ABSTRACT
Severe infections associated with the use of strong immunosuppressive medication are a leading cause of morbidity and mortality in patients with ANCA vasculitis (AV). While guidelines conditionally recommend trimethoprim-sulfamethoxazole (TMP-SMX) prophylaxis for Pneumocystis jirovecii pneumonia in AV patients, robust evidence on prophylaxis strategies is lacking. This scoping review aimed to assess the existing evidence on infection prophylaxis in AV patients, identify knowledge gaps, and guide future study design. A comprehensive search of six databases and relevant references identified original studies in English from January 1, 2000, to July 31, 2020. Inclusion criteria encompassed studies evaluating the impact of any antimicrobial prophylaxis strategy on infection-related outcomes in AV patients receiving immunosuppressive treatment. Studies were screened by four researchers using a blinded approach. Data was extracted by two reviewers, with differences resolved via consensus in consultation with a third reviewer. Nineteen studies met inclusion criteria, including two randomized trials and 17 cohort studies, with TMP-SMX being the most commonly assessed prophylactic strategy. The studies varied in sample sizes, outcomes measured, prophylactic strategies employed, and proportion of patients who received the regimen. Most cohort studies included no or limited control of potential confounding factors. This scoping review suggests significant variation in AV patients' receipt of TMP-SMX and alternative infection prophylaxis approaches. Observational studies using large secondary healthcare databases with rigorous designs are needed to provide high-quality evidence of the real-world effectiveness of antimicrobial prophylactic regimens, to improve clinical decision-making and quality of care for AV patients receiving immunosuppressive treatment.
ABSTRACT
Clinical and laboratory correlates of chronic kidney disease (CKD) in sickle cell anaemia remain incompletely defined. In a multicenter cohort study, we evaluated the prevalence of persistent albuminuria (PA) and characteristics associated with PA, albumin-creatinine ratio (ACR) and decreased estimated glomerular filtration rate (eGFR) using logistic, linear and multinomial regression models, respectively. Of 269 participants (median age: 30 years; 57.2% females), the prevalence of PA was 35.7%. Using baseline ACR values of <100 and ≥100 mg/g, the probabilities of PA were 30.0% and 94.6%, respectively. In multivariable logistic regression analyses, male sex (ß = 0.80 [SE = 0.36], p = 0.024) and ACE inhibitors/ARBs use (ß = 1.54 [SE = 0.43], p < 0.001) were associated with higher likelihoods of PA, while higher haemoglobin (ß = -0.33 [SE = 0.13], p = 0.009) and HbF (ß = -0.04 [SE = 0.02], p = 0.041) were associated with lower likelihoods of PA. In multivariable multinomial regression analyses, older age (ß = 0.06 [SE = 0.02], p = 0.004) and higher alkaline phosphatase (ß = 0.01 [SE = 0.00], p = 0.004) were associated with higher odds of having eGFR 60-90 versus eGFR>90 mL/min/1.73 m2 using the cystatin C-based CKD-EPI-2012 equation. Additionally, higher systolic blood pressure (ß = 0.11 [SE = 0.03], p = 0.001) and blood urea nitrogen (ß = 0.45 [SE = 0.12], p < 0.001) were associated with higher odds, while higher haemoglobin (ß = -1.22 [SE = 0.43], p = 0.004) was associated with lower odds of having eGFR<60 versus eGFR>90 mL/min/1.73 m2. PA and decreased eGFR are associated with measures of disease severity and comorbid conditions (Clinicaltrials.gov Identifier: NCT03277547).
ABSTRACT
Mass spectrometry is broadly employed to study complex molecular mechanisms in various biological and environmental fields, enabling 'omics' research such as proteomics, metabolomics, and lipidomics. As study cohorts grow larger and more complex with dozens to hundreds of samples, the need for robust quality control (QC) measures through automated software tools becomes paramount to ensure the integrity, high quality, and validity of scientific conclusions from downstream analyses and minimize the waste of resources. Since existing QC tools are mostly dedicated to proteomics, automated solutions supporting metabolomics are needed. To address this need, we developed the software PeakQC, a tool for automated QC of MS data that is independent of omics molecular types (i.e., omics-agnostic). It allows automated extraction and inspection of peak metrics of precursor ions (e.g., errors in mass, retention time, arrival time) and supports various instrumentations and acquisition types, from infusion experiments or using liquid chromatography and/or ion mobility spectrometry front-end separations and with/without fragmentation spectra from data-dependent or independent acquisition analyses. Diagnostic plots for fragmentation spectra are also generated. Here, we describe and illustrate PeakQC's functionalities using different representative data sets, demonstrating its utility as a valuable tool for enhancing the quality and reliability of omics mass spectrometry analyses.
ABSTRACT
The role of stressors, insect bites, and infections on disease relapse of ANCA vasculitis has yet to be entirely explored, with limited retrospective studies focused on disease onset from small participant cohorts. Our study analyzes longitudinal survey data from 2011-2022 to evaluate this perspective from a large ANCA vasculitis cohort. We collected surveys every three to six months to obtain information on self-reported psychological stressors and significant life events, insect bites, and infections throughout clinical disease. We defined cohorts as those who relapsed (Relapse Cohort) and controls as those who did not relapse (Remission Cohort) during the study period. Survey responses were retrospectively reviewed during a 15-month timeframe prior to relapse or during 15 months of remission and categorized by type of stress event, insect bite, and infections at every available 3-month interval. There were no significant differences in stress and insect bites between the relapse and remission cohorts. Patients who relapsed reported more frequent upper respiratory infections and other infections, such as those affecting the skin and eyes, but there were no significant differences in the incidence of pulmonary or urinary infections compared to the remission cohort. There was a significant difference in reported upper respiratory infections 9 to 15 months prior to the relapse date, indicating a remote history of infections as a potentially significant physical stressor that may contribute to disease relapse. More frequent patient-reported infections, specifically upper respiratory infections, may contribute to patient vulnerability to relapse. Counseling and close monitoring of patients after infectious symptoms could aid in earlier detection of disease flares. Future studies are essential to further understand the importance of distal risk factors and how they impact relapse.
Subject(s)
Anemia, Sickle Cell , Sodium-Glucose Transporter 2 Inhibitors , Humans , Anemia, Sickle Cell/drug therapy , Sodium-Glucose Transporter 2 Inhibitors/therapeutic use , Adult , Male , Female , Middle Aged , Glucagon-Like Peptide 1/agonists , Hypoglycemic Agents/therapeutic use , Diabetes Mellitus, Type 2/drug therapy , Sodium-Glucose Transporter 2ABSTRACT
BACKGROUND: Hispanic/Latino individuals are less likely to receive optimal treatment for chronic kidney disease than non-Hispanic whites. This may be particularly detrimental for women of reproductive age as chronic kidney disease increases risk for infertility, menstrual irregularities, and pregnancy loss. While these maternal outcomes have been associated with advanced chronic kidney disease, their occurrence in early chronic kidney disease is unclear. OBJECTIVES/DESIGN: Using baseline (2008-2011) and second study visit (2014-2017) data from the Hispanic Community Health Study/Study of Latinos, we retrospectively assessed the prevalence of chronic kidney disease as well as the association between chronic kidney disease and self-reported infertility, cessation of menses, hysterectomy, and nonviable pregnancy loss (experienced at less than 24 weeks gestation) in women of reproductive age (18-45 years). METHODS: Multivariable survey logistic regression analyses determined the unadjusted and multivariable-adjusted prevalence odds ratios with 95% confidence intervals between chronic kidney disease and the separate outcomes. RESULTS: Among 2589 Hispanic/Latino women included (mean age = 31.4 years), 4.6% were considered to have chronic kidney disease. In adjusted analyses, women with chronic kidney disease did not have a significantly increased odds of infertility (odds ratio = 1.02, 95% confidence interval = 0.42-2.49), cessation of menses (odds ratio = 1.25, 95% confidence interval = 0.52-3.04), or hysterectomy (odds ratio = 1.17, 95% confidence interval = 0.61-2.25) compared to those without chronic kidney disease. In those with chronic kidney disease, the adjusted odds of a nonviable pregnancy loss occurring after baseline visit were increased (odds ratio = 2.11, 95% confidence interval = 0.63-7.02) but not statistically significance. CONCLUSION: The presence of early stage chronic kidney disease did not confer a significant risk of infertility, cessation of menses, or nonviable pregnancy loss.
The Hispanic Community Health Study/Study of Latinos is a population-based study of over 16,000 Hispanic/Latino individuals throughout the United States. Within this cohort, we assessed the prevalence of chronic kidney disease in women of reproductive age (1845 years old) and the associations between kidney disease and infertility, cessation of menses, and nonviable pregnancy loss (loss occurring before the 24th week of pregnancy). We found that kidney disease affected 1 in 20 women of reproductive age and those with kidney disease were more likely to have obesity, diabetes, and hypertension. Compared to those without kidney disease, the presence of kidney disease did not increase risk of infertility, cessation of menses, or nonviable pregnancy loss.
Subject(s)
Infertility , Renal Insufficiency, Chronic , Pregnancy , Humans , Female , Adult , Adolescent , Young Adult , Middle Aged , Risk Factors , Prevalence , Public Health , Retrospective Studies , Hispanic or Latino , Renal Insufficiency, Chronic/epidemiologyABSTRACT
Synthetic promoters may be designed using short cis-regulatory elements (CREs) and core promoter sequences for specific purposes. We identified novel conserved DNA motifs from the promoter sequences of leaf palisade and vascular cell type-specific expressed genes in water-deficit stressed poplar (Populus tremula × Populus alba), collected through low-input RNA-seq analysis using laser capture microdissection. Hexamerized sequences of four conserved 20-base motifs were inserted into each synthetic promoter construct. Two of these synthetic promoters (Syn2 and Syn3) induced GFP in transformed poplar mesophyll protoplasts incubated in 0.5 M mannitol solution. To identify effect of length and sequence from a valuable 20 base motif, 5' and 3' regions from a basic sequence (GTTAACTTCAGGGCCTGTGG) of Syn3 were hexamerized to generate two shorter synthetic promoters, Syn3-10b-1 (5': GTTAACTTCA) and Syn3-10b-2 (3': GGGCCTGTGG). These promoters' activities were compared with Syn3 in plants. Syn3 and Syn3-10b-1 were specifically induced in transient agroinfiltrated Nicotiana benthamiana leaves in water cessation for 3 days. In stable transgenic poplar, Syn3 presented as a constitutive promoter but had the highest activity in leaves. Syn3-10b-1 had stronger induction in green tissues under water-deficit stress conditions than mock control. Therefore, a synthetic promoter containing the 5' sequence of Syn3 endowed both tissue-specificity and water-deficit inducibility in transgenic poplar, whereas the 3' sequence did not. Consequently, we have added two new synthetic promoters to the poplar engineering toolkit: Syn3-10b-1, a green tissue-specific and water-deficit stress-induced promoter, and Syn3, a green tissue-preferential constitutive promoter.
Subject(s)
Gene Expression Regulation, Plant , Plants, Genetically Modified , Populus , Promoter Regions, Genetic , Populus/genetics , Populus/metabolism , Promoter Regions, Genetic/genetics , Plants, Genetically Modified/genetics , Dehydration/genetics , Stress, Physiological/genetics , Organ Specificity/genetics , Plant Leaves/genetics , Plant Leaves/metabolismABSTRACT
RATIONALE & OBJECTIVE: Kidney transplant patients with glomerulonephritis (GN) as their native disease commonly have received pretransplant immunosuppression (PTI). This may contribute to the immunosuppression burden potentially increasing the risk for infections after transplantation. STUDY DESIGN: Single-center, retrospective cohort study. SETTING & PARTICIPANTS: Recipients of a kidney transplant from January 2005 until May 2020 at a tertiary care university teaching hospital. EXPOSURE: Patients with GN as their native kidney disease who received PTI for treatment of GN (n=184) were compared with nondiabetic recipients of kidney transplants who did not receive PTI (n = 579). OUTCOME: First occurrence after transplantation of an infection outcome, either viral (BK or cytomegalovirus [CMV] infection) or bacterial. ANALYTICAL APPROACH: Cox regression analysis adjusted for age at transplant, sex, race, donor type, year of transplant surgery, dialysis vintage, receipt of T-cell depleting induction, and CMV transplant status. RESULTS: Over a median follow-up period of 5.7 years, patients with GN PTI were not at an increased risk for developing any first viral infection compared with controls (adjusted HR [AHR] 0.69 [95% CI, 0.52-0.91]) nor at increased risk for specific viral infections: BK infection 19.6% vs 26.3% (AHR 0.72 [95% CI, 0.50-1.05]) or CMV infection, 24.5% vs 29.0% (AHR, 0.76 [95% CI, 0.54-1.07]), respectively. There was also no increased risk of developing a first bacterial infection: 54.5% vs 57.5% (AHR, 0.90 [95% CI, 0.71-1.13]). These findings of no increased risk for infection were independent of the type of PTI used (cyclophosphamide, rituximab, mycophenolate mofetil, or calcineurin inhibitor) or the type of T-cell depleting induction therapy (alemtuzumab or antithymocyte globulin) administered. LIMITATIONS: Single-center study, no data on methylprednisone use for PTI, unmeasured confounding. CONCLUSIONS: Use of PTI for the treatment of GN was not associated with an increased risk of viral (BK or CMV) or bacterial infection after transplantation. Additional surveillance for infection after transplantation for patients who received PTI may not be necessary. PLAIN-LANGUAGE SUMMARY: Many kidney transplant patients have glomerular disease as the cause of kidney failure. These patients may be exposed to immunosuppression before transplantation, which could increase the risk for infections after receipt of a transplanted kidney. We identified kidney transplant recipients at a university teaching hospital who received immunosuppression before transplant for the treatment of glomerular kidney disease. We examined their risk for infection after transplantation by comparing it with the risk among transplant patients who were not exposed to immunosuppression before transplant. We observed no increased risk for infection after exposure to prior immunosuppression. Therefore, patients exposed to significant amounts of immunosuppression before transplantation may not require special surveillance or medication adjustment for fear of infection after their receipt of a kidney transplant.
Subject(s)
Glomerulonephritis , Immunosuppressive Agents , Kidney Transplantation , Humans , Kidney Transplantation/adverse effects , Male , Female , Glomerulonephritis/epidemiology , Glomerulonephritis/etiology , Retrospective Studies , Middle Aged , Immunosuppressive Agents/adverse effects , Immunosuppressive Agents/therapeutic use , Adult , Cytomegalovirus Infections/epidemiology , Cytomegalovirus Infections/etiology , Cytomegalovirus Infections/immunology , Immunosuppression Therapy/adverse effects , Immunosuppression Therapy/methods , Bacterial Infections/epidemiology , Bacterial Infections/etiology , Postoperative Complications/epidemiology , Postoperative Complications/etiologyABSTRACT
Importance: The incidence of pregnancy-related acute kidney injury is increasing and is associated with significant maternal morbidity including progression to end-stage kidney disease (ESKD). Little is known about characteristics and long-term outcomes of patients who develop pregnancy-related ESKD. Objectives: To examine the characteristics and clinical outcomes of patients with pregnancy-related ESKD and to investigate associations between pre-ESKD nephrology care and outcomes. Design, Setting, and Participants: This was a cohort study of 183â¯640 reproductive-aged women with incident ESKD between January 1, 2000, and November 20, 2020, from the US Renal Data System and maternal data from births captured in the US Centers for Disease Control and Prevention publicly available natality data. Data were analyzed from December 2022 to June 2023. Exposure: Pregnancy-related primary cause of ESKD, per International Classification of Diseases, Ninth Revision (ICD-9) and ICD-10 codes reported at ESKD onset by the primary nephrologist on Centers for Medicare and Medicaid Services form 2728. Main Outcomes Measures: Multivariable Cox proportional hazards and competing risk models were constructed to examine time to (1) mortality, (2) access to kidney transplant (joining the waiting list or receiving a live donor transplant), and (3) receipt of transplant after joining the waitlist. Results: A total of 341 patients with a pregnancy-related primary cause of ESKD were identified (mean [SD] age 30.2 [7.3]). Compared with the general US birthing population, Black patients were overrepresented among those with pregnancy-related ESKD (109 patients [31.9%] vs 585â¯268 patients [16.2%]). In adjusted analyses, patients with pregnancy-related ESKD had similar or lower hazards of mortality compared with those with glomerulonephritis or cystic kidney disease (adjusted hazard ratio [aHR], 0.96; 95% CI, 0.76-1.19), diabetes or hypertension (aHR, 0.49; 95% CI, 0.39-0.61), or other or unknown primary causes of ESKD (aHR, 0.60; 95% CI, 0.48-0.75). Despite this, patients with pregnancy-related ESKD had significantly lower access to kidney transplant compared with those with other causes of ESKD, including (1) glomerulonephritis or cystic kidney disease (adjusted subhazard ratio [aSHR], 0.51; 95% CI, 0.43-0.66), (2) diabetes or hypertension (aSHR, 0.81; 95% CI, 0.67-0.98), and (3) other or unkown cause (aSHR, 0.82; 95% CI, 0.67-0.99). Those with pregnancy-related ESKD were less likely to have nephrology care or have a graft or arteriovenous fistula placed before ESKD onset (nephrology care: adjusted relative risk [aRR], 0.47; 95% CI, 0.40-0.56; graft or arteriovenous fistula placed: aRR, 0.31; 95% CI, 0.17-0.57). Conclusion and Relevance: In this study, those with pregnancy-related ESKD had reduced access to transplant and nephrology care, which could exacerbate existing disparities in a disproportionately Black population. Increased access to care could improve quality of life and health outcomes among these young adults with high potential for long-term survival.
Subject(s)
Arteriovenous Fistula , Diabetes Mellitus , Glomerulonephritis , Hypertension , Kidney Diseases, Cystic , Kidney Failure, Chronic , Pregnancy , Young Adult , Humans , Aged , Female , United States/epidemiology , Adult , Cohort Studies , Quality of Life , Medicare , Kidney Failure, Chronic/epidemiology , Kidney Failure, Chronic/etiology , Kidney Failure, Chronic/therapy , Hypertension/complications , Kidney Diseases, Cystic/complications , Arteriovenous Fistula/complicationsABSTRACT
BACKGROUND: Autoantibody detection is a promising approach to cancer screening. Serum p53 antibodies have been time tested in various cancers, including oral squamous cell carcinoma (OSCC). This study is aimed to detect and determine the level of p53 autoantibodies (p53-AAbs) in saliva. The association of clinicopathological features among patients with and without OSCC was also explored as a novel method for the detection of autoantibodies. METHODS: One hundred preoperative saliva samples from patients with histologically confirmed OSCC and a hundred from normal healthy individuals were collected. Anti p53 detection kit assessed levels of salivary p53-AAbs. The cut-off value was 1.3 U/mL by Enzyme-linked immunosorbent assay (ELISA). The p53-AAb levels were expressed in terms of the median and interquartile range (IQR). Fischer's exact test and Chi-square test were used to determine the association with clinicopathological features among patients with OSCC and healthy controls with tobacco consumption habits. RESULTS: Median level of p53-AAb is 0.234 U/mL (IQR 0.18-0.37U/mL) in healthy controls and 0.285U/mL (IQR 0.16-0.58U/mL) in OSCC. p53-AAbs was positive in 15% of 100 patients with OSCC, which was statistically higher ( P < 0.001) among OSCC, and controls were negative for p53-AAb. No significant correlation of p53-AAbs with the patient's age, gender, site, clinical staging (TNM), and pathologic grade was observed. However, a significant association was seen between the node involvement and salivary p53-AAbs. CONCLUSION: Salivary p53-AAb positivity was seen in a higher proportion in OSCC patients than in healthy controls with tobacco consumption, and the levels did differ significantly among OSCC and healthy controls.
ABSTRACT
Introduction Technical faults are no longer accepted as the sole reason for recurrence following inguinal hernia (InH) repairs. Medical literature has been studied to find any contributing factors and collagen has emerged as a promising marker. Owing to their long half-lives, it has been found to best reflect the process of scarring, which is central to ensuring the formation of a proper fibrous tissue that incorporates the mesh with the abdominal wall. Methods Sixty participants were divided into two groups. The case group were patients diagnosed with InH and the control group had patients undergoing abdominal surgeries for indications other than abdominal wall hernias. A 0.5x0.5cm specimen of skin and transversalis fascia were biopsied and subsequently stained to determine the amount of collagen I and III. Results Collagen I, collagen III and the ratio of collagen I to III was measured. Collagen I was normal in the skin of both groups but decreased in transversalis fascia of cases. Collagen III was found to be normal in transversalis fascia of both cases and controls, but increased in the skin of cases. Ratio of collagen I to III was decreased in both skin and transversalis fascia of cases. Statistical analysis was carried out using an unpaired t-test, non-parametric Mann-Whitney test, ANOVA and chi-square test. Conclusions Our study has reported that in patients with inguinal hernia, collagen III or immature collagen is increased in skin and collagen I or mature collagen is decreased in the transversalis fascia. The ratio of collagen I/III is decreased in both skin and transversalis fascia.
ABSTRACT
Following vaccination with adenoviral vector-based ChAdOx1 nCoV-19, serious neurological adverse events have been reported. Here we report two cases who presented with quadriparesis following the adenoviral vector-based ChAdOx1 nCoV-19 vaccine. A 55-year-old male patient presented with quadriparesis after 8 days of the second dose of ChAdOx1 nCoV-19 vaccination. Imaging showed features of stroke with right basilar artery thrombosis; he was started on anticoagulation following which the patient's neurological status improved and he was discharged during the 7th week of hospital stay. A 19-year-old male patient presented with quadriparesis after 16 days of the first dose of ChAdOx1 nCoV-19 vaccination. Cerebral spinal fluid and nerve conduction study was suggestive of Guillain-Barre syndrome (GBS). Two doses of intravenous immunoglobulin were given, following which the patient's neurological status improved and he was discharged in the 11th week of his hospital stay. Awareness of neurological adverse effects and emphasis on the underlying mechanism of vaccine-induced thrombotic thrombocytopenia (VITT) and molecular mimicry in patients presenting with quadriparesis following ChAdOx1 nCoV-19 vaccination is important.
ABSTRACT
BACKGROUND: Treatment requirements of antineutrophil cytoplasmic autoantibody vasculitis (AV) and high comorbidity burden among patients with AV may lead to higher potential for polypharmacy and its associated adverse outcomes, including adverse drug events, nonadherence, drug-drug interactions, and higher costs. Medication burden and risk factors associated with polypharmacy in patients with AV have not been well-characterized. OBJECTIVE: To characterize medication burden and examine prevalence of and risk factors for polypharmacy in the first year after diagnosis with AV. METHODS: We conducted a retrospective cohort study using 2015-2017 Medicare claims to identify incident cases of AV. We counted the number of unique generic products dispensed to patients in each of the 4 quarters after diagnosis and categorized medication count as high (≥10 medications), moderate (5-9 medications), or minimal or no polypharmacy (<5 medications). We used multinomial logistic regression to examine associations of predisposing, enabling, and medical need factors with having high or moderate polypharmacy. RESULTS: In 1,239 Medicare beneficiaries with AV, high or moderate polypharmacy was most common in the first quarter after diagnosis (83.7%), with 43.2% taking 5 - 9 medications and 40.5% taking at least 10. The odds of high polypharmacy were greater in all quarters for patients with eosinophilic granulomatosis with polyangiitis compared with granulomatosis with polyangiitis, ranging from 2.02 (95% CI = 1.18 - 3.46) in the third quarter to 2.96 (95% CI = 1.64-5.33) in the second quarter. Older age, diabetes, chronic kidney disease, obesity, a higher Charlson Comorbidity Index score, coverage with Medicaid/Part D low-income subsidy, and living in areas with low education or persistent poverty were risk factors for high or moderate polypharmacy. CONCLUSIONS: Medicare beneficiaries with newly diagnosed AV experienced a high medication burden, with more than 40% taking at least 10 medications and the highest rates among those with eosinophilic granulomatosis with polyangiitis. Patients with AV may benefit from medication therapy management interventions to manage complex drug regimens and reduce risks associated with polypharmacy. DISCLOSURES: Dr Derebail receives personal fees from Travere Therapeutics, Pfizer, Bayer, Forma Therapeutics, UpToDate, outside of the submitted work. The content is solely the responsibility of the authors and does not represent the official views of the National Institutes of Health or the Department of Veterans Affairs. Dr Thorpe receives royalties from SAGE Publishing for activities unrelated to the submitted work. This research is supported by internal funds from the University of North Carolina, as well as the National Institute of Allergy and Infectious Diseases of the National Institutes of Health under award number R21AI160606 (PI: C. Thorpe).
Subject(s)
Churg-Strauss Syndrome , Granulomatosis with Polyangiitis , Humans , Aged , United States/epidemiology , Medicare , Antibodies, Antineutrophil Cytoplasmic , Retrospective StudiesABSTRACT
The study covers the concepts involved in reverse supply chain modeling using the case of a manufacturing company. The purpose of this study is to build a sustainable reverse supply chain model for resource conservation through remanufacturing of stator shafts by using a discrete-event simulation approach. The simulation studies in the reverse supply chain have taken up cases of either plastic or electronic waste remanufacturing, while very limited studies deal with simulation of sustainable reverse supply chains using a manufacturing industry case study from international customers. In this study, reverse supply chain using simulation study in manufacturing sector is carried out using Arena Rockwell simulation software. The simulation model is built using discrete-event simulation for returns from customers of two developed countries, i.e., Germany and the USA to Chennai, India. The study emphasizes full container load and less than container load modes of shipment scenarios and multiple return cases. The comparative analysis suggests that the value-added and non-value-added time of the reverse supply chain is slightly greater in the less container load scenario. The wait time per entity in remanufacturing processes similar for both shipment scenarios varies significantly based on return cases. The cost and carbon emission associated with transportation, in the reverse supply chain inclusive of social carbon cost, have also been estimated. Therefore, the study proposes a possible sustainable reverse supply chain framework that could be adopted by different manufacturing industries and yield opportunities for performance improvement.
ABSTRACT
The underlying mechanisms of disease in sickle cell disease (SCD) contribute to a multifaceted nephropathy, commonly manifested as albuminuria. In severe SCD genotypes ( e.g. , Hemoglobin SS [HbSS]), albuminuria and CKD are major predictors of mortality in this population. Therefore, the monitoring and management of renal function is an intrinsic part of comprehensive care in SCD. Management of nephropathy in SCD can be accomplished with SCD-directed therapies and/or CKD-directed therapies. In the past 5 years, novel disease-modifying and palliative therapies have been approved in SCD to target aspects of the disease, such as anemia, inflammation, and vasculopathy. Along with conventional hydroxyurea and chronic transfusion, l -glutamine, crizanlizumab, and voxelotor have all been shown to mitigate some adverse effect of SCD, and their effect on nephropathy is being investigated. CKD-directed therapies such as renin-angiotensin-aldosterone system blockers have long been used in SCD nephropathy; however, more complete long-term studies on benefits are needed. Given the effect of renal disease on survival, further assessment of the mechanisms and efficacy of these SCD-directed or CKD-directed therapeutic agents is essential.
Subject(s)
Anemia, Sickle Cell , Renal Insufficiency, Chronic , Vascular Diseases , Humans , Albuminuria/etiology , Anemia, Sickle Cell/complications , Anemia, Sickle Cell/drug therapy , Kidney/physiology , Hemoglobin, Sickle/therapeutic use , Renal Insufficiency, Chronic/therapyABSTRACT
Introduction: Preeclampsia increases the risk for future chronic kidney disease (CKD). Among those diagnosed with CKD, it is unclear whether a prior history of preeclampsia, or other complications in pregnancy, negatively impact kidney disease progression. In this longitudinal analysis, we assessed kidney disease progression among women with glomerular disease with and without a history of a complicated pregnancy. Methods: Adult women enrolled in the Cure Glomerulonephropathy study (CureGN) were classified based on a history of a complicated pregnancy (defined by presence of worsening kidney function, proteinuria, or blood pressure; or a diagnosis of preeclampsia, eclampsia, or hemolysis, elevated liver enzymes, and low platelets [HELLP] syndrome), pregnancy without these complications, or no pregnancy history at CureGN enrollment. Linear mixed models were used to assess estimated glomerular filtration rate (eGFR) trajectories and urine protein-to-creatinine ratios (UPCRs) from enrollment. Results: Over a median follow-up period of 36 months, the adjusted decline in eGFR was greater in women with a history of a complicated pregnancy compared to those with uncomplicated or no pregnancies (-1.96 [-2.67, -1.26] vs. -0.80 [-1.19, -0.42] and -0.64 [-1.17, -0.11] ml/min per 1.73 m2 per year, P = 0.007). Proteinuria did not differ significantly over time. Among those with a complicated pregnancy history, eGFR slope did not differ by timing of first complicated pregnancy relative to glomerular disease diagnosis. Conclusions: A history of complicated pregnancy was associated with greater eGFR decline in the years following glomerulonephropathy (GN) diagnosis. A detailed obstetric history may inform counseling regarding disease progression in women with glomerular disease. Continued research is necessary to better understand pathophysiologic mechanisms by which complicated pregnancies contribute to glomerular disease progression.
ABSTRACT
Japanese encephalitis virus (JEV) is the foremost cause of viral encephalitis in Southeast Asia and Australia leading to approximately 68 000 clinical cases and about 13 600-20 400 deaths annually. Vaccination is not completely sure and safe. Despite this, no specific antiviral has been available or approved for JEV infection yet and treatment is generally symptomatic. Therefore, this study aims to examine the antiviral activity of natural compounds against JEV proteins. The antiviral activity of natural compounds was investigated via molecular docking, cytopathic effect (CPE) inhibition assay, western blotting, and indirect immunofluorescence assay. Physiochemical, pharmacokinetics, and toxicity analysis were evaluated for the safety and efficacy of natural compounds. Network pharmacology-based approaches have been used to study the molecular mechanisms of drug-target interactions. Molecular docking results suggested that the NS5 protein of JEV is the major target for natural compounds. Network pharmacology-based analysis revealed that these drugs majorly target IL6, AKT1, tumor necrosis factor (TNF), and PTGS2 to regulate key immune and inflammatory pathways such as nuclear factor kappa B, PI3K-Akt, and TNF signaling, during JEV infection. Our in vitro results show that among the natural compounds, curcumin provides the highest protection against JEV infection via reducing the JEV-induced CPE (IC50 = 5.90 ± 0.44 µM/mL), and reduces the expression of NS5 protein, IL6, AKT1, TNF-α, and PTGS2. However, other natural compounds also provide protection to some extent but their efficacy is lower compared to curcumin. Therefore, this study shows that natural compounds, mainly curcumin, may offer novel therapeutic avenues for the treatment of JEV via inhibiting key viral proteins and regulating crucial host pathways involved in JEV replication.
Subject(s)
Curcumin , Encephalitis Virus, Japanese , Encephalitis, Japanese , Humans , Antiviral Agents/pharmacology , Antiviral Agents/therapeutic use , Cyclooxygenase 2/metabolism , Cyclooxygenase 2/pharmacology , Cyclooxygenase 2/therapeutic use , Molecular Docking Simulation , Curcumin/pharmacology , Curcumin/therapeutic use , Interleukin-6 , Phosphatidylinositol 3-Kinases/metabolism , Signal Transduction , Virus ReplicationABSTRACT
BACKGROUND: Tobacco exposure has been recognized as a risk factor for cardiovascular disease (CVD) and progression of kidney disease. Patients with proteinuric glomerulopathies are at increased risk for cardiovascular morbidity and mortality. Multiple studies have linked tobacco exposure to CVD and chronic kidney disease, but the relationships between smoking and proteinuric glomerulopathies in adults and children have not been previously explored. METHODS: Data from the Nephrotic Syndrome Study Network (NEPTUNE), a multi-center prospective observational study of participants with proteinuric glomerulopathies, was analyzed. 371 adults and 192 children enrolled in NEPTUNE were included in the analysis. Self-reported tobacco exposure was classified as non-smoker, active smoker, former smoker, or exclusive passive smoker. Baseline serum cotinine levels were measured in a sub-cohort of 178 participants. RESULTS: The prevalence of active smokers, former smokers and exclusive passive smoking among adults at baseline was 14.6%, 29.1% and 4.9%, respectively. Passive smoke exposure was 16.7% among children. Active smoking (reference non-smoking) was significantly associated with greater total cholesterol among adults (ß 17.91 95% CI 0.06, 35.76, p = 0.049) while passive smoking (reference non-smoking) was significantly associated with greater proteinuria over time among children (ß 1.23 95% CI 0.13, 2.33, p = 0.03). Higher cotinine levels were associated with higher baseline eGFR (r = 0.17, p = 0.03). CONCLUSION: Tobacco exposure is associated with greater risk for CVD and worse kidney disease outcomes in adults and children with proteinuric glomerulopathies. Preventive strategies to reduce tobacco exposure may help protect against future cardiovascular and kidney morbidity and mortality in patients with proteinuric glomerulopathies.
Subject(s)
Cardiovascular Diseases , Kidney Diseases , Tobacco Smoke Pollution , Humans , Adult , Child , Cohort Studies , Cotinine , Nicotiana , Tobacco Smoke Pollution/adverse effects , Neptune , Kidney Diseases/chemically inducedABSTRACT
A GWAS of patients with anti-neutrophil cytoplasmic antibodies (ANCAs) found an association between proteinase-3 ANCA (PR3-ANCA) and a single nucleotide polymorphism (rs62132293) upstream of PRTN3, encoding PR3. The variant (G allele) was shown to be an expression quantitative trait locus in healthy controls, but the clinical impact remains unknown. Longitudinally followed patients with ANCA and healthy controls were genotyped. Gene expression was quantified by real-time quantitative PCR from leukocyte RNA. Plasma PR3 was quantified by ELISA. Among patients, variant carriers had elevated leukocyte PRTN3 expression compared with noncarriers (C/G vs. C/C and G/G vs. C/C). Healthy controls had low PRTN3 regardless of genotype. Myeloperoxidase (MPO) expression did not differ by genotype. PRTN3 expression correlated with circulating PR3, and variant carriers had higher plasma PR3 compared with noncarriers. Among variant carriers, there was an increased risk of relapse in patients with PR3-ANCA versus MPO-ANCA. The risk allele marked by rs62132293 is clinically significant as it is associated with increased autoantigen and may, in part, explain increased relapse in PR3-ANCA. Our results underscore the role of autoantigen availability in ANCA vasculitis.