected material. Spinach developed yellowing or necrotic spots whereas indicators showed variety of symptoms including mosaic, vein banding, and necrotic lesions. Virus purifications, double-stranded RNA extractions, cloning, and sequencing (2,3) followed by a combination of molecular (reverse transcription [RT]-PCR and immunocapture RT-PCR) and serological (ELISA) techniques with antisera provided by Dr. Avgelis were performed as described (4), verifying the presence of two viruses in the diseased seedlings: Sowbane mosaic virus (SoMV), a sobemovirus, was present in spinach and indicators with mottling and leaf deformation, whereas Olive mild mosaic virus (OMMV), a necrovirus, was present in plants with necrotic spots. All RT-PCR products amplified with primers SoMV-F (5'-CAAATGGTCTTGGTCAGCAGTC)/SoMV-R (5'-GCATACGCTCGACGATCTG) and OMMV-F (5'-CAAACCCAGCCTGTGTTCGATG)/OMMV-R (5'-CATCAGTTTGGTAATCCATTGA) were sequenced and found to confirm the other results. The SoMV-spinach isolate polyprotein gene sequence (GenBank Accession No. DQ450973) has 95% sequence identity with the type isolate from C. quinoa (GenBank Accession No. GQ845002), whereas the OMMV-spinach isolate (GenBank Accession No. JQ288895) has 92% sequence identity with the OMMV type isolate from olive (GenBank Accession No. AY616760). SoMV has been found to naturally infect spinach in the Netherlands (1) and, to our knowledge, this is the first report on spinach in Greece. The presence of OMMV in spinach is, to our knowledge, the first report worldwide. Its natural host range is limited to olive, tulip, and now spinach. OMMV might be transmitted by Olpidium spp. and may, according to data of its close relatives, persist in the soil for several decades. Pollen- and seedborne viruses (PSVs) like sobemoviruses and necroviruses are of particular importance for a crop like spinach where crop increase takes place in small, seed production-designated areas. If a PSV spreads in such an area it has the potential to become a major problem for the industry, especially when it remains undetected. Infected seed can be shipped worldwide with PSVs, causing diseases and becoming endemic in areas where they were absent. For this reason and the fact that field losses can exceed 50%, rigorous monitoring for the presence of SoMV and OMMV in seed fields is essential to minimize the possibility of the viruses moving to new areas. References: (1) L. Bos and N. Huijberts. Eur. J. Plant Pathol. 102:707, 1996. (2) S. M. Girgis et al., Eur. J. Plant Pathol. 125:203, 2009, (3) I. E. Tzanetakis et al. J. Virol. Methods 124:73, 2005. (4) I. E. Tzanetakis et al. Virus Res. 121:199, 2006.

Molecular characterization of a new Tospovirus infecting soybean.

A new, widespread disease was recently observed in soybean in the United States. The disease, named Soybean vein necrosis, is manifested by intraveinal chlorosis and necrosis, and has been found in almost all of the 50 fields visited over a period of 3 years in the midwest and midsouth part of the United States. A virus was isolated from symptomatic material, and detection protocols were developed. More than 150 symptomatic specimens collected from seven US States were tested, and all were found positive for the virus unlike 75 asymptomatic samples, revealing the absolute association between virus and disease. Protein pairwise comparisons coupled with phylogenetic analyses indicate that the virus is a new member of the genus Tospovirus.

Genomic sequences of blackberry chlorotic ringspot virus and strawberry necrotic shock virus and the phylogeny of viruses in subgroup 1 of the genus Ilarvirus.

Three members of subgroup 1 of the genus Ilarvirus: blackberry chlorotic ringspot (BCRV), strawberry necrotic shock (SNSV), and tobacco streak viruses (TSV), may infect Rubus and Fragaria species. All cause symptoms similar to those previously attributed to infection by TSV alone. Although similarities exist among the genomic sequences of the three, phylogenetic analysis shows them to be distinct viruses. These viruses and Parietaria mottle virus, the other currently accepted member of subgroup 1, appear to have evolved from a common ancestral virus, share conserved motifs in the products of the genomic RNAs, and constitute a distinct subgroup within the genus.

First Report of Cucumber mosaic virus Infecting Blephilia hirsuta in North America.

Blephilia hirsuta (Pursh) Benth. var. hirsuta, an ornamental plant known as hairy pagoda or hairy wood mint (Lamiaceae), is native to eastern North America and is listed as an endangered species or a species of special concern in several northeastern states ( http://www.ct.gov/dep/cwp/view.asp?a=2702&q=323482&depNav_GID=1628 and http://www.mass.gov/dfwele/dfw/nhesp/species_info/mesa_list/mesa_list.htm ). B. hirsuta, grown as an ornamental on the University of Arkansas campus in Fayetteville, exhibited mottling symptoms indicative of viral infection. Double-stranded RNA extractions (3) yielded four bands of approximately 3.2, 2.9, 2.2, and 0.9 kb, a pattern identical to that of Cucumber mosaic virus (CMV [2]). Nicotiana benthamiana and Chenopodium quinoa seedlings were mechanically inoculated with sap from symptomatic tissue. N. benthamiana inoculated plants were stunted and developed systemic mosaic and C. quinoa inoculated plants developed local lesions, whereas mock inoculated plants remained symptomless. Dot-blot and indirect ELISA using antisera against CMV (developed by H. A Scott) gave strong reactions when testing symptomatic tissue from B. hirusta, N. benthamiana, and C. quinoa compared with no reaction for symptomless plants. Total nucleic acid extractions (4) from symptomatic tissue was subjected to reverse transcription-PCR using Cucumovirus degenerate primers (1). An amplicon of approximately 940 bases was obtained and sequenced. The sequence, deposited in GenBank under Accession No. GU453918, confirmed the results of the immunological assays that B. hirsuta was infected with CMV. The nucleotide identities between the B. hirsuta isolate and those of the Fny CMV group exceeded 98%. To our knowledge, this is the first report of CMV infecting B. hirsuta, not only in North America, but globally. This finding has major implications for the ornamental industry and the viability of the endangered species. Given the wide range of CMV, B. hirsuta may act as a reservoir for the virus and facilitate transmission to ornamentals and other plants. In addition, the virus may reduce host fitness and undermine the efforts to preserve the species in areas that is threatened. References: (1) S. K. Choi et al. J. Virol. Methods 83:67, 1999. (2) I. E. Tzanetakis. Plant Dis. 93:431, 2009. (3) I. E. Tzanetakis and R. R. Martin. J. Virol. Methods 149:167, 2008. (4) I. E. Tzanetakis et al. Virus Res. 127:26, 2007.

First Report of Impatiens necrotic spot virus in Blackberry in the Southeastern United States.

Blackberry yellow vein disease (BYVD) has emerged as an important disease of blackberry (Rubus spp.) in the south and southeastern United States (2,3). In an effort to characterize viruses that may be involved in the disease, double-stranded RNA extracted from a symptomatic 'Apache' blackberry from South Carolina was used for shotgun cDNA cloning (4). Sequence analysis showed that in addition to Blackberry yellow vein associated virus (BYVaV) (2), a constant component of BYVD, sequences of Impatiens necrotic spot virus (INSV) also were obtained. The 623-nt fragment of INSV (Genbank Accession No. EU287930) shared 98% nucleotide and amino acid sequence identity with GenBank Accession No. NC003616. Confirmation of the results of the initial shotgun cloning was done by reverse transcription-PCR with primers INSVF (5' GATCTGTCCTGGGATTGTTC 3') and INSVR (5' GTCTCCTTCTGGTTCTATAATCAT 3') that amplify a 460 base fragment of the M RNA of INSV. Amplicons obtained from single-stranded and dsRNA templates were sequenced and found to be identical with EU287930. The identity of INSV by PCR was also supported by positive results with a commercially available INSV-ELISA kit (AC Diagnostics, Fayetteville, AR). Earlier, more than 400 plants from North Carolina, South Carolina, and Virginia with BYVD and other virus-like symptoms were tested for INSV by ELISA and approximately 33% were found to be infected with the virus (1). Thus, INSV appears to be one of the major viruses infecting blackberry in the southeastern United States, and it remains to be seen if INSV acts synergistically with BYVaV and other viruses to contribute to the severity of BYDV. To our knowledge, this is the first report of INSV infecting Rubus spp. References: (1) T. L. Guzmán-Baeny. M.S. thesis. North Carolina State University, Raleigh, 2003. (2) J. Susaimuthu et al. Plant Pathol. 55:607, 2006. (3) J. Susaimuthu et al. Virus Res. 131:145, 2008. (4) I. E. Tzanetakis et al. J. Virol. Methods 124:73, 2005.

First Report of Cucumber mosaic virus in Anemone sp. in the United States.

In the spring of 2008, more than a dozen, aphid-infested, anemone plants (Anemone sp.) grown at the campus of the University of Arkansas in Fayetteville showed stunting and mosaic, whereas only two were asymptomatic. Leaf homogenates from four symptomatic plants were inoculated onto Nicotiana benthamiana that became stunted and developed severe mosaic approximately 7 days postinoculation, whereas buffer-inoculated plants remained asymptomatic. Double-stranded RNA (dsRNA) extraction (4) from symptomatic anemone revealed the presence of four predominant bands of approximately 3.2, 2.9, 2.2, and 0.9 kbp, a pattern indicative of cucumovirus infection. Cucumber mosaic virus (CMV) is the only cucumovirus reported in anemone in Europe (2) and Israel (3), and for this reason, anemone and N. benthamiana plants were tested by Protein A ELISA with antisera against CMV developed by H. A. Scott. ELISA verified the presence of CMV in symptomatic anemone and inoculated N. benthamiana, while asymptomatic plants were free of the virus. Using cucumovirus degenerate primers, essentially as described by Choi et al. (1), a region of approximately 940 bases that includes the complete coat protein gene of the virus was amplified from symptomatic anemone and N. benthamiana but not asymptomatic plants of either species. This anemone isolate (GenBank Accession No. FJ375723) belongs to the IA subgroup of CMV because it shares 99% nucleotide and 100% amino acid sequence identities with the Fny isolates of the virus. To my knowledge, this is the first report of CMV infecting anemone in the United States and an important discovery for the ornamental industry since anemone is commonly grown together with several ornamental hosts of CMV in nursery and garden settings. References: (1) S. K. Choi et al. J. Virol. Methods 83:67, 1999. (2) M. Hollings. Ann. Appl. Biol. 45:44, 1957 (3) G. Loebenstein. Acta Hortic. 722:31, 2006 (4) I. E. Tzanetakis and R. R. Martin, J. Virol. Methods 149:167, 2008.

First Report of Rosa multiflora cryptic virus in Rosa multiflora in the Eastern United States.

In the process of attempting to identify the rose rosette agent, double-stranded RNA was isolated from several symptomatic Rosa multiflora plants from northwestern Arkansas. The pattern of the dsRNA bands differed among the five samples used in this study, suggesting the presence of several viruses. Four of the five plants tested had two predominant bands of approximately 1.8 and 1.5 kbp, a pattern similar to that observed in plants infected with Fragaria chiloensis cryptic virus (FCCV; 3), and further steps were taken for the identification of the putative virus. One plant that only had the two predominant bands was chosen for further characterization using degenerate oligonucleotide primed (DOP)-PCR (4). Twenty clones were sequenced and all were found to be part of two contigs of 937 and 1,087 nucleotides that have been deposited in GenBank (Accession nos. EU350962 and EU350963). The two contigs had 82 and 72% nucleotide and 85 and 69% amino acid sequence identities with RNA 1 and 2 of FCCV, respectively; 98 and 99% amino acid sequence identities with Rose multiflora cryptic virus (RMCV; 2) RNA 1 and 3, respectively. Oligonucleotide primers F (5' gaatgggaactacgctttgc 3') and R (5' cgatgcttccaatgatgttg 3') designed to amplify a 196-bp region of RNA 1 of the virus were tested using ss and dsRNA templates and were shown to be virus specific after sequencing of multiple PCR amplicons. Just before submission of this manuscript, the complete sequence of RMCV, a virus isolated from R. multiflora showing rose spring dwarf symptoms was published (2). RMCV and the dsRNAs isolated from R. multiflora in Arkansas are the same species because they share 99% nucleotide sequence identity. Cryptic viruses are expected to be symptomless though mild symptoms have been associated with several cryptic viruses (1). The presence of RMCV has been verified in both symptomless and plants infected with two severe diseases of rose, thus, the virus could play a role in the phenotype of these diseases as part of a virus complex. To our knowledge, this is the first report of RMCV in the eastern United States, which is closley related to RMCV from California (2). In the review process of this note, it was brought to our attention that a similar virus named Rose cryptic virus 1 was being investigated in Mississippi (Genbank Accession Nos. EU413666-68), supporting the statement that this virus is probably widespread in Rosa germplasm. References: (1) L. Chen et al. Arch. Virol. 151:849, 2006. (2) N. M. Salem et al. Arch. Virol. 153:455, 2008. (3) I. E. Tzanetakis et al. Virus Genes 36:267, 2008. (4) I. E. Tzanetakis and R. R. Martin. J. Virol. Methods 149:167, 2008.

Identification, detection and transmission of a new vitivirus from Mentha.

Mentha x gracilis 'Variegata' is an ornamental clone with a phenotype caused by virus infection. Several clones were ordered from mail-order nurseries in an attempt to identify a virus consistently associated with symptoms. One of these clones did not exhibit typical 'Variegata' symptoms, and steps were taken to identify any agents causing the 'off-type' symptoms. One of the viruses identified in the atypical 'Variegata' clone is a previously unknown virus, a member of the family Flexiviridae. Sequence and phylogenetic analysis indicate that the virus, designated as mint virus-2, is related to members of the species Grapevine virus A, Grapevine virus B and Heracleum latent virus, placing it in the genus Vitivirus. A detection protocol for the virus has been developed, and the mint aphid (Ovatus crataegarius) was able to transmit the virus in the presence of a helper virus but not from single infected plants.

First Report of Blackberry chlorotic ringspot virus in Rubus sp. in the United States.

Blackberry chlorotic ringspot virus (BCRV), genus Ilarvirus, has been found in Rubus sp. in Scotland (2) and rose in the United States (4). The possibility that BCRV infects other hosts in the United States was explored. We tested 18 accessions of Fragaria sp. and 30 of Rubus sp. maintained at the National Clonal Germplasm Repository in Corvallis, OR. Ilarviruses had been detected in these plants by reverse transcription (RT)-PCR, ELISA, or had caused symptoms typical of ilarviruses on indicator plants. The accessions were tested by RT-PCR with primers F (5'-GTTTCCTGTGCTCCTCA-3') and R (5'-GTCACACCGAGGTACT-3') (4) that amplify a 519 to 522 nt (depending on the isolate) region of the RNA 3 of BCRV. The virus was detected in two accessions of black raspberry (Rubus occidentalis L.): RUB433, cv. Lowden and RUB 9012, cv. New Logan. The sequences of the fragments amplified from these accessions (GenBank Accession Nos. EF041817 and EF041818, respectively) had 97% nt sequence identity to each other and 95 and 88% nt identity to the rose and Scottish isolates (GenBank Accession Nos. DQ329378 and DQ091195, respectively). Chenopodium quinoa indicator plants inoculated with isolate RUB 433 developed mild chlorotic spots on the inoculated leaves 4 days after inoculation. RT-PCR and sequencing of the amplicons verified BCRV infection of C. quinoa. RUB 9012 was used for the characterization of Black raspberry latent virus (BRLV), later thought to be an isolate of Tobacco streak virus (TSV). This accession was recently found to be infected with Strawberry necrotic shock virus (SNSV) but not TSV (3). It is possible that BRLV may be a mixture of SNSV and BCRV. SNSV is one of the most abundant viruses of Rubus sp. in the Pacific Northwest (1), and the finding of another ilarvirus, BCRV, may account in part for the rapid decline of Rubus sp. observed in several fields in Oregon and Washington. To our knowledge, this is the first report of BCRV infecting Rubus sp. outside the United Kingdom. References: (1) A. B. Halgren. Ph.D. Diss. Oregon State University, Corvallis, OR, 2006. (2) A. T. Jones et al. Ann. Appl. Biol. 149:125, 2006. (3) I. E. Tzanetakis et al. Arch. Virol. 149:2001, 2004. (4) I. E. Tzanetakis et al. Plant Pathol. 55:568, 2006.

Mint virus X: a novel potexvirus associated with symptoms in 'Variegata' mint.

Mentha x gracilis 'Variegata', an ornamental mint clone first described about 200 years ago, exhibits virus-like vein banding symptoms. Double-stranded RNA and virion isolations revealed the presence of three viruses in a 'Variegata' plant. Cloning and sequencing disclosed that one of the viruses was a previously unidentified species with similarities to members of the Flexiviridae family, designated as Mint virus X (MVX). The complete nucleotide sequence of the virus was determined. Phylogenetic analysis divulged the close relationship of the virus with lily virus X and strawberry mild yellow edge virus, members of the Potexvirus genus. A reverse transcription-polymerase chain reaction protocol was developed and used for detection of MVX in other 'Variegata' plants. All clones tested, obtained from nurseries around the United States were infected with MVX, making the virus a possible causal agent of the variegated symptoms.

The complete nucleotide sequence and genome organization of tomato chlorosis virus.

The crinivirus tomato chlorosis virus (ToCV) was discovered initially in diseased tomato and has since been identified as a serious problem for tomato production in many parts of the world, particularly in the United States, Europe and Southeast Asia. The complete nucleotide sequence of ToCV was determined and compared with related crinivirus species. RNA 1 is organized into four open reading frames (ORFs), and encodes proteins involved in replication, based on homology to other viral replication factors. RNA 2 is composed of nine ORFs including genes that encode a HSP70 homolog and two proteins involved in encapsidation of viral RNA, referred to as the coat protein and minor coat protein. Sequence homology between ToCV and other criniviruses varies throughout the viral genome. The minor coat protein (CPm) of ToCV, which forms part of the "rattlesnake tail" of virions and may be involved in determining the unique, broad vector transmissibility of ToCV, is larger than the CPm of lettuce infectious yellows virus (LIYV) by 217 amino acids. Among sequenced criniviruses, considerable variability exists in the size of some viral proteins. Analysis of these differences with respect to biological function may provide insight into the role crinivirus proteins play in virus infection and transmission.

The use of reverse transcriptase for efficient first- and second-strand cDNA synthesis from single- and double-stranded RNA templates.

Molecular characterization of eight distinct, difficult-to-clone RNA plant viruses was accomplished after the development of a reverse transcriptase-based first- and second-strand cDNA synthesis method. Double-stranded (ds) RNA templates isolated from strawberry and blackberry and several herbaceous hosts (mint, pea and tobacco) were cloned using this method. Templates, combined with random primers, were denatured with methyl mercuric hydroxide. Reverse transcriptase was added followed by the addition of RNase H. The resulting dsDNA was then digested with restriction endonucleases to produce shorter fragments that could be cloned efficiently into a T-tailed vector after adding an A-overhang using Taq polymerase. This procedure resulted in a high number of cloned fragments and allowed insert sizes up to three kilobase-pairs. Unlike traditional cDNA construction methods, there is no need for additional enzymes/steps for second-strand synthesis, PCR amplification or prior sequence information. Synthesis and cloning of cDNA derived from dsRNA templates is much more efficient than with previously described methods. This procedure also worked well for cloning gel-purified dsRNA and with single-stranded RNA templates.

Fragaria chiloensis cryptic virus: A New Strawberry Virus Found in Fragaria chiloensis Plants from Chile.

Molecular characterization of Fragaria chiloensis latent virus (FClLV) (3) was based on shotgun cloning of double-stranded RNA (dsRNA) obtained from a Chilean Fragaria chiloensis plant. While the majority of the clones acquired belonged to FClLV, several had similarities with the RNA polymerases of viruses of the family Partitiviridae. A region of more than 1 kb of the putative virus (GenBank Accession No. DQ093961) was acquired by a combination of shotgun cloning and reverse transcription-polymerase chain reaction (RT-PCR) (3) and was compared against sequences found in GenBank. The Alphacryptovirus Beet cryptic virus 3 (Genbank Accession No. S63913) and the RNA-dependent RNA polymerase encoded using dsRNA isolated from Pyrus pyrifolia (Genbank Accession No. BAA34783) produced the most significant alignments with approximately 40% amino acid sequence identity and 60% amino acid similarity with the coding region of the sequenced portion of the virus. Detection primers F (5'AAGTCCGTGAGCACTGCCAT3') and R (5'TGAATACAAGTAACGGGAATTGA3') that amplify a 152-bp fragment of the putative virus were developed and used for RT-PCR detection of the virus as described (4) in 20 F. chiloensis plants obtained from the National Clonal Germplasm Repository (NCGR) in Corvallis, OR. These 20 plants as well as the plant used for the dsRNA isolation were a subset of F. chiloensis clones collected from Chile in 1990 and 1992 as germplasm for the Fragaria collection in the NCGR system (2). Seven of the plants were found to be infected with the virus as determined using RT-PCR and sequencing of the amplicons. There was no correlation between the presence of FClLV and the novel virus. To eliminate the possibility that the sequenced region was encoded by F. chiloensis genome, DNA was isolated (DNeasy; QIAGEN Inc., Valencia, CA) and used as a template in PCR, and no amplicons were obtained in these tests. The possibility that the putative virus belonged to the Endornavirus genus was also examined. DsRNA was extracted, and individual bands were gel purified and subjected to cloning as described (4) and RT-PCR amplification. Both methods indicated that the polymerase region was encoded by a dsRNA species of approximately 1.8 kb, which is similar in size to the genomic molecules of other cryptic viruses that encode the virus polymerase (1). This information indicated that the virus is a novel cryptic virus and the name Fragaria chiloensis cryptic virus is proposed. References: (1) G. Boccardo and T. Candresse. Arch. Virol. 150:399, 2005. (2) J. S. Cameron et al. Acta Hortic. 348:65, 1993. (3) I. E. Tzanetakis and R. R. Martin. Virus Res. 112:32, 2005. (4) I. E. Tzanetakis et al. Plant Dis. 88:383, 2004.