Rumen effects of monensin in dry cow diets varying in energy density.

Controversy has existed as to whether monensin will provide equal or differential benefits in a higher-energy, lower-roughage close-up diet versus a higher-roughage, lower-energy diet. Our objective was to determine the rumen effects of a controlled-energy, high-fiber diet balanced to meet but not greatly exceed energy requirements during the dry period or a traditional 2-group approach of higher-energy close-up diet. The effects of added monensin in each diet type were determined. Multiparous Holstein cows (n = 17) were fitted surgically with ruminal cannulas. During the first 4 wk of the dry period, all cows were fed a controlled-energy, high-fiber diet (CE) as a total mixed ration for ad libitum intake. During the last 3 wk before calving, half of the cows were switched to a higher-energy, close-up diet until calving (CU), whereas the other half continued to receive the CE diet. Within each dietary group, half of the cows received monensin (MON) supplementation in the diet (24.2 g/t of total dry matter) and half did not (CON). After calving, all cows received the same lactation diet containing monensin (15.4 g/t of dietary dry matter). At 14 d prepartum, dry matter intake was not different across treatments. The weight of rumen contents was greater for cows fed CE. Rumen liquid dilution rate, solids passage rate, pH, total volatile fatty acid (VFA) concentrations, molar proportions of acetate and propionate, and papillae length did not differ among diets. Butyrate percentage tended to be greater for cows fed CE. Postpartum, dry matter intake, mass of rumen contents, solids passage rate, pH, total VFA concentration, molar percentages of propionate and butyrate, and papillae length did not differ among treatments. Liquid dilution rate (16.6, 10.7, 16.0, and 18.2%/h for CE + CON, CE + MON, CU + CON, and CU + MON, respectively) was affected by a diet × monensin interaction. Cows on the CE + CON diet had a greater ruminal proportion of acetate than did cows fed CU + CON, whereas cows fed monensin on either diet were intermediate (diet × monensin interaction). Addition of MON to the CU diet decreased the proportion of propionate (diet × monensin interaction). Cows fed CE had greater mass of rumen contents before parturtition but the high inclusion of wheat straw in the CE diet did not negatively affect rumen papillae length. Monensin inclusion differentially affected liquid passage rate and VFA concentrations.

Effects of prepartum diets varying in dietary energy density and monensin on early-lactation performance in dairy cows.

Our objectives were to evaluate the effects of prepartum monensin supplementation and dry-period nutritional strategy on the postpartum productive performance of cows fed monensin during lactation. A total of 102 Holstein cows were enrolled in the experiment (32 primiparous and 70 multiparous). The study was a completely randomized design, with randomization restricted to balance for parity, body condition score, and expected calving date. A 2 × 2 factorial arrangement of prepartum treatments was used; the variables of interest were prepartum feeding strategy [controlled-energy diet throughout the dry period (CE) vs. controlled-energy diet from dry-off to 22 d before expected parturition, followed by a moderate-energy close-up diet from d 21 before expected parturition through parturition (CU)] and prepartum monensin supplementation [0 g/t (control, CON) or 24.2 g/t (MON); Rumensin; Elanco Animal Health, Greenfield, IN]. Lactation diets before and after the dry period contained monensin at 15.4 g/t. During the close-up period, cows fed CU had greater DM and NEL intakes than cows fed CE. Calf BW at birth tended to be greater for cows fed CU than for those fed CE but was not affected by MON supplementation. Diet did not affect calving difficulty score, but cows supplemented with MON had an increased calving difficulty score. We found a tendency for a MON × parity interaction for colostral IgG concentration, such that multiparous MON cows tended to have lower IgG concentration than CON cows, but colostral IgG concentration for primiparous MON and CON cows did not differ. Postpartum milk yield did not differ between diets but tended to be greater for cows supplemented with MON. Milk fat and lactose content were greater for cows fed CU than for those fed CE, and lactose content and yield were increased for cows supplemented with MON. Solids-corrected and fat-corrected milk yields were increased by MON supplementation, but were not affected by diet. Overall means for postpartum DMI did not differ by diet or MON supplementation. The CU diet decreased the concentration of nonesterified fatty acids during the close-up period but increased it postpartum. Neither diet nor monensin affected ß-hydroxybutyrate or liver composition. Overall, postpartum productive performance differed little between prepartum dietary strategies, but cows fed MON had greater energy-corrected milk production. In herds fed monensin during lactation, monensin should also be fed during the dry period.

Efecto del recunnto de células somáticas sobre a aptitud quesera de la leche yy la calidad fisicoquímica y sensorial del queso campesino / Somaticcell counnt effect on cheese yield and quality of fresh cheese

Antecedentes: en Colombia, el alto recuento de células somáticas (RCS) en la leche es un problema para la industria lechera. Altos recuentos pueden afectar de manera considerable los rendimientos y calidad final del queso. Varios países han establecido límites máximos estandarizados para el RCS. Colombia no lo ha hecho de manera oficial y tan solo unas pocas industrias manejan sus propios límites. Objetivos: Determinar el efecto del RCS sobre parámetros de aptitud quesera de la leche y la calidad sensorial del queso campesino. Métodos: Se tomaron muestras de leche de seis tanques con altos y bajos RCS y se realizaron mezclas para obtener 30 baches con diferentes RCS (desde 150.000 hasta 1.200.000 cel/ml). Con estas mezclas se elaboraron 30 quesos tipo campesino a los cuales se les determinaron variables de aptitud quesera (tiempo de coagulación, rendimientos y pérdidas en suero) y la calidad organoléptica a través de una prueba sensorial descriptiva de puntajes con panel de seis jueces con experiencia previa y entrenados en queso campesino. Las variables de aptitud quesera fueron analizadas por regresión múltiple y los resultados de la evaluación sensorial con la prueba no paramétrica de Friedman. Resultados: La aptitud quesera disminuyó con RCS superiores a 200.000 cel/ml. El tiempo de coagulación (R² = 0.74; P< 0.001) y las pérdidas de proteína en el lactosuero (R² = 0.55; P<0,001) aumentaron, mientras que los rendimientos (R²=0.31; P<0.01) disminuyeron a medida que aumentó el RCS. La calificación de los panelistas respecto de la textura y la apariencia disminuyó con RCS mayores a 600.000 cel/ml (P<0.01) y el sabor y el aroma, a partir de 800.000 cel/ml (P<0,01). Conclusiones: Aumentos en el RCS en leche afectan negativamente parámetros de aptitud quesera y la calidad sensorial del queso campesino. Se sugiere que los impactos serán menores sobre el rendimiento cuanto menor sea el RCS, mientras que la calidad organoléptica mejorará cuando la leche tenga RCS por debajo de 600.000 cel/ml.

Background: A high milk somatic cell count (SCC) is a problem for milk industry in Colombia. These high counts can affect considerably yield and final quality of cheese. Several countries have established maximum limits for SCC. In Colombia these limits have not been established officially, only a few industries have their own limits. Objectives: To determine the effect of somatic cell count (SCC) on milk potential for cheese making and sensorial quality of fresh cheese. Methods: Six milk samples with high and low SCC, were taken from bulk tanks and mixed to obtain 30 samples with SCC of 150.000 to 1.200.000 somatic cells/mL. Thirty fresh cheeses were prepared and clotting time, yield (protein, fat, dry matter) and whey losses were determined. Additionally, score descriptive sensorial quality test was performed by 6 trained judges. Protein, fat, dry matter in milk and cheese yields were analyzed by multiple regressions and information of sensorial test by Friedman method. Results: When milk SCC (somatic cells/ml) increased from 150.000 to 1.200.000, clotting time (R² = 0,74; P<0.001), and whey protein losses increased (R² = 0.55; P<0.001) and cheese yield decreased (R²=0.31, P<0.01). According to panelists, texture and appearance were affected negatively when SCC was higher than 600.000 cells per ml (P<0.01), flavor and aroma when they were higher than 800000 cells/ml. Conclusions: Increases in SCC have a negative effect on milk potential for cheese making and quality sensorial parameters on fresh cheese. It is suggested that minor impacts in fresh cheese yield would be obtained with a lower SCC and for good sensorial quality when the milk has SCC, lower than 600.000 cells per ml.

First Report of Tomato torrado virus Infecting Tomato in Single and Mixed Infections with Cucumber mosaic virus in Panama.

In February of 2008, in open-field-grown tomato crops (Solanum lycopersicum L.) from the central regions of Coclé, Herrera, Los Santos, and Veraguas of Panama, unusual disease symptoms, including deformation, necrosis, purple margins, interveinal yellowing, downward and upward curling of the leaflets alternately, necrotic lines in sepals and branches, fruits distorted with necrotic lines on the surface, and severe stunting, were observed. Tomato production was seriously damaged. To verify the identity of the disease, five symptomatic tomato plants from four fields of these regions were selected and analyzed by double-antibody sandwich (DAS)-ELISA using specific antibodies to Cucumber mosaic virus (CMV), Potato virus X (PVX), Potato virus Y (PVY), Tomato mosaic virus (ToMV), Tomato spotted wilt virus (TSWV) (Loewe Biochemica, Sauerlach, Germany), and Pepino mosaic virus (PepMV) (DSMZ, Braunschweig, Germany). Total RNA was extracted from all plants and tested using reverse transcription (RT)-PCR with three pairs of specific primers: one pair designed to amplify 586 bp of the coat protein gene of CMV (CMV-F 5'-CCTCCGCGGATGCTAACTT-3' and CMV-R 5'-CGGAATCAGACTGGGAGCA-3') and the other two pairs to Tomato torrado virus (ToTV) that amplify 580 and 574 bp of the polyprotein (4) and coat protein (Vp23) (3) region of RNA2, respectively; and by dot-blot hybridization with a digoxygenin-labeled RNA probe complementary to the aforementioned polyprotein. The serological analysis for PVX, PVY, ToMV, TSWV, and PepMV were negative. ToTV was detected in all samples analyzed. Three of these samples were also positive for CMV by serological and molecular analysis. No differences in symptom expression were observed between plants infected with both viruses or with ToTV alone. RT-PCR products were purified and directly sequenced. BLAST analysis of one CMV sequence (GenBank Accession No. EU934036) showed 98% identity with a CMV sequence from Brazil (most closely related sequence) (GenBank Accession No. AY380812) and 97% with the Fny isolate (CMV subgroup I) (GenBank Accession No. U20668). Two ToTV sequences were obtained (GenBank Accession Nos. EU934037 and FJ357161) and showed 99% and 98% identities with the polyprotein and coat protein region of ToTV from Spain (GenBank Accession No. DQ388880), respectively. CMV is transmitted by aphids and is distributed worldwide with a wide host range (2), while ToTV is transmitted by whiteflies and has only been reported in tomato crops in Spain and Poland and recently on weeds in Spain (1). To our knowledge, this is the first time ToTV has been detected in Panama and the first report of CMV/ToTV mixed infection. References: (1) A. Alfaro-Fernández et al. Plant Dis. 92:831, 2008. (2) A. A. Brunt et al. Plant Viruses Online: Descriptions and Lists from the VIDE Database. Online Publication, 1996. (3) H. Pospieszny et al. Plant Dis. 91:1364, 2007. (4) M. Verbeek et al. Arch. Virol. 152:881, 2007.

First Report of Tomato torrado virus Infecting Tomato in Hungary.

During the growing seasons of 2007 and 2008, in commercial greenhouses of tomato crops (Solanum lycopersicum L.) located in Szeged, Öcsöd, and Csongrád (southeastern regions of Hungary), unusual disease symptoms were observed, including necrotic spots in defined areas at the base of the leaflet, necrosis in the stems, and necrotic lines on the fruits surface. Affected plants appeared inside the greenhouses with a random distribution and the incidence recorded was at least 40%. These symptoms resembled those described for Tomato torrado virus (ToTV) infection in Spain (1) and Poland (3). To verify the identity of the disease, three symptomatic plants from commercial greenhouses of each geographic location were selected and analyzed by double-antibody sandwich-ELISA using polyclonal antibodies specific to Cucumber mosaic virus (CMV), Potato virus Y (PVY), Tomato mosaic virus (ToMV), Tomato spotted wilt virus (TSWV) (Loewe Biochemica, Sauerlach, Germany), and Pepino mosaic virus (PepMV) (DSMZ, Braunschweig, Germany). Total RNA was extracted and tested by reverse transcription (RT)-PCR with three pair of specific primers: one pair used to amplify the coat protein (CP) gene of PepMV (2) and the other two pairs specific to ToTV that amplify 580 bp of the polyprotein (4) and a fragment of 574 bp in the CP Vp23 (3). Nonisotopic dot-blot hybridization using a digoxygenin-labeled RNA probe complementary to the aforementioned fragment of the polyprotein was also performed. Tomato samples were negative for all the viruses tested by serological analysis and for PepMV by RT-PCR. However, all three samples were positive for ToTV by molecular hybridization and RT-PCR. RT-PCR products were purified and directly sequenced. The amplified fragments of the three Hungarian isolates, ToTV-H1, ToTV-H2, and ToTV-H3, for the polyprotein (GenBank Accession Nos. EU835496, FJ616995, and FJ616994, respectively) and the CP Vp23 (GenBank Accession Nos. FJ616996, FJ616997, and FJ616998, respectively) showed 99 to 98% nt identity with the polyprotein and the coat protein regions of ToTV from Spain and Poland (GenBank Accession Nos. DQ3888880 and EU563947, respectively). Whiteflies, commonly found in Hungarian greenhouses, have been reported to transmit ToTV (3), although the efficiency of transmission is unknown. To our knowledge, this is the first report of ToTV in Hungary. References: (1) A. Alfaro-Fernández et al. Plant Dis. 91:1060, 2007. (2) I. Pagán et al. Phytopathology 96:274, 2006. (3) H. Pospieszny et al. Plant Dis. 91:1364, 2007. (4) J. Van der Heuvel et al. Plant Virus Designated Tomato Torrado Virus. Online publication. World Intellectual Property Organization. WO/2006/085749, 2006.

First Report of Tobacco mild green mosaic virus Infecting Capsicum annuum in Tunisia.

During the springs of 2007 and 2008, leaf deformations as well as symptoms of mild green and chlorotic mosaic were observed on pepper (Capsicum annuum) plants grown in Monastir (northwest Tunisia) and Kebili (southeast Tunisia). With the support of projects A/5269/06 and A/8584/07 from the Spanish Agency for International Cooperation (AECI), symptomatic leaf samples were analyzed by transmission electron microscopy (TEM) of leaf-dip preparations. Typical tobamovirus-like particles (rigid rods ≈300 nm long) were observed in crude plant extracts. According to literature, at least six tobamoviruses infect peppers: Paprika mild mottle virus (PaMMV); Pepper mild mottle virus (PMMoV); Ribgrass mosaic virus (RMV); Tobacco mild green mosaic virus (TMGMV); Tobacco mosaic virus (TMV); and Tomato mosaic virus (ToMV) (1). Extracts from six symptomatic plants from Monastir and four from Kebili fields tested negative for ToMV, TMV, and PMMoV and tested positive for TMGMV by double-antibody sandwich (DAS)-ELISA using polyclonal antibodies specific to each virus (Loewe Biochemica GMBH, Sauerlach, Germany). To confirm the positive TMGMV results, total RNAs from 10 symptomatic plants that tested positive by ELISA were extracted and analyzed by reverse transcription (RT)-PCR using primers designed to specifically amplify a region of the coat protein gene (CP) of TMGMV (2). The 524-bp TMGMV-CP specific DNA fragment was amplified from all samples, but was not amplified from healthy plants or the sterile water used with negative controls. RT-PCR products were purified and directly sequenced. BLAST analysis of the obtained sequence (GenBank No. EU770626) showed 99 to 98% nucleotide identity with TMGMV isolates PAN-1, DSMZ PV-0113, TMGMV-Pt, and VZ1 (GenBank Nos. EU934035, EF469769, AM262165, and DQ460731, respectively) and less than 69% with PaMMV and PMMoV isolates (GenBank Nos. X72586 and AF103777, respectively). Two TMGMV-positive, singly, infected symptomatic pepper plants collected from Monastir and Kebili were used in mechanical transmissions to new pepper and tomato plants. Inoculated pepper plants exhibited mild chlorosis symptoms and tested positive for TMGMV only; however, inoculated tomato plants cv. Marmande were asymptomatic and tested negative as expected for TMGMV infection (1). To our knowledge, although C. annuum has been shown as a natural host for TMGMV (2), this is the first report of TMGMV in Tunisia. Reference: (1) A. A. Brunt et al. Plant Viruses Online: Descriptions and Lists from the VIDE Database. Version: 20th August 1996. Online publication, 1996. (2) J. Cohen et al. Ann. Appl. Biol. 138:153, 2001.

First Report of the US1 Strain of Pepino mosaic virus in Tomato in the Canary Islands, Spain.

Pepino mosaic virus (PepMV), a member of the genus Potexvirus, was first described in 1974 on pepino (Solanum muricatum Ait.) in Peru. In 1999, PepMV was reported to be affecting tomato (Solanum lycopersicum L.) (3), and currently, the virus is distributed throughout many parts of the world causing economic losses in tomato crops. This virus induces not only a high variability of symptoms on infected plants, including distortion, chlorosis, mosaic, blistering, and filiformity on leaves and marbling on fruits, but also exhibits substantial genetic diversity. Five strains or genotypes of PepMV have been described, including European tomato (EU), Peruvian (PE), Chilean 2 (CH2), and two American strains, US1 (including CH1) and US2. No correlation has been found between different genotypes and symptom expression of PepMV infection. Studies have demonstrated that field populations of PepMV in Europe belong to EU and US2 or CH2 strains. Mixed infections between these strains and interstrain recombinant isolates are also found (1,2). In Spain, the PE strain was also described, but at a lower relative frequency than other strains (2). In February 2007 in the Canary Islands (Tenerife, Spain), a PepMV isolate (PepMV-Can1) showing the typical leaf symptoms of blistering and mosaic was collected. PepMV was first identified by double-antibody sandwich (DAS)-ELISA with specific antisera against PepMV (DSMZ GMBH, Baunschweig, Germany) according to the manufacturer's instructions. The serological identification was confirmed by reverse transcription (RT)-PCR with two pairs of PepMV-specific primers Pep3/Pep4 and CP-D/CP-R that amplify a fragment of the RNA dependent RNA polymerase (RdRp) gene and the complete coat protein (CP) gene, respectively (2). PCR products were purified and directly sequenced. The amplified RdRp fragment of PepMV-Can1 (GenBank Accession No. EU791618) showed 82% nt identity with the EU and PE strains (GenBank Accession Nos. AJ606360 and AM109896, respectively), but more than 98% identity with the US2 and US1 strains (GenBank Accession Nos. AY509927 and AY 509926, respectively). Sequence information obtained from the amplified CP fragment (GenBank Accession No. EU797176) showed 99% nt identity with US1 and less than 83% with EU, PE, CH2 (GenBank Accession No. DQ000985), and US2. To confirm these results, specific primers for the triple gene block (TGB) were designed using the sequence data from GenBank Accession Nos. AY509926, AY509927, DQ000985, AJ606360, and AM109896. (PepTGB-D:5' GATGAAGCTGAACAACATTTC 3' and PepTGB-R: 5' GGAGCTGTATTRGGATTTGA 3'). A 1,437-bp fragment (GenBank Accession No. EU797177) was obtained, sequenced, and compared with the published sequences, showing 98% nt identity with the US1 strain and less than 86% with the other strains of PepMV. The highest sequence identity in all the studied regions of the PepMV-Can1 isolate was with the US1 strain of PepMV. To our knowledge, this is not only the first report of an isolate of the US1 strain in the Canary Islands (Spain), but also the first report of the presence of this genotype in a different location than its original report (North America). References: (1) I. Hanssen et al. Eur. J. Plant Pathol. 121:131, 2008. (2) I. Pagán et al. Phytopathology 96:274, 2006. (3) R. A. R. Van der Vlugt et al. Plant Dis. 84:103, 2000.

First Report of Alfalfa mosaic virus in Viburnum lucidum in Spain.

Viburnum sp. is an ornamental shrub widely used in private and public gardens. It is common in natural wooded areas in the Mediterranean Region. The genus includes more than 150 species distributed widely in climatically mild and subtropical regions of Asia, Europe, North Africa, and the Americas. In January 2007, yellow leaf spotting in young plants of Viburnun lucidum was observed in two ornamental nurseries in the Mediterranean area of Spain. Symptoms appeared sporadically depending on environmental conditions but normally in cooler conditions. Leaf tissue from 24 asymptomatic and five symptomatic plants was sampled and analyzed by double-antibody sandwich (DAS)-ELISA with specific polyclonal antibodies against Tomato spotted wilt virus (TSWV) (Loewe Biochemica, Sauerlach, Germany) and Alfalfa mosaic virus (AMV) (SEDIAG S.A.S, Longvic, France). All symptomatic plants of V. lucidum were positive for Alfalfa mosaic virus (AMV). The presence of AMV was tested in the 29 samples by one-step reverse transcription (RT)-PCR with the platinum Taq kit (Invitrogen Life Technologies, Barcelona, Spain) using primers derived from a partial fragment of the coat protein gene of AMV (2). The RT-PCR assays produced an expected amplicon of 700 bp in the five symptomatic seropositive samples. No amplification product was observed when healthy plants or a water control were used as a template in the RT-PCR assays. One PCR product was purified (High Pure PCR Product Purification Kit; Roche Diagnostics, Mannheim, Germany) and directly sequenced (GenBank Accession No. EF427449). BLAST analysis showed 96% nucleotide sequence identity to an AMV isolate described from Phlox paniculata in the United States (GenBank Accession No. DQ124429). This virosis has been described as affecting Viburnum tinus L. in France (1). To our knowledge, this is the first report of natural infection of Viburnum lucidum with AMV in Spain, which might have important epidemiological consequences since V. lucidum is a vegetatively propagated ornamental plant. References: (1) L. Cardin et al. Plant Dis. 90:1115, 2006. (2) Ll. Martínez-Priego et al. Plant Dis. 88:908, 2004.

First Report of Pea enation mosaic virus Infecting Pea and Broad Bean in Spain.

During the spring of 2007, pea plants (Pisum sativum L.) (cvs. Utrillo and Floreta) showing virus-like symptoms were observed in several commercial fields in the southern and eastern regions of Catalonia, Spain. Incidence of symptomatic plants ranged from 5 to 15% and was distributed in both small and large patches. Infected plants exhibited yellow mosaic leaf symptoms that later became translucent. Leaves gradually curled and in some cases developed enations near the veins on the abaxial surface. Plants were "bushy" and had shortened internodes. Infection prior to pod formation resulted in pods that were distorted and stunted (1). The infected leaves and pods were tested by indirect-ELISA with a potyvirus-specific antibody (Agdia, Elkhart, IN) and double-antibody sandwich (DAS)-ELISA with antibodies specific to Pea enation mosaic virus (PEMV), Broad bean wilt virus 1 (BBWV-1), Beet western yellow virus (BWYV), Bean yellow mosaic virus (BYMV), Alfalfa mosaic virus (AMV), and Tomato spotted wilt virus (TSWV) (Loewe Biochemica GmbH, Sauerlach, Germany). PEMV was detected in all 24 symptomatic samples that were collected from 10 locations between March 2007 and March 2008. Thirteen of these samples also tested positive for BWYV, but no differences in symptom expression were observed in plants infected with both viruses or PEMV alone. PEMV was also identified in seven broad bean plants (Vicia faba L.) from three additional locations. These plants expressed interveinal yellow mosaic on leaves and deformed pods. The genomic sequence of PEMV-1 (GenBank Accession No. L04573) was used to design primers to amplify a 451-nt segment of the polymerase gene by reverse transcription (RT)-PCR; PEMV-D (5'-TGACCATGAGTCCACTGAGG-3'), PEMV-R (5'-AGTATCTTCCAACAACCACAT-3'). One ELISA-positive sample was analyzed and the expected size amplicon was generated. Direct sequencing (GenBank Accession No. EU652339) revealed that PEMV-1 and our pea isolate have nucleotide sequence identities of 95%. To our knowledge, this is the first report of PEMV in Spain, which might cause important economical losses since PEMV is an important viral disease of pea and other legumes worldwide. Reference: (1) J. S. Skaf and G. A. Zoeten. No. 372 (No. 257 revised) in: Description of Plant Viruses. AAB, Kew, Surrey, England, 2000.

First Report of Tomato torrado virus on Weed Hosts in Spain.

Tomato torrado virus (ToTV) is a recently identified Picorna-like virus that causes "torrado disease" in tomatoes (4). Typical symptoms of "torrado disease" seen in tomato crops (Solanum lycopersicum L. formerly Lycopersicon esculentum L.) were initially defined as yellow areas at the base of the leaflet that later developed into necrotic spots that sometimes abscised, leaving holes in the leaflet. Other plants showed extensive necrosis progressing from the base to the tip of the leaflet. Fruits were distorted with necrotic lines on the surface that often cracked. Affected plants had a burnt-like appearance and the production was seriously reduced. These symptoms have been observed in tomato crops in Murcia (Spain) and the Canary Islands (Spain) (1). To identify possible alternative hosts that may serve as virus reservoirs, samples of 72 different common weed species were collected in greenhouses in Murcia and the Canary Islands where "torrado disease" symptoms were observed in tomatoes. Forty-seven showed virus-like symptoms and 25 were asymptomatic. Symptoms included mild mosaic, blistering, vein clearing, interveinal yellowing, yellow spots, necrosis, leaf distortion, and curling. Samples were analyzed by one-step reverse transcription (RT)-PCR using primers specific for ToTV to amplify 580 bp of the polyprotein region of RNA2 (3) and dot-blot hybridization with a digoxygenin-labeled RNA probe complementary to the same portion of the ToTV genome. Twenty-two of the 72 weed samples belonging to Amaranthus sp. (Amaranthaceae); Spergularia sp. (Caryophyllaceae); Atriplex sp., Chenopodium ambrosioides L., Chenopodium sp., and Halogetum sativus (Loef. ex L.) Moq. (Chenopodiaceae); Senebiera didyma Pers. (Cruciferae); Malva sp. (Malvacae); Polygonum sp. (Polygonaceae); and Nicotiana glauca Graham and Solanum nigrum L. (Solanaceae) were positive for ToTV by molecular hybridization (10 samples) and RT-PCR (22 samples, including the samples positive by molecular hybridization). PCR products obtained from Atriplex sp. (Canary Islands) and S. didyma (Murcia) were sequenced (GenBank Accessions EU090252 and EU090253). BLAST analysis showed 99% identity to ToTV RNA2 sequence (GenBank Accession DQ388880). Two tomato plants were positive for ToTV by RT-PCR after mechanical back-inoculation, although no symptoms were observed. This study showed ToTV infects common weeds present in Spanish tomato crops. Recently, Trialeurodes vaporariorum has been reported to transmit ToTV (2), although the efficiency of transmission is unknown. The vector-assisted transmission of ToTV could explain the infection of weeds in affected greenhouses. To our knowledge, this is the first report of natural infection of weeds by ToTV. References: (1) A. Alfaro-Fernández et al. Plant Dis. 91:1060, 2007. (2) H. Pospieszny et al. Plant Dis. 91:1364, 2007. (3) J. Van der Heuvel et al. Plant Virus Designated Tomato Torrado Virus. Online publication. World Intellectual Property Organization WO/2006/085749, 2006. (4) M. Verbeek et al. Arch. Virol. 152:881, 2007.

Foliar water supply of tall trees: evidence for mucilage-facilitated moisture uptake from the atmosphere and the impact on pressure bomb measurements.

The water supply to leaves of 25 to 60 m tall trees (including high-salinity-tolerant ones) was studied. The filling status of the xylem vessels was determined by xylem sap extraction (using jet-discharge, gravity-discharge, and centrifugation) and by (1)H nuclear magnetic resonance imaging of wood pieces. Simultaneously, pressure bomb experiments were performed along the entire trunk of the trees up to a height of 57 m. Clear-cut evidence was found that the balancing pressure (P(b)) values of leafy twigs were dictated by the ambient relative humidity rather than by height. Refilling of xylem vessels of apical leaves (branches) obviously mainly occurred via moisture uptake from the atmosphere. These findings could be traced back to the hydration and rehydration of mucilage layers on the leaf surfaces and/or of epistomatal mucilage plugs. Xylem vessels also contained mucilage. Mucilage formation was apparently enforced by water stress. The observed mucilage-based foliar water uptake and humidity dependency of the P(b) values are at variance with the cohesion-tension theory and with the hypothesis that P(b) measurements yield information about the relationships between xylem pressure gradients and height.

Towards a medically approved technology for alginate-based microcapsules allowing long-term immunoisolated transplantation.

The concept of encapsulated-cell therapy is very appealing, but in practice a great deal of technology and know-how is needed for the production of long-term functional transplants. Alginate is one of the most promising biomaterials for immunoisolation of allogeneic and xenogeneic cells and tissues (such as Langerhans islets). Although great advances in alginate-based cell encapsulation have been reported, several improvements need to be made before routine clinical applications can be considered. Among these is the production of purified alginates with consistently high transplantation-grade quality. This depends to a great extent on the purity of the input algal source as well as on the development of alginate extraction and purification processes that can be validated. A key engineering challenge in designing immunoisolating alginate-based microcapsules is that of maintaining unimpeded exchange of nutrients, oxygen and therapeutic factors (released by the encapsulated cells), while simultaneously avoiding swelling and subsequent rupture of the microcapsules. This requires the development of efficient, validated and well-documented technology for cross-linking alginates with divalent cations. Clinical applications also require validated technology for long-term cryopreservation of encapsulated cells to maintaining a product inventory in order to meet end-user demands. As shown here these demands could be met by the development of novel, validated technologies for production of transplantation-grade alginate and microcapsule engineering and storage. The advances in alginate-based therapy are demonstrated by transplantation of encapsulated rat and human islet grafts that functioned properly for about 1 year in diabetic mice.

Real-time 3-D dark-field microscopy for the validation of the cross-linking process of alginate microcapsules.

Alginate-based microencapsulation is a promising method for long-term maintenance of cellular and membrane function of the cells and tissue fragments required for in vitro and in vivo biosensors, for tissue engineering and particularly for immunoisolation of non-autologous transplants. Microcapsules of high mechanical strength and optimum permeability can be produced by injection of BaCl2 crystals into alginate droplets before they come into contact with external Ba2+. A key requirement is that the system parameters (number of crystals, speed of the crystal stream etc.) are properly adjusted according to the mannuronic and guluronic acid ratio and the average molecular mass of the alginate as well as to the diameter of the microcapsules. Robust, reliable, rapid and low-cost validation tools are, therefore, needed for assurance of the microcapsule quality. Here, we describe a novel three-dimensional (3-D) dark-field microscopy that allows the real-time measurement of the number and spatial distribution of the injected Ba2+ ions throughout the microcapsules after treatment with sulphate. This novel method requires only a conventional microscope equipped with three polarising filters and a double aperture stop. In contrast to confocal laser scanning microscopy images, peripherally attached BaSO4 precipitates can clearly be distinguished from internal ones. The data also demonstrate that several steps of the alginate gelling process must be improved before such immunoisolation can be used in patients.

A highly sensitive cell assay for validation of purification regimes of alginates.

Among the hydrogels used for microencapsulation of cells and tissues, alginate has been and will continue to be one of the most important biomaterials. A mandatory requirement for clinical immunoisolated transplantations is the reproducible production of biocompatible alginate. As shown here for alginates extracted from freshly collected algal stipes, the current assays used for validation of the quality of the alginate are not sufficient to screen for impurities arising from spores of gram-positive bacteria (and related contaminants). To assess the quality of alginate, we have developed a cell assay based on the induction of apoptosis in Jurkat cells. This assay allows in combination with the "modified mixed lymphocyte" assay a rapid and sensitive screening for any fibrosis-inducing impurities in alginate samples (even during the purification regime) as demonstrated by transplantation experiments performed in parallel with BB rats (exhibiting an elevated macrophage activity). The results clearly demonstrate that the quality of the input algal material is of key relevance for the production of transplantation-grade alginate.

Myocardial protection with preconditioning.

Myocardial preconditioning with brief coronary artery occlusions before a sustained ischemic period is reported to reduce infarct size. To determine the number of occlusive episodes required to produce the preconditioning effect, we performed single or multiple occlusions of the left circumflex coronary artery (LCx) followed by a sustained occlusion (60 minutes) of the LCx. Anesthetized dogs underwent one (P1), six (P6), or 12 (P12) 5-minute occlusions of the LCx. Each occlusion period was followed by a 10-minute reperfusion period. A 60-minute occlusion of the LCx followed the preconditioning sequences. A control group received a 60-minute occlusion of the LCx without preconditioning. All groups were subjected to 6 hours of reperfusion after which the heart was removed for calculating infarct size (IS), area at risk (AR), and left ventricular mass (LV). The IS/AR ratio for the control group was 29.8 +/- 4.4% (n = 17), which was substantially greater (p less than 0.001) than that of the preconditioned groups: P1, 3.9 +/- 1.3% (n = 14); P6, 0.4 +/- 0.3% (n = 5); and P12, 2.9 +/- 2.8% (n = 5). There were no significant differences in the IS/AR ratio among the three preconditioned groups. The AR/LV ratio was comparable among all groups and did not differ statistically: control, 40.4 +/- 1.3%; P1, 36.2 +/- 1.7%; P6, 36.1 +/- 1.7%; and P12, 37.3 +/- 2.1%. Collateral blood flow to the inner two thirds of the risk region determined with radiolabeled microspheres during ischemia did not differ significantly between the control group (0.03 +/- 0.01 ml/min/g, n = 8) and single occlusion group (0.06 +/- 0.02 ml/min/g, n = 8), indicating that the marked disparity in infarct size could not be attributed to differences in collateral blood flow. The data indicate that preconditioning with one brief ischemic interval is as effective as preconditioning with multiple ischemic periods.

Radiofrequency hyperthermia and topical retinoic acid therapy in murine melanoma.

Malignant cells are known to be sensitive to increased temperature. The effects of hyperthermia (HT) on intradermally implanted S91 melanoma cells in syngeneic mice were investigated with a hand-held radiofrequency generator. The possible additive effects of topical retinoic acid (RA) in this system also were studied. Five millimeter diameter melanomas were treated with either HT alone, RA alone, or a combination of HT and RA and were then evaluated after 43 days and 59 days. Eighteen of 20 tumors treated with HT alone and all 20 melanomas treated with HT/RA were eradicated. RA alone caused complete regression in 11 of 19 treated tumors. It is concluded that radiofrequency HT is an effective treatment in intradermal murine melanoma and that the addition of RA does not significantly alter the outcome because of the extreme effectiveness of HT alone.

[Responsible paternity against abortion]. / Paternidad responsable contra aborto.

PIP: Family planning programs were implemented in Mexico in 1973; since then the number of family planning acceptors has grown considerably; however, the number of illegal abortions has also been on the increase. Such phenomenon has been noticed in other countries under the same circumstances, notably Korea, India, and Chile. Women in large urban areas tend to abandon family planning programs for lack of specific information and of adequate and specialized attention. In 1977 in the state of Puebla 32.6% of the total number of pregnancies were terminated in abortion, often induced with primitive and unsanitary methods. It is essential to educate young and very young people on the idea of responsible paternity, and to offer them adequate sex education in schools and outside schools. The general physician can play a very important role in advising these people and in spreading the principle of family planning.^ieng

[Vasectomy]. / Vasectomia.

PIP: Selection of vasectomy patients must be done very conscientiously; only emotionally mature people should be selected, with stable marriages, and 2-3 children over 6. Written authorization from both spouses is indispensable, at least in Mexico. Operative procedures are simple and safe, and can be performed under local anesthesia; a 1-day rest is advisable. Complications include infection, epididymitis and granuloma; such occurrences, however, are extremely rare and easily treatable.^ieng