Prime-boost vaccination with recombinant mumps virus and recombinant vesicular stomatitis virus vectors elicits an enhanced human immunodeficiency virus type 1 Gag-specific cellular immune response in rhesus macaques.

Intramuscular inoculation of rhesus macaques with one or more doses of recombinant vesicular stomatitis virus (rVSV) expressing human immunodeficiency virus type 1 (HIV-1) Gag (rVSVgag) typically elicits peak cellular immune responses of 500 to 1,000 gamma interferon (IFN-gamma) enzyme-linked immunospots (ELISPOTS)/10(6) peripheral blood lymphocytes (PBL). Here, we describe the generation of a novel recombinant mumps virus (rMuV) expressing HIV-1 Gag (rMuVgag) and measure the Gag-specific cellular immune responses detected in rhesus macaques following vaccination with a highly attenuated form of rVSV expressing HIV-1 Gag (rVSVN4CT1gag1) and rMuVgag in various prime-boost combinations. Notably, peak Gag-specific cellular immune responses of 3,000 to 3,500 ELISPOTS/10(6) PBL were detected in macaques that were primed with rMuVgag and boosted with rVSVN4CT1gag1. Lower peak cellular immune responses were detected in macaques that were primed with rVSVN4CT1gag1 and boosted with rMuVgag, although longer-term gag-specific responses appeared to remain higher in this group of macaques. These findings indicate that rMuVgag may significantly enhance Gag-specific cellular immune responses when administered with rVSVN4CT1gag1 in heterologous prime-boost regimens.

Reverse genetics of measles virus and resulting multivalent recombinant vaccines: applications of recombinant measles viruses.

An overview is given on the development of technologies to allow reverse genetics of RNA viruses, i.e., the rescue of viruses from cDNA, with emphasis on nonsegmented negative-strand RNA viruses (Mononegavirales), as exemplified for measles virus (MV). Primarily, these technologies allowed site-directed mutagenesis, enabling important insights into a variety of aspects of the biology of these viruses. Concomitantly, foreign coding sequences were inserted to (a) allow localization of virus replication in vivo through marker gene expression, (b) develop candidate multivalent vaccines against measles and other pathogens, and (c) create candidate oncolytic viruses. The vector use of these viruses was experimentally encouraged by the pronounced genetic stability of the recombinants unexpected for RNA viruses, and by the high load of insertable genetic material, in excess of 6 kb. The known assets, such as the small genome size of the vector in comparison to DNA viruses proposed as vectors, the extensive clinical experience of attenuated MV as vaccine with a proven record of high safety and efficacy, and the low production cost per vaccination dose are thus favorably complemented.

Comparison of predicted amino acid sequences of measles virus strains in the Edmonston vaccine lineage.

Protein-encoding nucleotide sequences of the N, P, M, F, H, and L genes were determined for a low-passage isolate of the Edmonston wild-type (wt) measles virus and five Edmonston-derived vaccine virus strains, including AIK-C, Moraten, Schwarz, Rubeovax, and Zagreb. Comparative analysis demonstrated a high degree of nucleotide sequence homology; vaccine viruses differed at most by 0. 3% from the Edmonston wt strain. Deduced amino acid sequences predicted substitutions in all viral polypetides. Eight amino acid coding changes were common to all vaccine viruses; an additional two were conserved in all vaccine strains except Zagreb. Comparisons made between vaccine strains indicated that commercial vaccine lots of Moraten and Schwarz had identical coding regions and were closely related to Rubeovax, while AIK-C and Zagreb diverged from the Edmonston wt along slightly different paths. These comparisons also revealed amino acid coding substitutions in Moraten and Schwarz that were absent from the closely related reactogenic Rubeovax strain. All of the vaccine viruses contained amino acid coding changes in the core components of the virus-encoded transcription and replication apparatus. This observation, combined with identification of noncoding region nucleotide changes in potential cis-acting sequences of the vaccine strains (C. L. Parks, R. A. Lerch, P. Walpita, H.-P. Wang, M. S. Sidhu, and S. A. Udem, J. Virol. 75:921-933, 2001), suggest that modulation of transcription and replication plays an important role in attenuation.

Analysis of the noncoding regions of measles virus strains in the Edmonston vaccine lineage.

The noncoding sequence of five Edmonston vaccine viruses (AIK-C, Moraten, Rubeovax, Schwarz, and Zagreb) and those of a low-passage Edmonston wild-type (wt) measles virus have been determined and compared. Twenty-one nucleotide positions were identified at which Edmonston wt and one or more vaccine strains differed. The location of some of these nucleotide substitutions suggests that they may influence the efficiency of mRNA synthesis, processing, and translation, as well as genome replication and encapsidation. Five nucleotide substitutions were conserved in all of the vaccine strains. Two of these were in the genomic 3'-terminal transcriptional control region and could affect RNA synthesis or encapsidation. Three were found within the 5'-untranslated region of the F mRNA, potentially altering translation control sequences. The remaining vaccine virus base changes were found in one to four vaccine strains. Their genomic localization suggests that some may modify cis-acting regulatory domains, including the Kozak consensus element of the P and M genes, the F gene-end signal, and the F mRNA 5'-untranslated sequence.

Crystal structure of the oligomerization domain of NSP4 from rotavirus reveals a core metal-binding site.

During the maturation of rotaviral particles, non-structural protein 4 (NSP4) plays a critical role in the translocation of the immature capsid into the lumen of the endoplasmic reticulum. Full-length NSP4 and a 22 amino acid peptide (NSP4(114-135)) derived from this protein have been shown to induce diarrhea in young mice in an age-dependent manner, and may therefore be the agent responsible for rotavirally-induced symptoms. We have determined the crystal structure of the oligomerization domain of NSP4 which spans residues 95 to 137 (NSP4(95-137)). NSP4(95-137) self-associates into a parallel, tetrameric coiled-coil, with the hydrophobic core interrupted by three polar layers occupying a and d-heptad positions. Side-chains from two consecutive polar layers, consisting of four Gln123 and two of the four Glu120 residues, coordinate a divalent cation. Two independent structures built from MAD-phased data indicated the presence of a strontium and calcium ion bound at this site, respectively. This metal-binding site appears to play an important role in stabilizing the homo-tetramer, which has implications for the engagement of NSP4 as an enterotoxin.

Evaluation of a live, cold-passaged, temperature-sensitive, respiratory syncytial virus vaccine candidate in infancy.

A live-attenuated, intranasal respiratory syncytial virus (RSV) candidate vaccine, cpts-248/404, was tested in phase 1 trials in 114 children, including 37 1-2-month-old infants-a target age for RSV vaccines. The cpts-248/404 vaccine was infectious at 104 and 105 plaque-forming units in RSV-naive children and was broadly immunogenic in children >6 months old. Serum and nasal antibody responses in 1-2 month olds were restricted to IgA, had a dominant response to RSV G protein, and had no increase in neutralizing activity. Nevertheless, there was restricted virus shedding on challenge with a second vaccine dose and preliminary evidence for protection from symptomatic disease on natural reexposure. The cpts-248/404 vaccine candidate did not cause fever or lower respiratory tract illness. In the youngest infants, however, cpts-248/404 was unacceptable because of upper respiratory tract congestion associated with peak virus recovery. A live attenuated RSV vaccine for the youngest infant will use cpts-248/404 modified by additional attenuating mutations.

Rescue of mumps virus from cDNA.

A complete DNA copy of the genome of a Jeryl Lynn strain of mumps virus (15,384 nucleotides) was assembled from cDNA fragments such that an exact antigenome RNA could be generated following transcription by T7 RNA polymerase and cleavage by hepatitis delta virus ribozyme. The plasmid containing the genome sequence, together with support plasmids which express mumps virus NP, P, and L proteins under control of the T7 RNA polymerase promoter, were transfected into A549 cells previously infected with recombinant vaccinia virus (MVA-T7) that expressed T7 RNA polymerase. Rescue of infectious virus from the genome cDNA was demonstrated by amplification of mumps virus from transfected-cell cultures and by subsequent consensus sequencing of reverse transcription-PCR products generated from infected-cell RNA to verify the presence of specific nucleotide tags introduced into the genome cDNA clone. The only coding change (position 8502, A to G) in the cDNA clone relative to the consensus sequence of the Jeryl Lynn plaque isolate from which it was derived, resulting in a lysine-to-arginine substitution at amino acid 22 of the L protein, did not prevent rescue of mumps virus, even though an amino acid alignment for the L proteins of paramyxoviruses indicates that lysine is highly conserved at that position. This system may provide the basis of a safe and effective virus vector for the in vivo expression of immunologically and biologically active proteins, peptides, and RNAs.

Enhanced measles virus cDNA rescue and gene expression after heat shock.

Rescue of negative-stranded RNA viruses from full-length genomic cDNA clones is an essential technology for genetic analysis of this class of viruses. Using this technology in our studies of measles virus (MV), we found that the efficiency of the measles virus rescue procedure (F. Radecke et al., EMBO J. 14:5773-5784, 1995) could be improved by modifying the procedure in two ways. First, we found that coculture of transfected 293-3-46 cells with a monolayer of Vero cells increased the number of virus-producing cultures about 20-fold. Second, we determined that heat shock treatment increased the average number of transfected cultures that produced virus another two- to threefold. In addition, heat shock increased the number of plaques produced by positive cultures. The effect of heat shock on rescue led us to test the effect on transient expression from an MV minireplicon. Heat shock increased the level of reporter gene expression when either minireplicon DNA or RNA was used regardless of whether complementation was provided by cotransfection with expression plasmids or infection with MV helper virus. In addition, we found that MV minireplicon gene expression could be stimulated by cotransfection with an Hsp72 expression plasmid, indicating that hsp72 likely plays a role in the effect of heat shock.

Identification of mutations contributing to the temperature-sensitive, cold-adapted, and attenuation phenotypes of the live-attenuated cold-passage 45 (cp45) human parainfluenza virus 3 candidate vaccine.

The live-attenuated human parainfluenza virus 3 (PIV3) cold-passage 45 (cp45) candidate vaccine was shown previously to be safe, immunogenic, and phenotypically stable in seronegative human infants. Previous findings indicated that each of the three amino acid substitutions in the L polymerase protein of cp45 independently confers the temperature-sensitive (ts) and attenuation (att) phenotypes but not the cold-adaptation (ca) phenotype (29). cp45 contains 12 additional potentially important point mutations in other proteins (N, C, M, F, and hemagglutinin-neuraminidase [HN]) or in cis-acting sequences (the leader region and the transcription gene start [GS] signal of the N gene), and their contribution to these phenotypes was undefined. To further characterize the genetic basis for the ts, ca, and att phenotypes of this promising vaccine candidate, we constructed, using a reverse genetics system, a recombinant cp45 virus that contained all 15 cp45-specific mutations mentioned above, and found that it was essentially indistinguishable from the biologically derived cp45 on the basis of plaque size, level of temperature sensitivity, cold adaptation, level of replication in the upper and lower respiratory tract of hamsters, and ability to protect hamsters from subsequent wild-type PIV3 challenge. We then constructed recombinant viruses containing the cp45 mutations in individual proteins as well as several combinations of mutations. Analysis of these recombinant viruses revealed that multiple cp45 mutations distributed throughout the genome contribute to the ts, ca, and att phenotypes. In addition to the mutations in the L gene, at least one other mutation in the 3' N region (i.e., including the leader, N GS, and N coding changes) contributes to the ts phenotype. A recombinant virus containing all the cp45 mutations except those in L was more ts than cp45, illustrating the complex nature of this phenotype. The ca phenotype of cp45 also is a complex composite phenotype, reflecting contributions of at least three separate genetic elements, namely, mutations within the 3' N region, the L protein, and the C-M-F-HN region. The att phenotype is a composite of both ts and non-ts mutations. Attenuating ts mutations are located in the L protein, and non-ts attenuating mutations are located in the C and F proteins. The presence of multiple ts and non-ts attenuating mutations in cp45 likely contributes to the high level of attenuation and phenotypic stability of this promising vaccine candidate.

A single amino acid change in the hemagglutinin protein of measles virus determines its ability to bind CD46 and reveals another receptor on marmoset B cells.

This paper provides evidence for a measles virus receptor other than CD46 on transformed marmoset and human B cells. We first showed that most tissues of marmosets are missing the SCR1 domain of CD46, which is essential for the binding of Edmonston measles virus, a laboratory strain that has been propagated in Vero monkey kidney cells. In spite of this deletion, the common marmoset was shown to be susceptible to infections by wild-type isolates of measles virus, although they did not support Edmonston measles virus production. As one would expect from these results, measles virus could not be propagated in owl monkey or marmoset kidney cell lines, but surprisingly, both a wild-type isolate (Montefiore 89) and the Edmonston laboratory strain of measles virus grew efficiently in B95-8 marmoset B cells. In addition, antibodies directed against CD46 had no effect on wild-type infections of marmoset B cells and only partially inhibited the replication of the Edmonston laboratory strain in the same cells. A direct binding assay with insect cells expressing the hemagglutinin (H) proteins of either the Edmonston or Montefiore 89 measles virus strains was used to probe the receptors on these B cells. Insect cells expressing Edmonston H but not the wild-type H bound to rodent cells with CD46 on their surface. On the other hand, both the Montefiore 89 H and Edmonston H proteins adhered to marmoset and human B cells. Most wild-type H proteins have asparagine residues at position 481 and can be converted to a CD46-binding phenotype by replacement of the residue with tyrosine. Similarly, the Edmonston H protein did not bind CD46 when its Tyr481 was converted to asparagine. However, this mutation did not affect the ability of Edmonston H to bind marmoset and human B cells. The preceding results provide evidence, through the use of a direct binding assay, that a second receptor for measles virus is present on primate B cells.

Respiratory syncytial virus (RSV) SH and G proteins are not essential for viral replication in vitro: clinical evaluation and molecular characterization of a cold-passaged, attenuated RSV subgroup B mutant.

A live, cold-passaged (cp) candidate vaccine virus, designated respiratory syncytial virus (RSV) B1 cp-52/2B5 (cp-52), replicated efficiently in Vero cells, but was found to be overattenuated for RSV-seronegative infants and children. Sequence analysis of reverse-transcription-PCR-amplified fragments of this mutant revealed a large deletion spanning most of the coding sequences for the small hydrophobic (SH) and attachment (G) proteins. Northern blot analysis of cp-52 detected multiple unique read-through mRNAs containing SH and G sequences, consistent with a deletion mutation spanning the SH:G gene junction. Immunological studies confirmed that an intact G glycoprotein was not produced by the cp-52 virus. Nonetheless, cp-52 was infectious and replicated to high titer in tissue culture despite the absence of the viral surface SH and G glycoproteins. Thus, our characterization of this negative-strand RNA virus identified a novel replication-competent deletion mutant lacking two of its three surface glycoproteins. The requirement of SH and G for efficient replication in vivo suggests that selective deletion of one or both of these RSV genes may provide an alternative or additive strategy for developing an optimally attenuated vaccine candidate.

Rescue of synthetic measles virus minireplicons: measles genomic termini direct efficient expression and propagation of a reporter gene.

Measles virus (MV) mRNA transcription and replication are thought to be controlled by cis-acting sequence elements contained within the terminal MV genomic noncoding nucleotides. To validate these promoter and regulatory signal assignments, cDNAs were constructed allowing synthesis of RNAs corresponding to a MV genome in which all coding and intercistronic regions were replaced by the chloramphenicol acetyl transferase (CAT) coding sequence. Transcript production by T7 polymerase starting and ending precisely with the MV genome terminal residues was achieved by fusing the T7 polymerase promoter and the hepatitis delta virus genome ribozyme followed by tandem T7 polymerase termination sequences to the MV genomic 5' and 3' ends, respectively. Transfection of these negative polarity transcripts, mimicking natural defective interfering RNAs of the internal deletion type, into MV-infected 293 cells gave rise to CAT activity which could be serially transferred and massively amplified together with progeny helper virus in fresh cells. Transfer was blocked only by antibodies able to neutralize MV infectivity, indicating that the chimeric RNA not only was encapsidated, transcribed, and replicated, but also packaged into virions. Sequence analyses confirmed that both the expected chimeric antigenome and mRNA products were transcribed and replicated with fidelity during serial passage. Minor changes introduced in the transcription promoter markedly compromised function. This system now can be exploited to examine MV genomic cis-acting regulatory elements and extended to the development of full-length MV cDNAs.

Canine distemper virus L gene: sequence and comparison with related viruses.

We cloned the genomic RNA of canine distemper virus (CDV) and determined the nucleotide sequence of the large (L) protein-coding gene. The L gene is 6573 nucleotides long and contains a single open reading frame coding for a polypeptide of 2161 amino acids (MW 246,354). The precise 5' end of the viral genome consists of a 38-nucleotide leader region. The CDV L protein shows over 77% amino acid similarity with its morbilliform relative measles virus (MV) with nearly 67% of their amino acids conserved. The sequence homology of 11 negative strand viruses L proteins is compared and relatedness was found in the following decreasing order: CDV, MV, Sendai virus, parainfluenza virus type 3, simian virus 5, parainfluenza virus type 2, mumps virus, Newcastle disease virus, respiratory syncytial virus, vesicular stomatitis virus, rabies virus. The consensus sequence of proposed functional domains involved in L gene catalytic activities was well conserved in the CDV L protein.

Canine distemper terminal and intergenic non-protein coding nucleotide sequences: completion of the entire CDV genome sequence.

Sequences critical for the transcription and replication functions of canine distemper virus (CDV) RNA polymerase were analyzed. The sequence was obtained from polymerase chain reaction (PCR) products using either c-DNA clones from a genomic library as template or in most instances genomic CDV RNA. Clones coding for the precise 3'- and 5'-ends of the CDV genome were sequenced and the results confirmed by additional PCR experiments. The virtual identity of terminal sequences and spacing at the two noncoding ends speak to the importance of these areas in replication and transcription. The sequence for each of the CDV gene boundaries was defined and all were compared to related viruses. This report completes the sequence determination of the CDV genome.

Sensitive and specific detection of toxoplasma DNA in an experimental murine model: use of Toxoplasma gondii-specific cDNA and the polymerase chain reaction.

Toxoplasma gondii, an apicomplexan parasite of mammals and birds, is well recognized as a cause of encephalitis in AIDS patients and as a cause of congenital infections. The polymerase chain reaction (PCR) and toxoplasma cDNA clones were used to diagnose T. gondii infection in an acute murine model of toxoplasmosis. Diagnosis of tissue infection by Southern blot hybridization with cDNA clones of T. gondii was possible within 5 days of infection. This technique could detect as few as 10,000 organisms. Specific T. gondii gene amplification by PCR using the primers 5'CACACGGTTGTATGTCGGTTTCGCT3' and 5'TCAAGGAGCTCAATGTTACAGCCT3' followed by oligonucleotide hybridization using 5'GCGGTCATTCTCACACCGACGGAGAACCACTTCACTCTCA3' allowed detection of T. gondii in the tissue of mice by day 2 after infection and in the blood of mice by day 5 after infection with RH strain T. gondii. This technique could detect as few as 10 organisms. Thus, these techniques may be useful in the diagnosis of toxoplasmosis.

Regulatory effects of persistent measles virus infection on tumorigenicity and protooncogene expression in neuroblastoma cells.

MS is among the infectious agents known to persistently infect cells of the CNS. Clones NS20/Y and NS20/MS persistently infected with MS, both originating from the C1300 mouse neuroblastoma, were used. Multiple effects of the MS infection on the neuronal cell communication, expression of protooncogenes tumorigenicity and on the presence of immunoregulatory molecules were studied. Our results demonstrate that the level of the MHC class I and II antigens and beta-2 microglobulin was elevated in the MS infected cells. Furthermore, MS infection results in the significant increase of protein kinase C (PKC) activity concomitantly with the elevation of PKC-I specific m-RNA. The MS infection was found to affect also the expression of the protooncogenes known to associate with the PKC signaling system. Thus, the level of c-fos mRNA was elevated in the MS infected cells, while there were almost no changes in the c-myc gene expression. Ki-ras and Ha-ras appeared to be regulated differently by MS infection. The level of Ki-ras mRNA was unchanged, but the expression of the Ha-ras gene was markedly depressed, correlating well with the low tumorigenicity of the MS infected neuroblastoma cells in nude mice. Our results suggest that viral infection may be beneficial in certain cases of depressing oncogenic genes which may contribute to the development and maintenance of the malignant phenotype.

Infectious measles virus from cloned cDNA.

The study of measles virus (MV) and of negative strand RNA viruses in general has been hampered by the lack of an experimental system for genetic manipulation. Here we describe a procedure for generating infectious MV from cloned MV cDNA. First we assembled a genetically marked DNA copy of the MV genome in plasmids, under the control of phage T3 or T7 promoters, allowing production of transcripts almost identical to the MV genome or antigenome. Incubation of these linearized plasmid DNAs with the appropriate phage polymerase and only two ribonucleoside triphosphates yielded committed transcription complexes. Microinjection of these complexes into the cytoplasm of helper cells which provide the proteins necessary for MV genome encapsidation and transcription/replication, reproducibly give rise to lytic MVs. The transcripts of one of these viruses were analysed by sequencing after reverse transcription followed by DNA amplification, and found to contain the genetic tags. The described procedure permits the analysis of a negative strand RNA virus with the same genetic tools previously applicable only to positive strand RNA viruses and retroviruses.

Mutated and hypermutated genes of persistent measles viruses which caused lethal human brain diseases.

Persistent measles viruses (MVs) causing lethal human brain diseases are defective, and the structure of several mutated matrix genes has been elucidated previously. The present study of four persistent MVs revealed a high number of differences from a consensus sequence also in other genes. Amino acid changes accumulated in the carboxyl terminus of the nucleocapsid protein and in the amino terminus of the phosphoprotein, but did not significantly alter these products, which are implicated in viral replication and transcription. The contrary is true for the envelope glycoproteins: In three of four cases, mutations caused partial deletion of the short intracellular domain of the fusion protein, most likely compromising efficient viral budding. Moreover, in the hemagglutinin gene of a strain showing strongly reduced hemadsorption, 20 clustered A to G mutations, resulting in 16 amino acid changes, were detected. This hypermutation might be due to unwinding modification of a part of the MV RNA genome accidentally present in a double-stranded form. Finally, we classified four lytic and seven persistent MV strains on the basis of their sequences. Surprisingly, the four lytic viruses considered belong to the same class. The persistent viruses form more loosely defined groups, which all differ from the vaccine strain Edmonston.