DNA i-motif formation at neutral pH is driven by kinetic partitioning.

Cytosine-rich DNA regions can form four-stranded structures based on hemi-protonated C.C+ pairs, called i-motifs (iMs). Using CD, UV absorption, NMR spectroscopy, and DSC calorimetry, we show that model (CnT3)3Cn (Cn) sequences adopt iM under neutral or slightly alkaline conditions for n > 3. However, the iMs are formed with long-lasting kinetics under these conditions and melt with significant hysteresis. Sequences with n > 6 melt in two or more separate steps, indicating the presence of different iM species, the proportion of which is dependent on temperature and incubation time. At ambient temperature, kinetically favored iMs of low stability are formed, most likely consisting of short C.C+ blocks. These species act as kinetic traps and prevent the assembly of thermodynamically favored, fully C.C+ paired iMs. A higher temperature is necessary to unfold the kinetic forms and enable their substitution by a slowly developing thermodynamic structure. This complicated kinetic partitioning process considerably slows down iM folding, making it much slower than the timeframes of biological reactions and, therefore, unlikely to have any biological relevance. Our data suggest kinetically driven iM species as more likely to be biologically relevant than thermodynamically most stable iM forms.

Guanine quadruplexes in the RNA genome of the tick-borne encephalitis virus: their role as a new antiviral target and in virus biology.

We have identified seven putative guanine quadruplexes (G4) in the RNA genome of tick-borne encephalitis virus (TBEV), a flavivirus causing thousands of human infections and numerous deaths every year. The formation of G4s was confirmed by biophysical methods on synthetic oligonucleotides derived from the predicted TBEV sequences. TBEV-5, located at the NS4b/NS5 boundary and conserved among all known flaviviruses, was tested along with its mutated variants for interactions with a panel of known G4 ligands, for the ability to affect RNA synthesis by the flaviviral RNA-dependent RNA polymerase (RdRp) and for effects on TBEV replication fitness in cells. G4-stabilizing TBEV-5 mutations strongly inhibited RdRp RNA synthesis and exhibited substantially reduced replication fitness, different plaque morphology and increased sensitivity to G4-binding ligands in cell-based systems. In contrast, strongly destabilizing TBEV-5 G4 mutations caused rapid reversion to the wild-type genotype. Our results suggest that there is a threshold of stability for G4 sequences in the TBEV genome, with any deviation resulting in either dramatic changes in viral phenotype or a rapid return to this optimal level of G4 stability. The data indicate that G4s are critical elements for efficient TBEV replication and are suitable targets to tackle TBEV infection.

Revealing structural peculiarities of homopurine GA repetition stuck by i-motif clip.

Non-canonical forms of nucleic acids represent challenging objects for both structure-determination and investigation of their potential role in living systems. In this work, we uncover a structure adopted by GA repetition locked in a parallel homoduplex by an i-motif. A series of DNA oligonucleotides comprising GAGA segment and C3 clip is analyzed by NMR and CD spectroscopies to understand the sequence-structure-stability relationships. We demonstrate how the relative position of the homopurine GAGA segment and the C3 clip as well as single-base mutations (guanine deamination and cytosine methylation) affect base pairing arrangement of purines, i-motif topology and overall stability. We focus on oligonucleotides C3GAGA and methylated GAGAC3 exhibiting the highest stability and structural uniformity which allowed determination of high-resolution structures further analyzed by unbiased molecular dynamics simulation. We describe sequence-specific supramolecular interactions on the junction between homoduplex and i-motif blocks that contribute to the overall stability of the structures. The results show that the distinct structural motifs can not only coexist in the tight neighborhood within the same molecule but even mutually support their formation. Our findings are expected to have general validity and could serve as guides in future structure and stability investigations of nucleic acids.

G-Quadruplex Formation by DNA Sequences Deficient in Guanines: Two Tetrad Parallel Quadruplexes Do Not Fold Intramolecularly.

Guanine quadruplexes (G4s) are noncanonical forms of nucleic acids that are frequently found in genomes. The stability of G4s depends, among other factors, on the number of G-tetrads. Three- or four-tetrad G4s and antiparallel two-tetrad G4s have been characterized experimentally; however, the existence of an intramolecular (i. e., not dimeric or multimeric) two-tetrad parallel-stranded DNA G4 has never been experimentally observed. Many sequences compatible with two-tetrad G4 can be found in important genomic regions, such as promoters, for which parallel G4s predominate. Using experimental and theoretical approaches, the propensity of the model sequence AATGGGTGGGTTTGGGTGGGTAA to form an intramolecular parallel-stranded G4 upon increasing the number of GGG-to-GG substitutions has been studied. Deletion of a single G leads to the formation of intramolecular G4s with a stacked G-triad, whose topology depends on the location of the deletion. Removal of another guanine from another G-tract leads to di- or multimeric G4s. Further deletions mostly prevent the formation of any stable G4. Thus, a solitary two-tetrad parallel DNA G4 is not thermodynamically stable and requires additional interactions through capping residues. However, transiently populated metastable two-tetrad species can associate to form stable dimers, the dynamic formation of which might play additional delicate roles in gene regulation. These findings provide essential information for bioinformatics studies searching for potential G4s in genomes.

Diversity of Parallel Guanine Quadruplexes Induced by Guanine Substitutions.

Recently, we reported an inhibitory effect of guanine substitutions on the conformational switch from antiparallel to parallel quadruplexes (G4) induced by dehydrating agents. As a possible cause, we proposed a difference in the sensitivity of parallel and antiparallel quadruplexes to the guanine substitutions in the resulting thermodynamic stability. Reports on the influence of guanine substitutions on the biophysical properties of intramolecular parallel quadruplexes are rare. Moreover, such reports are often complicated by the multimerisation tendencies of parallel quadruplexes. To address this incomplete knowledge, we employed circular dichroism spectroscopy (CD), both as stopped-flow-assisted fast kinetics measurements and end-point measurements, accompanied by thermodynamic analyses, based on UV absorption melting profiles, and electrophoretic methods. We showed that parallel quadruplexes are significantly more sensitive towards guanine substitutions than antiparallel ones. Furthermore, guanine-substituted variants, which in principle might correspond to native genomic sequences, distinctly differ in their biophysical properties, indicating that the four guanines in each tetrad of parallel quadruplexes are not equal. In addition, we were able to distinguish by CD an intramolecular G4 from intermolecular ones resulting from multimerisation mediated by terminal tetrad association, but not from intermolecular G4s formed due to inter-strand Hoogsteen hydrogen bond formation. In conclusion, our study indicates significant variability in parallel quadruplex structures, otherwise disregarded without detailed experimental analysis.

Composite 5-methylations of cytosines modulate i-motif stability in a sequence-specific manner: Implications for DNA nanotechnology and epigenetic regulation of plant telomeric DNA.

BACKGROUND: The i-motif is a tetrameric DNA structure based on the formation of hemiprotonated cytosine-cytosine (C+.C) base pairs. i-motifs are widely used in nanotechnology. In biological systems, i-motifs are involved in gene regulation and in control of genome integrity. In vivo, the i-motif forming sequences are subjects of epigenetic modifications, particularly 5-cytosine methylation. In plants, natively occurring methylation patterns lead to a complex network of C+.C, 5mC+.C and 5mC+.5mC base-pairs in the i-motif stem. The impact of complex methylation patterns (CMPs) on i-motif formation propensity is currently unknown. METHODS: We employed CD and UV-absorption spectroscopies, native PAGE, thermal denaturation and quantum-chemical calculations to analyse the effects of native, native-like, and non-native CMPs in the i-motif stem on the i-motif stability and pKa. RESULTS: CMPs have strong influence on i-motif stability and pKa and influence these parameters in sequence-specific manner. In contrast to a general belief, i) CMPs do not invariably stabilize the i-motif, and ii) when the CMPs do stabilize the i-motif, the extent of the stabilization depends (in a complex manner) on the number and pattern of symmetric 5mC+.5mC or asymmetric 5mC+.C base pairs in the i-motif stem. CONCLUSIONS: CMPs can be effectively used to fine-tune i-motif properties. Our data support the notion of epigenetic modifications as a plausible control mechanism of i-motif formation in vivo. GENERAL SIGNIFICANCE: Our results have implications in epigenetic regulation of telomeric DNA in plants and highlight the potential and limitations of engineered patterning of cytosine methylations on the i-motif scaffold in nanotechnological applications.

Stability of Two-Quartet G-Quadruplexes and Their Dimers in Atomistic Simulations.

G-quadruplexes (GQs) are four-stranded noncanonical DNA and RNA architectures that can be formed by guanine-rich sequences. The stability of GQs increases with the number of G-quartets, and three G-quartets generally form stable GQs. However, the stability of two-quartet GQs is an open issue. To understand the intrinsic stability of two-quartet GQ stems, we have carried out a series of unbiased molecular dynamics (MD) simulations (505 µs in total) of two- and four-quartet DNA and RNA GQs, with attention paid mainly to parallel-stranded arrangements. We used AMBER DNA parmOL15 and RNA parmOL3 force fields and tested different ion and water models. Two-quartet parallel-stranded DNA GQs unfolded in all the simulations, while the equivalent RNA GQ was stable in most of the simulations. GQs composed of two stacked units of two-quartet GQs were stable for both DNA and RNA. The simulations suggest that a minimum of three quartets are needed to form an intrinsically stable all-anti parallel-stranded DNA GQ. Parallel two-quartet DNA GQ may exist if substantially stabilized by another molecule or structural element, including multimerization. On the other hand, we predict that isolated RNA two-quartet parallel GQs may form, albeit being weakly stable. We also show that ionic parameters and water models should be chosen with caution because some parameter combinations can cause spurious instability of GQ stems. Some in-so-far unnoticed limitations of force-field description of multiple ions inside the GQs are discussed, which compromise the capability of simulations to fully capture the effect of increase in the number of quartets on the GQ stability.

Guanine Substitutions Prevent Conformational Switch from Antiparallel to Parallel G-Quadruplex.

Guanine quadruplexes, recently reported to form in vivo, represent a broad spectrum of non-canonical conformations of nucleic acids. The actual conformation might differ between water solutions and crowding or dehydrating solutions that better reflect the conditions in the cell. Here we show, using spectroscopic techniques, that most guanine substitutions prevent the conformational switch from antiparallel or hybrid forms to parallel ones when induced by dehydrating agents. The inhibitory effect does not depend on the position of the substitution, but, interestingly, on the type of substitution and, to some extent, on its destabilising potential. A parallel form might be induced in some cases by ligands such as N-methyl mesoporphyrin IX and even this ligand-induced switch is inhibited by guanine substitution. The ability or inability to have a conformation switch, based on actual conditions, might significantly influence potential conformation-dependent quadruplex interactions.

CD Study of the G-Quadruplex Conformation.

Circular Dichroic (CD) spectroscopy is one of the most frequently used methods for guanine quadruplex studies and in general for studies of conformational properties of nucleic acids. The reason is its high sensitivity to even slight changes in mutual orientation of absorbing bases of DNA. CD can reveal formation of particular structural DNA arrangements and can be used to search for the conditions stabilizing the structures, to follow the transitions between various structural states, to explore kinetics of their appearance, to determine thermodynamic parameters, and also to detect formation of higher order structures. CD spectroscopy is an important complementary technique to NMR spectroscopy and X-ray diffraction in quadruplex studies due to its sensitivity, easy manipulation of studied samples, and relative inexpensiveness. In this part, we present the protocol for the use of CD spectroscopy in the study of guanine quadruplexes, together with practical advice and cautions about various, particularly interpretation, difficulties.

Systematic investigation of sequence requirements for DNA i-motif formation.

The formation of intercalated motifs (iMs) - secondary DNA structures based on hemiprotonated C.C+ pairs in suitable cytosine-rich DNA sequences, is reflected by typical changes in CD and UV absorption spectra. By means of spectroscopic methods, electrophoresis, chemical modifications and other procedures, we characterized iM formation and stability in sequences with different cytosine block lengths interrupted by various numbers and types of nucleotides. Particular attention was paid to the formation of iMs at pH conditions close to neutral. We identified the optimal conditions and minimal requirements for iM formation in DNA sequences, and addressed gaps and inaccurate data interpretations in existing studies to specify principles of iM formation and modes of their folding.

i-Motif of cytosine-rich human telomere DNA fragments containing natural base lesions.

i-Motif (iM) is a four stranded DNA structure formed by cytosine-rich sequences, which are often present in functionally important parts of the genome such as promoters of genes and telomeres. Using electronic circular dichroism and UV absorption spectroscopies and electrophoretic methods, we examined the effect of four naturally occurring DNA base lesions on the folding and stability of the iM formed by the human telomere DNA sequence (C3TAA)3C3T. The results demonstrate that the TAA loop lesions, the apurinic site and 8-oxoadenine substituting for adenine, and the 5-hydroxymethyluracil substituting for thymine only marginally disturb the formation of iM. The presence of uracil, which is formed by enzymatic or spontaneous deamination of cytosine, shifts iM formation towards substantially more acidic pH values and simultaneously distinctly reduces iM stability. This effect depends on the position of the damage sites in the sequence. The results have enabled us to formulate additional rules for iM formation.

Spectroscopic insights into quadruplexes of five-repeat telomere DNA sequences upon G-block damage.

BACKGROUND: The DNA lesions, resulting from oxidative damage, were shown to destabilize human telomere four-repeat quadruplex and to alter its structure. Long telomere DNA, as a repetitive sequence, offers, however, other mechanisms of dealing with the lesion: extrusion of the damaged repeat into loop or shifting the quadruplex position by one repeat. METHODS: Using circular dichroism and UV absorption spectroscopy and polyacrylamide electrophoresis, we studied consequences of lesions at different positions of the model five-repeat human telomere DNA sequences on the structure and stability of their quadruplexes in sodium and in potassium. RESULTS: The repeats affected by lesion are preferentially positioned as terminal overhangs of the core quadruplex structurally similar to the four-repeat one. Forced affecting of the inner repeats leads to presence of variety of more parallel folds in potassium. In sodium the designed models form mixture of two dominant antiparallel quadruplexes whose population varies with the position of the affected repeat. The shapes of quadruplex CD spectra, namely the height of dominant peaks, significantly correlate with melting temperatures. CONCLUSION: Lesion in one guanine tract of a more than four repeats long human telomere DNA sequence may cause re-positioning of its quadruplex arrangement associated with a shift of the structure to less common quadruplex conformations. The type of the quadruplex depends on the loop position and external conditions. GENERAL SIGNIFICANCE: The telomere DNA quadruplexes are quite resistant to the effect of point mutations due to the telomere DNA repetitive nature, although their structure and, consequently, function might be altered.

Clustered abasic lesions profoundly change the structure and stability of human telomeric G-quadruplexes.

Ionizing radiation produces clustered damage to DNA which is difficult to repair and thus more harmful than single lesions. Clustered lesions have only been investigated in dsDNA models. Introducing the term 'clustered damage to G-quadruplexes' we report here on the structural effects of multiple tetrahydrofuranyl abasic sites replacing loop adenines (A/AP) and tetrad guanines (G/AP) in quadruplexes formed by the human telomere d[AG3(TTAG3)3] (htel-22) and d[TAG3(TTAG3)3TT] (htel-25) in K+ solutions. Single to triple A/APs increased the population of parallel strands in their structures by stabilizing propeller type loops, shifting the antiparallel htel-22 into hybrid or parallel quadruplexes. In htel-25, the G/APs inhibited the formation of parallel strands and these adopted antiparallel topologies. Clustered G/AP and A/APs reduced the thermal stability of the wild-type htel-25. Depending on position, A/APs diminished or intensified the damaging effect of the G/APs. Taken together, clustered lesions can disrupt the topology and stability of the htel quadruplexes and restrict their conformational space. These in vitro results suggest that formation of clustered lesions in the chromosome capping structure can result in the unfolding of existing G-quadruplexes which can lead to telomere shortening.

G-quadruplex formation in the Oct4 promoter positively regulates Oct4 expression.

The Oct4 gene codes for a transcription factor that plays a critical role in the maintenance of pluripotency in embryonic and cancer stem cells. Its expression thus has to be tightly regulated. We performed biophysical characterization of the promoter region using a combination of UV absorption, CD, and NMR spectroscopies, native PAGE and chemical probing, which was followed by functional studies involving luciferase reporter assays performed in osteosarcoma and human embryonic stem cell lines. We have shown that the evolutionarily conserved G-rich region close to the Oct4 transcription start site in the non-template strand forms a parallel G-quadruplex structure. We characterized its structure and stability upon point mutations in its primary structure. Functional studies then revealed that whereas the wild type quadruplex sequence ensures high reporter gene expression, the expression of mutated variants is significantly decreased proportionally to the destabilizing effect of the mutations on the quadruplex. A ligand, N-methyl mesoporphyrin IX that increases the stability of formed quadruplex rescued the reporter expression of single-mutated variants to the level of wild-type, but it has no effect on a mutated variant that cannot form quadruplex. These data indicate that the quadruplex acts as a strong, positive regulator of Oct4 expression and as such it might serve as a potential target for therapeutic intervention.

Wild-type p53 binds to MYC promoter G-quadruplex.

G-quadruplexes are four-stranded nucleic acid structures that are implicated in the regulation of transcription, translation and replication. Genome regions enriched in putative G-quadruplex motifs include telomeres and gene promoters. Tumour suppressor p53 plays a critical role in regulatory pathways leading to cell cycle arrest, DNA repair and apoptosis. In addition to transcriptional regulation mediated via sequence-specific DNA binding, p53 can selectively bind various non-B DNA structures. In the present study, wild-type p53 (wtp53) binding to G-quadruplex formed by MYC promoter nuclease hypersensitive element (NHE) III1 region was investigated. Wtp53 binding to MYC G-quadruplex is comparable to interaction with specific p53 consensus sequence (p53CON). Apart from the full-length wtp53, its isolated C-terminal region (aa 320-393) as well, is capable of high-affinity MYC G-quadruplex binding, suggesting its critical role in this type of interaction. Moreover, wtp53 binds to MYC promoter region containing putative G-quadruplex motif in two wtp53-expressing cell lines. The results suggest that wtp53 binding to G-quadruplexes can take part in transcriptional regulation of its target genes.

p53 binds human telomeric G-quadruplex in vitro.

The tumor suppressor protein p53 is a key factor in genome stability and one of the most studied of DNA binding proteins. This is the first study on the interaction of wild-type p53 with guanine quadruplexes formed by the human telomere sequence. Using electromobility shift assay and ELISA, we show that p53 binding to telomeric G-quadruplexes increases with the number of telomeric repeats. Further, p53 strongly favors G-quadruplexes folded in potassium over those formed in sodium, thus indicating the telomeric G-quadruplex conformational selectivity of p53. The presence of the quadruplex-stabilizing ligand, N-methyl mesoporphyrin IX (NMM), increases p53 recognition of G-quadruplexes in potassium. Using deletion mutants and selective p53 core domain oxidation, both p53 DNA binding domains are shown to be crucial for telomeric G-quadruplex recognition.

Diverse effects of naturally occurring base lesions on the structure and stability of the human telomere DNA quadruplex.

Various base lesions continuously form in cellular nucleic acids and the unrepaired lesions are promutagenic and procarcinogenic. Though natural base lesions have been extensively studied in double-stranded DNA models, these studies are only less than a decade old for non-canonical DNA models, such as quadruplexes. Here we present a report on the effects of three frequently occurring natural lesions that can form in the TTA loops on the structure of the human telomere quadruplex d[AG3(TTAG3)3]. We compared the effect of the abasic site and 8-oxoadenine replacing adenine and 5-hydroxymethyluracil substituting for thymine. The results showed that the three lesions impacted the stability and quadruplex folding in markedly different ways. The effects depended on the type of lesion and the position in the sequence. Analogous lesions of guanine in the G-tetrads extensively destabilized the quadruplex and the effects depended more on the position than on the type of lesion. The distinct effects of the loop substitutions as well as comparison of the modifications of the loops and the quadruplex tetrads are discussed in this communication.

G-quadruplex-based structural transitions in 15-mer DNA oligonucleotides varying in lengths of internal oligo(dG) stretches detected by voltammetric techniques.

Electrochemical methods, particularly when applied in connection with mercury-containing electrodes, are excellent tools for studying nucleic acids structure and monitoring structural transitions. We studied the effect of the length of the central (dG) n stretch (varying from 0 to 15 guanine residues) in 15-mer oligodeoxynucleotides (ODN, G0 to G15) on their electrochemical and interfacial behavior at mercury and carbon electrodes. The intensity of guanine oxidation signal at the carbon electrode (peak G(ox)) was observed to increase continuously with number of guanines between 0 and 15, with only a slight positive shift for ODNs with seven or more guanines in the central segment. Very different effects were observed when the peak G(HMDE) was measured at the mercury electrode. Intensity of the latter signal increased with number of guanines up to G5, and decreased sharply with further elongation of the (dG) n stretch. CD spectroscopy and electrophoresis experiments revealed formation of parallel intermolecular quadruplex structures for ODNs containing five or more G residues. Further measurements made by cyclic and alternating-current voltammetry revealed a strong influence of the ODN structure on their behavior at electrically charged surfaces.

Unique C. elegans telomeric overhang structures reveal the evolutionarily conserved properties of telomeric DNA.

There are two basic mechanisms that are associated with the maintenance of the telomere length, which endows cancer cells with unlimited proliferative potential. One mechanism, referred to as alternative lengthening of telomeres (ALT), accounts for approximately 10-15% of all human cancers. Tumours engaged in the ALT pathway are characterised by the presence of the single stranded 5'-C-rich telomeric overhang (C-overhang). This recently identified hallmark of ALT cancers distinguishes them from healthy tissues and renders the C-overhang as a clear target for anticancer therapy. We analysed structures of the 5'-C-rich and 3'-G-rich telomeric overhangs from human and Caenorhabditis elegans, the recently established multicellular in vivo model of ALT tumours. We show that the telomeric DNA from C. elegans and humans forms fundamentally different secondary structures. The unique structural characteristics of C. elegans telomeric DNA that are distinct not only from those of humans but also from those of other multicellular eukaryotes allowed us to identify evolutionarily conserved properties of telomeric DNA. Differences in structural organisation of the telomeric DNA between the C. elegans and human impose limitations on the use of the C. elegans as an ALT tumour model.

Novel biophysical determination of miRNAs related to prostate and head and neck cancers.

In this study we have chosen a new approach and characterized three miRNAs (miR-23a, miR-34a and miR-320a) related to prostate cancer and head and neck cancer by spectral (circular dichroic and UV-absorption spectra) and electrochemical (voltammetry at graphite and mercury electrodes) methods. The spectral and voltammetric results, reflecting different nucleotide sequences of miRNAs, were complemented by the results of DNAs(U) having the same oligonucleotide sequences as miRNAs. The effect of the substitution of ribose for deoxyribose was shown and structural diversity was confirmed. The stability of RNA and DNA(U) was studied using CD and UV-absorption spectroscopy and melting points were calculated. MiRNA-320a with the highest content of guanine provided the highest melting point. With respect to the rapid progress of miRNA electrochemical sensors, our results will be useful for the research and development of sensitive, portable and time-efficient miRNA sensors, which will be able to diagnose cancer and other diseases.