Detection of Pathogens Associated with Psyllids and Leafhoppers in Capsicum annuum L. in the Mexican States of Durango, Zacatecas, and Michoacán.

In fall 2014, 5 to 75% percent of chili and bell pepper (Capsicum annuum L.) in commercial fields located in the Mexican states of Durango, Zacatecas, and Michoacán had symptoms of deformed, small, mosaic, curled, and chlorotic leaves; shortened internodes; plant dwarfing; or phyllody and rosetting leaf tips. At the same time, leafhoppers and psyllids were observed in the fields, and more than 50 beet leafhoppers (Circulifer tenellus) and nearly 300 potato psyllids (Bactericera cockerelli) were collected from the pepper plants and adjacent weeds. Based on the insect pressure and observed symptoms, nearly 400 pepper samples were collected across this region of Mexico and tested for the presence of leafhopper- and psyllid-associated pathogens. In all, 76% of the pepper samples were found to be infected with 'Candidatus Liberibacter solanacearum', beet leafhopper-transmitted virescence agent (BLTVA) phytoplasma, a strain of a curtovirus, or a combination of any two or three of these pathogens. Additionally, 77% of the collected leafhoppers and 40% of the psyllids were infected with one or more of these pathogens, in addition to Spiroplasma citri. Specifically, the leafhoppers were infected with BLTVA phytoplasma, S. citri, or a strain of curtovirus. Of particular interest, potato psyllids were not only infected with 'Ca. L. solanacearum' but also with phytoplasmas that belong to the groups 16SrVI subgroup A and 16SrI subgroup A. The presence of mixed infections in pepper plants and the insect vectors highlights the need for growers to effectively control both leafhoppers and potato psyllids from solanaceous crops in this region of Mexico in order to prevent the spread of these bacterial and viral pathogens.

First Report of Beet mild curly top virus in Dry Bean in Zacatecas, Mexico.

In August 2009, yellowing, upward curling of leaves, and stunted growth were observed on 15 to 40% of dry bean (Phaseolus vulgaris cv. Aluvori) plants in each of several experimental fields in Zacatecas, Mexico. Symptoms and presence of the beet leafhopper (Circulifer tenellus) in affected fields suggested an infection by curtoviruses (Geminiviridae). Total DNA extracts from 18 plant samples exhibiting symptoms were obtained by a modified Dellaporta method (2) and subjected to PCR analysis using two pairs of new, degenerate primers specific for curtoviruses: RepQEW-for (CCRAARTAAGMATCRGCCCAYTCTTG) in combination with CP450-rev (GTCCTCGAGTAGACGGCATAGCCTGACC) and V2Gen910-for (ATGTCGACGAAGCATTTGAAGTTTGATATGGC) with Rep2GQ-rev (GAAGATCTGCWCGMGGAGGYCARCAGACGGCT). This double set of primers was used to amplify two overlapping DNA segments encompassing the complete curtovirus genome. All samples produced amplicons of the expected size (1.75 and 1.8 kb, respectively) that were cloned into pGEM-T Easy Vector (Promega, Madison, WI). Restriction fragment length polymorphism analysis of PCR clones with EcoRI and HinfI endonucleases suggested the presence of a single curtovirus species because only one restriction fragment pattern was observed in all cases. Viral amplicons from three plants were sequenced, and the overlapping DNA fragments were subsequently assembled into a complete genome sequence. Comparison of the virus sequence (Accession No. HQ634913) with sequences of all curtovirus isolates available in GenBank showed that it shared the highest nucleotide identity (98%) with Beet mild curly top virus-Mexico SLP1 from pepper (BMCTV-MX [SLP1]; Accession No. EU586260). Amino acid sequence identity of the seven predicted proteins (Rep, TrAP, REn, C4, V1, V2, and V3) encoded by the virus isolated from bean plants shared 98.0, 97.3, 98.5, 98.8, 100, 99.2, and 97.8% sequence identity, respectively, with the homologous proteins of BMCTV-MX [SLP1]. A BMCTV isolate from pepper collected in Zacatecas in 2007 (Accession No. EU586260) with 96% nucleotide sequence identity to the curtovirus identified in bean induced symptoms in P. vulgaris cv. Topcrop similar to those observed in bean in Zacatecas (1). To determine the presence of curtoviruses in the local populations of insect vectors, beet leafhoppers were collected in one of the sampled dry bean fields and total DNA was isolated from a pool of approximately 20 insects. Amplification of viral DNA with the degenerate primers RepQEW-for and CP450-rev and further sequencing of the PCR products confirmed the presence of a curtovirus DNA sharing almost identical nucleotide identity (99%) with the DNA isolated from bean plants. In 2011, symptoms similar to those observed in bean in 2009 occurred in approximately 30% of dry bean plants, suggesting that BMCTV is endemic in the Zacatecas Region. To our knowledge, this is the first report of BMCTV in legumes in Mexico. References: (1) L. F. Chen et al. Arch. Virol. 156:547, 2011. (2) S. L. Dellaporta et al. Plant Mol. Biol. Rep. 1:19, 1983.

First Report of Beet mild curly top virus Infection of Chile Pepper in North-Central Mexico.

During the 2005 growing season, widespread virus-like symptoms were observed in pepper (Capsicum annuum) fields in north-central Mexico. Early in the season, plants were chlorotic and stunted with thickened, elongated leaves. From mid to late season, the affected plants showed severe yellowing, upwardly rolled, small leaves, and a few deformed fruits. Symptoms were similar to those described for curtoviruses in pepper (1). The leafhopper vector of curtoviruses, Circulifer tenellus, was first reported in the area in 1953 (3) (its presence was confirmed again in January 2008). Pepper fields were sampled in the states of Aguascalientes and Zacatecas, and five symptomatic plants from Zacatecas tested positive for the presence of curtoviruses by PCR using primers to the coat protein (CP) coding region (2). PCR amplicons from three samples of Ancho and Mirasol pepper types from Zacatecas, which also tested positive by PCR using the rep coding region (2), were sequenced and compared with reported curtoviruses. The samples showed 91% identity with the CP coding region and 93% identity with the rep coding region of Beet mild curly top virus (formerly the Worland strain). A survey of pepper fields from Aguascalientes and Zacatecas based on symptomatic plants was conducted from July to August of 2005. Forty-three fields of different types of pepper, including those growing under mulch and drip irrigation, were surveyed. Twenty-five plants in each of five contiguous rows were inspected for the symptoms described above. Disease symptoms were noted in Mirasol, Ancho, Pasilla, and Guajillo pepper types, and the average disease incidence was 9.87% (range: 1.6 to 48%), 15.2% (range: 6.4 to 25.6%), 7.85% (range: 2.4 to 15.2%), and 20.8% (range: 8 to 33.6%), respectively. To our knowledge, this is the first report of curtovirus infection of chile pepper in this region of Mexico. The moderate level of curtovirus infection found here suggests the need to initiate management strategies for this disease. References: (1) L. L. Black et al. Page 98 in: Pepper Diseases. A Field Guide. AVRDC, Taiwan, 1991. (2) R. Creamer et al. Plant Dis. 89:480, 2005. (3) D. A. Young and N. W. Frazier. Hilgardia 23:25, 1954.

Geographic and Host Range of Meloidogyne spp. in North Central Mexico.

A disease survey carried out in 1998, 1999, and 2000 in the states of Aguascalientes, San Luis Potosí, and Zacatecas revealed the dispersal of Meloidogyne spp in this region of Mexico. Pepper (Capsicum annuum L.) Mirasol type plants showing general chlorosis, root rot, and galls were observed in central Zacatecas and western San Luis Potosí. Dry bean (Phaseolus vulgaris L.) plants (Landrace Flor de Mayo) collected in western San Luis Potosí and Aguascalientes also showed root galls. Roots of squash (Cucurbita spp) and sunflower (Helianthus annuus L.) plants that showed galled roots were found under dryland conditions in northern Zacatecas. Nursery peach (Prunus persica L.) plantlets with no foliar symptoms but showing severe root galling were detected in Zacatecas. Perineal patterns of Meloidogyne females obtained from those galled roots were coincident with those of M. incognita according to pictoral keys (1). This is the first report of M. incognita affecting these hosts in that region of the country. Alfalfa (Medicago sativa) plants collected in Aguascalientes showed galls caused by Meloidogyne spp; this is the first report of this nematode affecting alfalfa in the state. Volunteer onion (Allium cepa L., 'Grano Blanco') plants growing in a squash field in eastern Zacatecas had galled roots; a few Meloidogyne spp. females were obtained from small galls. This is the first report of the root-knot nematode affecting onion plants in north central México. Onion is known to be a host for several species of this nematode (2). Stunted, chlorotic squash plants had roots severely galled by Meloidogyne spp, but pepper crops growing in the same field in previous years showed general chlorosis, reduced size, and poor yield did not have root galls. References: (1) Eisenback, J. D., et al. 1983. Guia para la identificación de las cuatro especiales más comunes del nematodo agallador (Meloidogyne spp.) con una clave pictorica. International Meloidogyne Project, Raleigh, NC. (2) Schwartz, H. F., and Mohan, S. K. 1995. Compendium of onion and garlic diseases. American Phytopathological Society. St. Paul. MN.

First Report of Powdery Mildew of Pepper in North-Central Mexico.

Pepper plants showing general yellowing and white spots on the lower surface as well as brown spots on the upper surface of the lowest leaves were observed during the 1998 crop season in the states of Chihuahua, Zacatecas, and Aguascalientes (north central area of México). Light defoliation was observed. Samples were collected in Chihuahua and Zacatecas to identify the pathogen, which showed navicular conidia. A conidial suspension was sprayed on pepper varieties, but only Hungarian Yellow Wax showed powdery mildew lesions. The average size of the conidia from Zacatecas was 61.2 × 18.2 µm while those from Chihuahua measured 58.2 × 17.6 µm, which is coincident with the description given for an Oidiopsis sp. The perfect stage is Leveillula taurica (1). Cleistothecia were not observed. In Zacatecas the disease was not detected in tomato fields or in sowthistle (Sonchus oleraceae) plants contiguous to, or within, infected pepper fields. Powdery mildew incidence ranged from 35 to 80% in Ancho type and from 0 to 55% in Mirasol type pepper fields in Zacatecas. The number of powdery mildew lesions per leaf in most cases varied from 1 to 3. Incidence was higher in fields where the canopy was closed and warmer and wetter conditions may have allowed the disease to progress. Reference: (1) J. B. Jones et al. 1991. Compendium of Tomato Diseases. American Phytopathological Society, St. Paul, MN.

Spread of Ergot of Sorghum (Claviceps africana) in Central Mexico.

By late August 1997, sorghum ergot (Claviceps africana Frederickson, Mantle & De Milliano) had not been detected in the Bajio area in central Mexico, the second-largest sorghum (Sorghum bicolor (L.) Moench) producing area in the country, despite earlier 1997 reports of the disease in the adjacent states of San Luis Potosi, Michoacan, and Jalisco. A mid-September survey was conducted in el Bajio, primarily in the state of Guanajuato, and adjacent areas in the states of Michoacan and Jalisco. Infected sorghum heads showing ergot symptoms of honeydew and white secondary sporulation were observed in commercial grain and hybrid seed fields in all three states. Environmental conditions, late summer rains and early low temperatures promoting abundant dew, as well as extended periods of sorghum blooming, contributed to a low and delayed incidence of ergot in Guanajuato. In Michoacan and Jalisco the higher relative humidity and rainfall (around 750 ml) probably contributed to the observed epidemic of ergot. Johnsongrass (Sorghum halepense (L.) Pers.) florets also showed ergot symptoms. Macroconidia in honeydew were hyaline, oblong to oval, slightly constricted at the center, with an average size of 15 × 7 µm, agreeing with the given description of Sphacelia sorghi McRae (2), the anamorph stage of C. africana. No sclerotia were found on any host. Ergot control in this region of Mexico is being attempted by chemical means and burning of heads, even in commercial fields with minimal incidence of ergot. This report of ergot spread complements an earlier note describing the initial detection of the disease in Tamaulipas, the largest sorghum-producing state in Mexico (1). References: (1) J. Aguirre R. et al. Plant Dis. 81:831, 1997. (2) D. E. Frederickson et al. Mycol. Res. 95:1101, 1991.

Pathogenicity of Fusarium oxysporum f. sp. phaseoli Isolates from Spain to Phaseolus vulgaris.

Fusarium oxysporum Schechtend.:Fr. f. sp. phaseoli J. B. Kendrick & W. C. Snyder (FOP) is the causal agent of the common bean (Phaseolus vulgaris L.) disease known as Fusarium wilt or Fusarium yellows. FOP has been reported from the Castilla y Leon region in Spain, where it is a serious problem on most commercial bean cultivars (1). Five FOP isolates from Spain (AB-6, AB-111, AB-112, AS-1, and AS-4) obtained from J. M. Díaz-Mínguez and the isolate FOP-CO1 (ATCC 90245) from Colorado were tested for pathogenicity on two American lines: Pinto U.I. 114, considered as a universal susceptible check, and Flor de Mayo, a Mexican landrace. Seedlings were root-clip inoculated and evaluated according to the CIAT 1 to 9 severity scale, in which 1 to 3 = resistant, 3.1 to 6 = intermediate, and 6.1 to 9 = susceptible. Three inoculum concentrations were tested: 104, 105, and 106 conidia/ml. AS-1 and AS-4 produced resistant reactions in both U.I. 114 (1.5 to 2.1 and 1.2 to 1.5) and Flor de Mayo (1.9 to 2.3 and 1.4), respectively, at all inoculum concentrations. Susceptible reactions to AB-6 (7.3 to 8.9), AB-111 (7.6 to 8.9), AB-112 (7.5 to 7.9), and FOP-CO1 (8.1 to 8.6) were observed in Pinto U.I. 114, regardless of inoculum concentration, although severity ratings increased as the inoculum concentration was increased. Flor de Mayo exhibited a susceptible reaction (6.7 to 7.8) to FOP-CO1 at all inoculum concentrations tested, and intermediate reactions to AB-6 (4.9), AB-111 (5.4), and AB-112 (5.0) at the lowest inoculum concentration. Susceptible reactions (7 to 8.2 for AB-6; 6.8 to 7.0 for AB-111, and 7.3 to 7.7 for AB-112) occurred with higher inoculum concentrations, and severity ratings increased as the inoculum concentration increased. Recently, FOP isolates from Greece and Italy were recognized as each belonging to different pathogenic races (2); consequently, more research on the Spanish isolates (AB-6, AB-111, and AB-112) is needed to determine if they are similar to the races reported from the Mediterranean Basin or should be classified as a new FOP race (s). References: (1) J. M. Díaz-Mínguez et al. Plant Dis. 80:600, 1996. (2) S. L. Woo et al. Phytopathology 86:966, 1996.