Virus spread, tissue inflammation and antiviral response in brains of flavivirus susceptible and resistant mice acutely infected with Murray Valley encephalitis virus.

Inborn resistance to flaviviruses, conferred by a single chromosome 5 locus Flv, is a genetic trait operative in wild mice and a few strains of laboratory mice. In this study we have used in situ hybridisation to trace the spread of flavivirus genomic RNA within the brains of flavivirus susceptible C3H/HeJARC and congenic resistant C3H.PRI- Flv(r) mice following infection with Murray Valley encephalitis virus (MVE) in parallel to studying a brain histopathology and induction of cellular genes involved in antiviral response. We find that in contrast to a high viral RNA content in brains of susceptible mice, viral RNA was markedly reduced in the cortex, olfactory bulb, thalamus and hypothalamus of resistant mice. Trace amounts of viral RNA were detected in the medulla oblongata while it was completely absent from the hippocampus, pons and cerebellum of resistant mice at different time points post infection. The low virus titres within brains of resistant mice coincided with a very mild inflammation, low counts of infiltrating inflammatory cells, and lower IFN I/II and TNFalpha gene induction than in susceptible mice. Furthermore, transcripts of several genes belonging to a 2',5'-oligoadenylate synthetase ( OAS) family, implicated in IFN I-inducible OAS/RNase L antiviral pathway, showed similar brain tissue induction in both strains of mice suggesting only minor contribution of this pathway to the resistance phenotype.

Development and characterization of new flavivirus-resistant mouse strains bearing Flv(r)-like and Flv(mr) alleles from wild or wild-derived mice.

A single genetic locus, flavivirus resistance (Flv), controls virus titres and severity of flavivirus infection in mouse brain. It has been mapped to mouse chromosome 5 and shown to include different allelic forms. While the majority of laboratory mouse strains are susceptible to flaviviruses and carry the Flv(s) allele, wild mice and laboratory mouse strains recently derived from them are resistant and carry flavivirus-resistance alleles including Flv(r)-like and Flv(mr) alleles. Although there is a mouse model of flavivirus resistance conferred by the Flv(r) allele, other resistance alleles have not been adequately studied due to a lack of appropriate animal models. In this paper we describe the development of new flavivirus-resistant mouse strains, C3H.M.domesticus-Flv(r) and C3H.MOLD-Flv(mr), which carry the novel resistance alleles Flv(r)-like and Flv(mr) on the genetic background of flavivirus susceptible C3H/HeJ mice. The new strains were created by 10 to 11 generations of backcrossing followed by brother-sister matings resulting in a generation of homozygous founder stocks. Genome analysis of the newly developed mouse strains has revealed chromosomal regions of approximately 9 and 11 cM, respectively, encompassing Flv on chromosome 5, which are derived from resistant donor mice. These segments are much smaller than the segment of approximately 31 cM described in the congenic resistant mouse strain C3H.PRI-Flv(r) (also known as C3H/RV). The new congenic mouse strains, which were created to carry the Flv(r)-like and Flv(mr) alleles on the standardized genetic background of susceptible mice, represent new animal models of flavivirus resistance conferred by these novel resistance alleles.

Genetic control of host resistance to flavivirus infection in animals.

Flaviviruses are small, enveloped RNA viruses which are generally transmitted by arthropods to animals and man. Although flaviviruses cause important diseases in domestic animals and man, flaviviral infection of animals which constitute the normal vertebrate reservoir may be mild or sub-clinical, which suggests that some adaptation between virus and host may have occurred. While this possibility is difficult to study in wild animals, extensive studies using laboratory mice have demonstrated the existence of innate, flavivirus-specific resistance. Resistance is heritable and is attributable to the gene Flvr, which is located on chromosome 5 in this species. The mechanism of resistance is at present unknown, but acts early and limits the replication of flaviviruses in cells. While some evidence supports a role for Flvr in enhancing the production of defective interfering virus, thereby restricting the production of infectious virus, other reports suggest that Flvr interferes with either virus RNA replication or RNA packaging. Recent research suggests that cytoplasmic proteins bind to the viral replication complex and that allelic forms of these proteins in resistant mice may restrict the production of infectious progeny. Apparent resistance to flaviviruses has been described in other vertebrates, although it remains to be seen if this is attributable to a homologue of Flvr. Nonetheless, knowledge gained of the characteristics and function of Flvr in mice should be applicable to other host species, and improvement of resistance to flaviviral infection in domestic animals by selective breeding or gene technology may ultimately be possible.

Characterization of defective viral RNA produced during persistent infection of Vero cells with Murray Valley encephalitis virus.

Defective interfering viral particles are readily produced in cell culture after a high multiplicity of infection with many animal RNA viruses. Due to defects that they carry in their genomes, their life cycle needs to be complemented by the helper functions provided by a parental virus which makes them both dependent on and competitive with the parental virus. In many instances, this may cause the abrogation of a lytic cycle of the parental virus, leading to a persistent infection. In this paper, we describe for the first time the presence of truncated or defective interfering viral RNAs produced in Vero cells persistently infected with the flavivirus Murray Valley encephalitis virus. While these RNAs have not been detected in acutely infected Vero cells, their appearance coincided with the establishment of persistent infection. We also show for the first time that the defective viral RNAs replicate well in both cell culture and cell-free virus replication systems, indicating that they may interfere with the replication of parental virus at the level of viral RNA synthesis. Significantly, structural analyses of these RNA species including nucleotide sequencing have revealed that they carry similar nucleotide deletions encompassing the genes coding for the prM and E proteins and various gene segments coding for the N terminus of the NS1 protein. These deletions are in frame, allowing the synthesis of truncated NS1 proteins to occur in persistently infected cells. This may have further implications for the interference with the parental virus at the level of viral RNA synthesis in addition to a major one at the level of virion assembly and release.

Molecular characterization of virus-specific RNA produced in the brains of flavivirus-susceptible and -resistant mice after challenge with Murray Valley encephalitis virus.

Natural resistance to flaviviruses in mice is controlled by a single genetic locus, FIv, on chromosome 5. Although the mechanism of this resistance is not fully understood, it is believed to operate at the level of virus replication rather than the immune response. It has been hypothesized that enhanced production of viral defective interfering (DI) particles is responsible for a substantial reduction in the titres of infectious virus in resistant mice. However, this has never been established at the molecular level since such particles have not been isolated and characterized. We have studied the products of virus replication in the brains of flavivirus-susceptible C3H/HeJ (Flv(s)) and -resistant congenic C3H/RV (Flv(r)) mice after an intracerebral challenge (i.c.) with Murray Valley encephalitis (MVE) virus and have found no evidence for the accumulation of truncated viral RNA in the brains of resistant mice. All three major viral RNA species, the replicative intermediate (RI), replicative form (RF) and virion RNA (vRNA) together with a subgenomic RNA species of 0.6 kb, which has not been previously described, were present in the brains of both mouse strains. However, the viral RF and RI RNA forms preferentially accumulated in the brains of resistant mice. Thus, we confirm that the resistance allele Flv(r) interferes with discrete steps in flavivirus replication, although the precise mechanism remains to be determined.

Low resolution mapping around the flavivirus resistance locus (Flv) on mouse chromosome 5.

Although the phenomenon of innate resistance to flaviviruses in mice was recognized many years ago, it was only recently that the genetic locus (Flv) controlling this resistance was mapped to mouse Chromosome (Chr) 5. Here we report the fine mapping of the Flv locus, using 12 microsatellite markers which have recently been developed for mouse Chr 5. The new markers were genotyped in 325 backcross mice of both (C3H/HeJ x C3H/RV)F1 x C3H/HeJ and (BALB/c x C3H/RV)F1 x BALB/c backgrounds, relative to Flv. The composite genetic map that has been constructed identifies three novel microsatellite loci, D5Mit68, D5Mit159, and D5Mit242, tightly linked to the Flv locus. One of those loci, D5Mit159, showed no recombinations with Flv in any of the backcross mice analyzed, indicating tight linkage (< 0.3 cM). The other two, D5Mit68 and D5Mit242, exhibited two and one recombinations with Flv (0.6 and 0.3 cM) respectively, defining the proximal and distal boundaries of a 0.9-cM segment around this locus. The proximal flanking marker, D5Mit68, maps to a segment on mouse Chr 5 homologous to human Chr 4. This, together with the previous data produced by our group, locates Flv to a region on mouse Chr 5 carrying segments that are conserved on either human Chr 4, 12, or 7, but present knowledge does not allow precise identification of the syntenic element.

Mapping the Flv locus controlling resistance to flaviviruses on mouse chromosome 5.

Genetically determined resistance to flaviviruses in mice is a dominant trait conferred by alleles at a single autosomal locus designated Flv, but no gene products have been associated with this locus and the mechanism of resistance is not well understood. To further characterize this model of genetic resistance, we conducted mapping studies to determine the chromosomal location of Flv. Because of evidence suggesting that the Flv locus is on chromosome 5, three-point backcross linkage analyses were used to define the location of Flv relative to previously assigned chromosome 5 markers. The results confirm the chromosome 5 location of Flv and indicate a map position between the anchor loci rd and Gus-s. The chromosomal localization of Flv is the first step in the production of a detailed linkage map of the Flv region, which may open approaches to positional cloning of the resistance gene.

Distinct spectrum of N-ras mutations in aml and mds patients in yugoslavia.

Mutations that activate ras genes were demonstrated to be associated with certain types of malignancies. Multiple point mutations were predominantly found in the N-ras and occasionally in the K-ras genes. The analysis of 4 MDS, 23 AML and 11 CML patients from Yugoslavia revealed the prevalence of the N-ras mutation (83%) over K-ras mutations (17%). Although the frequencies of the N- and K-ras mutations in these patients were similar to the ones reported for patients from USA and Japan, the N-ras mutational spectra considerably differed. The prevailing type of mutation in patients from Yugoslavia was G-to-T transversion at the first position in the codon 12 of the N-ras gene. This study supports a hypothesis that different geographical and environmental factors may cause the accumulation of different type of point mutations in the same target gene.

Prevalence of G-to-T transversions among K-ras oncogene mutations in human colorectal tumors in Yugoslavia.

Human colorectal carcinoma tissue sampled from 37 patients, routinely graded into Dukes' stages A, B and C and histologically examined for the level of differentiation, were analyzed for the presence of point mutations in the K-ras oncogene. Seventeen cases out of the 37 analyzed were found to have a mutation in either the 12th or the 13th codon of the K-ras gene, giving an overall frequency of mutation of 46%. The incidence of mutations in Dukes' stages A, B and C was 33, 46 and 58% respectively. Although the frequency of mutation appears to be similar to that reported for the USA population, the spectrum of point mutations in codons 12 and 13 of the K-ras gene in the Yugoslav population appears to differ significantly. G-to-T transversions make up 77% of all mutations present, with the distribution as follows: 18% at the first base and 59% at the second base of codons 12 and 13. G-to-A transitions at the second base is the only other mutation identified, occurring mainly in codon 13 in colorectal tumors of all 3 stages.

Nucleotide sequence of small chromatin-associated RNA (fr3 RNA).

A small RNA found in the fraction on non-histone chromosomal proteins or rat liver and chicken reticulocytes [Holoubek, V., Deacon, N.J., Buckle, D.W. and Naora, H. (1983) Eur. J. Biochem. 137, 249-256] has been isolated from rat liver and then sequenced. The RNA is 30 nucleotides long and has the following composition: 5'AGUGGGGGACUGCGUUCGCGCUCUCCCCUG3'. This sequence is identical with the sequence of the last 30 nucleotides at the 3' end of small nuclear U1 RNA.