ABSTRACT
Mangroves perform a crucial ecological role along the tropical and subtropical coastal intertidal zone where salinity fluctuation occurs frequently. However, the differential responses of mangrove plant at the combined transcriptome and metabolome level to variable salinity are not well documented. In this study, we used Avicennia marina (Forssk.) Vierh., a pioneer species of mangrove wetlands and one of the most salt-tolerant mangroves, to investigate the differential salt tolerance mechanisms under low and high salinity using inductively coupled plasma-mass spectrometry, transcriptomic and metabolomic analysis. The results showed that HAK8 was up-regulated and transported K+ into the roots under low salinity. However, under high salinity, AKT1 and NHX2 were strongly induced, which indicated the transport of K+ and Na+ compartmentalization to maintain ion homeostasis. In addition, A. marina tolerates low salinity by up-regulating ABA signaling pathway and accumulating more mannitol, unsaturated fatty acids, amino acids' and L-ascorbic acid in the roots. Under high salinity, A. marina undergoes a more drastic metabolic network rearrangement in the roots, such as more L-ascorbic acid and oxiglutatione were up-regulated, while carbohydrates, lipids and amino acids were down-regulated in the roots, and, finally, glycolysis and TCA cycle were promoted to provide more energy to improve salt tolerance. Our findings suggest that the major salt tolerance traits in A. marina can be attributed to complex regulatory and signaling mechanisms, and show significant differences between low and high salinity.
Subject(s)
Avicennia , Metabolome , Plant Roots , Salinity , Salt Tolerance , Salt-Tolerant Plants , Transcriptome , Avicennia/genetics , Avicennia/physiology , Avicennia/metabolism , Salt-Tolerant Plants/genetics , Salt-Tolerant Plants/metabolism , Salt-Tolerant Plants/physiology , Plant Roots/metabolism , Plant Roots/genetics , Salt Tolerance/genetics , Gene Expression Regulation, PlantABSTRACT
BACKGROUND: Genetic disorders often manifest as abnormal fetal or childhood development. Copy number variations (CNVs) represent a significant genetic mechanism underlying such disorders. Despite their importance, the effectiveness of clinical exome sequencing (CES) in detecting CNVs, particularly small ones, remains incompletely understood. We aimed to evaluate the detection of both large and small CNVs using CES in a substantial clinical cohort, including parent-offspring trios and proband only analysis. METHODS: We conducted a retrospective analysis of CES data from 2428 families, collected from 2018 to 2021. Detected CNV were categorized as large or small, and various validation techniques including chromosome microarray (CMA), Multiplex ligation-dependent probe amplification assay (MLPA), and/or PCR-based methods, were employed for cross-validation. RESULTS: Our CNV discovery pipeline identified 171 CNV events in 154 cases, resulting in an overall detection rate of 6.3%. Validation was performed on 113 CNVs from 103 cases to assess CES reliability. The overall concordance rate between CES and other validation methods was 88.49% (100/113). Specifically, CES demonstrated complete consistency in detecting large CNV. However, for small CNVs, consistency rates were 81.08% (30/37) for deletions and 73.91% (17/23) for duplications. CONCLUSION: CES demonstrated high sensitivity and reliability in CNV detection. It emerges as an economical and dependable option for the clinical CNV detection in cases of developmental abnormalities, especially fetal structural abnormalities.
Subject(s)
DNA Copy Number Variations , Exome Sequencing , Genetic Diseases, Inborn , Humans , DNA Copy Number Variations/genetics , Genetic Diseases, Inborn/diagnosis , Genetic Diseases, Inborn/genetics , Reproducibility of Results , Female , Predictive Value of Tests , Male , Retrospective StudiesABSTRACT
The HKT transporter plays an important role for plants in response to salt stress, but the transport property of the soybean HKT transporters at the molecular level is still unclear. Here, using Xenopus oocyte as a heterologous expression system and two-electrode voltage-clamp technique, we identified four HKT transporters, GmHKT1;1, GmHKT1;2, GmHKT1;3, and GmHKT1;4, which all belong to type I subfamily, but having distinct ion transport properties. While GmHKT1;1, GmHKT1;2 and GmHKT1;3 function as Na+ transporters, GmHKT1;1 is less selective against K+ than the two other transporters. Astonishingly, GmHKT1;4, which lacks transmembrane segments and has no ion permeability, is significantly expressed, and its gene expression pattern is different from the other three GmHKTs under salt stress. Interestingly, GmHKT1;4 reduced the Na+/K+ currents mediated by GmHKT1;1. Further study showed that the transport ability of GmHKT1;1 regulated by GmHKT1;4 was related to the structural differences in the first intracellular domain and the fourth repeat domain. Overall, we have identified one unique GmHKT member, GmHKT1;4, which modulates the Na+ and K+ transport ability of GmHKT1;1 via direct interaction. Thus, we have revealed a new type of HKTs interaction model for altering their ion transport properties.
ABSTRACT
PURPOSE: Differentiating ischemic brain damage is critical for decision making in acute stroke treatment for better outcomes. We examined the sensitivity of amide proton transfer (APT) MRI, a pH-weighted imaging technique, to achieve this differentiation. METHODS: In a rat stroke model, the ischemic core, oligemia, and the infarct-growth region (IGR) were identified by tracking the progression of the lesions. APT MRI signals were measured alongside ADC, T1, and T2 maps to evaluate their sensitivity in distinguishing ischemic tissues. Additionally, stroke under hyperglycemic conditions was studied. RESULTS: The APT signal in the IGR decreased by about 10% shortly after stroke onset, and further decreased to 35% at 5 h, indicating a progression from mild to severe acidosis as the lesion evolved into infarction. Although ADC, T1, and T2 contrasts can only detect significant differences between the IGR and oligemia for a portion of the stroke duration, APT contrast consistently differentiates between them at all time points. However, the contrast to variation ratio at 1 h is only about 20% of the contrast to variation ratio between the core and normal tissues, indicating limited sensitivity. In the ischemic core, the APT signal decreases to about 45% and 33% of normal tissue level at 1 h for the normoglycemic and hyperglycemic groups, respectively, confirming more severe acidosis under hyperglycemia. CONCLUSION: The sensitivity of APT MRI is high in detecting severe acidosis of the ischemic core but is much lower in detecting mild acidosis, which may affect the accuracy of differentiation between the IGR and oligemia.
Subject(s)
Acidosis , Disease Models, Animal , Ischemic Stroke , Magnetic Resonance Imaging , Protons , Animals , Rats , Acidosis/diagnostic imaging , Ischemic Stroke/diagnostic imaging , Magnetic Resonance Imaging/methods , Male , Rats, Sprague-Dawley , Brain/diagnostic imaging , Amides , Brain Ischemia/diagnostic imaging , Stroke/diagnostic imaging , Sensitivity and SpecificityABSTRACT
Probiotics are increasingly used as starter cultures to produce fermented dairy products; however, few studies have investigated the role of probiotics in milk fermentation metabolism. The current study aimed to investigate whether adding Bifidobacterium animalis ssp. lactis Probio-M8 (Probio-M8) as a starter culture strain could improve milk fermentation by comparing the physicochemical characteristics and metabolomes of fermented milks produced by a commercial starter culture with and without Probio-M8. Our results showed that adding Probio-M8 shortened the milk fermentation time and improved the fermented milk texture and stability. Metabolomics analyses revealed that adding Probio-M8 affected mostly organic acid, AA, and fatty acid metabolism in milk fermentation. Targeted quantitative analyses revealed significant increases in various metabolites related to the sensory quality, nutritive value, and health benefits of the probiotic fermented milk, including 5 organic acids (acetic acid, lactic acid, citric acid, succinic acid, and tartaric acid), 5 EAA (valine, arginine, leucine, isoleucine, and lysine), glutamic acid, and 2 essential fatty acids (α-linolenic acid and docosahexaenoic acid). Thus, applying probiotics in milk fermentation is desirable. This study has generated useful information for developing novel functional dairy products.
Subject(s)
Bifidobacterium animalis , Fermentation , Milk , Probiotics , Bifidobacterium animalis/metabolism , Animals , Milk/chemistry , Cultured Milk Products/microbiologyABSTRACT
This study presents a biosensor fabricated based on integrated passive device (IPD) technology to measure microbial growth on solid media in real-time. Yeast (Pichia pastoris, strain GS115) is used as a model organism to demonstrate biosensor performance. The biosensor comprises an interdigital capacitor in the center with a helical inductive structure surrounding it. Additionally, 12 air bridges are added to the capacitor to increase the strength of the electric field radiated by the biosensor at the same height. Feasibility is verified by using a capacitive biosensor, and the change in capacitance values during the capacitance detection process with the growth of yeast indicates that the growth of yeast can induce changes in electrical parameters. The proposed IPD-based biosensor is used to measure yeast drop-added on a 3 mm medium for 100 h at an operating frequency of 1.84 GHz. The resonant amplitude of the biosensor varies continuously from 24 to 72 h due to the change in colony height during vertical growth of the yeast, with a maximum change of 0.21 dB. The overall measurement results also fit well with the Gompertz curve. The change in resonant amplitude between 24 and 72 h is then analyzed and reveals a linear relationship with time with a coefficient of determination of 0.9844, indicating that the biosensor is suitable for monitoring yeast growth. Thus, the proposed biosensor is proved to have potential in the field of microbial proliferation detection.
Subject(s)
Biosensing Techniques , Yeasts/growth & developmentABSTRACT
Abnormal hemoglobin anti-Lepore Hong Kong is a rare ßδ fusion variants resulting from non-homologous crossover during meiosis. Anti-Lepore Hong Kong is known to consistently exhibit significantly increased level of HbA2. In this study, we used multiplex ligation-dependent probe amplification (MLPA) and single molecular real-time (SMRT) sequencing, as well as Sanger sequencing, to identify variants in five unrelated families with abnormal elevated HbA2 level. All probands in these five families were found to be heterozygous for anti-Lepore Hong Kong. Among them, two families showed co-occurrence of ß0-thalassemia and α-thalassemia (-SEA/ or αCSα/). Heterozygotes for anti-Lepore Hong Kong displayed an average HbA2 level of 17.7% and behaved normal. However, when combined with ß0-thalassemia and α-thalassemia, the probands exhibited higher HbA2 level (30.2-40.8%) and behaved with ß-thalassemia trait. Furthermore, determination of the α/ß-mRNA ratio revealed a slight downregulation of ß-globin, similar to that of ß-thalassemia minor. Our study is the first to identify compound heterozygotes for anti-Lepore Hong Kong, ß0-thalassemia and α-thalassemia, provide valuable information for prenatal counseling.
Subject(s)
Hemoglobins, Abnormal , alpha-Thalassemia , beta-Thalassemia , Humans , Pregnancy , Female , alpha-Thalassemia/genetics , Hemoglobins, Abnormal/genetics , beta-Thalassemia/genetics , beta-Globins/geneticsABSTRACT
The efficient remediation of the soil co-contaminated with heavy metals and polybrominated diphenyl ethers (PBDEs) from electronic disassembly zones is a new challenge. Here, we screened a fungus of F. solani (F.s) can immobilize Cd and remove PBDEs. wIt combined with tourmaline enhances the remediation of co- pollutants in the soil. Furthermore, the environment risks of the enhanced technology were assessed through the amount of Cd/BDE-153 in Amaranthus tricolor L. (amaranth) migrated from soil, as well as the changes of soil microorganism communities and enzyme activities. The results showed the combined treatment of tourmaline and F.s made the removal percentage of BDE-153 in rhizosphere soil co-contaminated with BDE-153 and Cd reached 46.5%. And the weak acid extractable Cd in rhizosphere soil decreased by 33.7% compared to control group. In addition, the combined remediation technology resulted in a 32.5% (22.8%), 45.5% (37.2%), and 50.7% (38.1%) decrease in BDE-153 (Cd) content in the roots, stems, and leaves of amaranth, respectively. Tourmaline combined with F.s can significantly increase soil microorganism diversity, soil dehydrogenase and urease activities, further improving the remediation rate of Cd and BDE-153co-pollutants in soil and the biomass of amaranth. This study provides the remediation technology of soil co-contaminated with heavy metal and PBDEs and ensure the maintenance of food security.
Subject(s)
Amaranthus , Environmental Pollutants , Metals, Heavy , Polybrominated Biphenyls , Silicates , Soil Pollutants , Soil , Cadmium , Biodegradation, Environmental , Halogenated Diphenyl Ethers/analysis , Soil Pollutants/analysis , Metals, Heavy/analysisABSTRACT
BACKGROUND: ß-Thalassemia is mainly caused by point mutations in the ß-globin gene cluster. With the rapid development of sequencing technic, more and more variants are being discovered. RESULTS: In this study, we found two novel deletion mutations in two unrelated families, HBB: c.180delG (termed ßCD59) and HBB: c.382_402delCAGGCTGCCTATCAGAAAGTG (termed ßCD128-134) in family A and B, respectively. Both the two novel mutations lead to ß-thalassemia trait. However, when compounded with other ß0-thalassemia, it may behave with ß-thalassemia intermedia or ß-thalassemia major. CONCLUSION: Our study broadens the variants spectral of ß-thalassemia in Chinese population and provides theoretical guidance for the prenatal diagnosis.
Subject(s)
beta-Thalassemia , Pregnancy , Female , Humans , beta-Thalassemia/genetics , beta-Globins/genetics , Prenatal Diagnosis , Sequence Deletion/genetics , China , MutationABSTRACT
Cast defects are common in cast alloys and they are difficult to eliminate without deformation. They strongly degrade the mechanical properties of cast alloys. The addition of some elements can affect the number of cast defects. In this work, the deleterious effect of Sn addition on the mechanical properties of Al-Si alloys has been investigated via 3D-computed tomography, SEM and TEM. Amorphous Sn oxides were found near the alumina film or formed enclosures with alumina film. The melt containing high Sn content was trapped by enclosures, causing more shrinkage pores during solidification. Cracks likely initiated and expanded along these pores and brittle amorphous Sn oxides, deteriorating the mechanical properties. This work suggests not adding Sn to various Al alloys when used in a cast state.
ABSTRACT
For effective wavefront management in the optical infrared range, dynamic all-dielectric metasurfaces, always based on phase transition materials, particularly G e 2 S b 2 T e 5 (GST), can be used. In this paper, we propose a GST-based tunable metasurface by structuring the phase-change material GST. We confirm that the nanopillar we designed has high transmittance in the wavelength band around 1550 nm and can fully cover the 0â¼2π phase. Based on these characteristics, we can achieve beam steering and a focusing effect in amorphous phase by elaborately arranging GST nanopillars, while the aforementioned optical phenomena disappear in crystalline phase. Additionally, by arranging the array of vortex phases, we also realize switching the perfect composite vortex beam (PCVB) when changing the crystal state of GST, and simulate the generation of PCVB with different topological charges and sizes in amorphous phase. We believe that our research results can serve as a reference for multifunctional optical surfaces, dynamic optical control, optical communication, and information processing.
ABSTRACT
AIMS: To determine the role of opioid and ß-adrenergic receptors in bladder underactivity induced by prolonged pudendal nerve stimulation (PNS). METHODS: In α-chloralose anesthetized cats, 30-min PNS was applied repeatedly for 3-9 times to induce poststimulation or persistent bladder underactivity. Then, naloxone (opioid receptor antagonist, 1 mg/kg, IV) or propranolol (ß-adrenergic receptor antagonist, 3 mg/kg, IV) was given to reverse the bladder underactivity. After the drug treatment, an additional 30-min PNS was applied to counteract the drug effect. Repeated cystometrograms were performed by slowly (1-2 mL/min) infusing the bladder with saline via a urethral catheter to determine the bladder underactivity and the treatment effects. RESULTS: Prolonged (2-4.5 h) PNS induced bladder underactivity evident as a large bladder capacity (169 ± 49% of control) and a reduced amplitude of bladder contraction (59 ± 17% of control). Naloxone fully reversed the bladder underactivity by reducing bladder capacity to 113 ± 58% and increasing the amplitude of bladder contraction to 104 ± 34%. After administration of naloxone an additional 30-min PNS temporarily increased the bladder capacity to the underactive bladder level (193 ± 74%) without changing the amplitude of the bladder contraction. Propranolol had no effect on bladder underactivity. CONCLUSIONS: A tonic enkephalinergic inhibitory mechanism in the CNS plays a critical role in the bladder underactivity induced by prolonged PNS, while the peripheral ß-adrenergic receptor mechanism in the detrusor is not involved. This study provides basic science evidence consistent with the clinical observation that comorbid opioid usage may contribute to voiding dysfunction in patients with Fowler's syndrome.
Subject(s)
Pudendal Nerve , Urinary Bladder Diseases , Cats , Animals , Urinary Bladder , Analgesics, Opioid/pharmacology , Propranolol/pharmacology , Receptors, Adrenergic, beta , Reflex/physiology , Electric Stimulation , Naloxone/pharmacologyABSTRACT
In this paper, we demonstrate an adjustable trifunctional absorber that can achieve the conversion of broadband, narrowband and superimposed absorption based on the phase transition material vanadium dioxide (VO2) in the mid-infrared domain. The absorber can achieve the switching of multiple absorption modes by modulating the temperature to regulate the conductivity of VO2. When the VO2 film is adjusted to the metallic state, the absorber serves as a bidirectional perfect absorber with switching capability of wideband and narrowband absorption. The superposed absorptance can be generated while the VO2 layer is converted to the insulating state. Then, we introduced the impedance matching principle to explain the inner mechanism of the absorber. Our designed metamaterial system with a phase transition material is promising for sensing, radiation thermometer and switching devices.
ABSTRACT
Probiotic functional products have drawn wide attention because of their increasing popularity. However, few studies have analyzed probiotic-specific metabolism in the fermentation process. This study applied UPLC-QE-MS-based metabolomics to track changes in the milk metabolomes in the course of fermentation by two probiotic strains, Lacticaseibacillus paracasei PC-01 and Bifidobacterium adolescentis B8589. We observed substantial changes in the probiotic fermented milk metabolome between 0 and 36 h of fermentation, and the differences between the milk metabolomes at the interim period (36 h and 60 h) and the ripening stage (60 h and 72 h) were less obvious. A number of time point-specific differential metabolites were identified, mainly belonging to organic acids, amino acids, and fatty acids. Nine of the identified differential metabolites are linked to the tricarboxylic acid cycle, glutamate metabolism, and fatty acid metabolism. The contents of pyruvic acid, γ-aminobutyric acid, and capric acid increased at the end of fermentation, which can contribute to the nutritional quality and functional properties of the probiotic fermented milk. This time-course metabolomics study analyzed probiotic-specific fermentative changes in milk, providing detailed information of probiotic metabolism in a milk matrix and the potential beneficial mechanism of probiotic fermented milk.
ABSTRACT
OBJECTIVE: The purpose of this study is to determine whether adaptively stepwise increasing the intensity of a high-frequency (10 kHz) biphasic stimulation (HFBS) can produce nerve conduction block without generating a large initial response. MATERIALS AND METHODS: In anesthetized cats, three cuff electrodes were implanted on the left pudendal nerve for stimulation or block. The urethral pressure increase induced by pudendal nerve stimulation was used to measure the pudendal nerve block induced by HFBS. RESULTS: HFBS applied suddenly with a large step increase in intensity induced a large (86 ± 16 cmH2O) urethral pressure increase before it blocked pudendal nerve conduction. However, HFBS applied by adaptively stepwise increasing the intensity every 10 to 60 seconds over a long period (33-301 minutes; average 108 ± 35 minutes) with many small intensity increases (0.005-0.1 mA) induced no response or low-amplitude high-frequency urethral pressure changes before it blocked pudendal nerve conduction. The minimal HFBS intensities required by the two different methods to block pudendal nerve conduction are similar. CONCLUSION: This study is important for better understanding the possible mechanisms underlying the HFBS-induced nerve block and provides the possibility of developing a new nerve block method for clinical applications in which an initial large response is a concern.
ABSTRACT
Topological charge (TC) is generally acknowledged as an important attribute of an optical vortex (OV), which indicates the twisted characterization of the wavefront. In most circumstances, the TC remains constant as an integer or fraction along the azimuthal direction. Herein, by transforming the TCs into the trigonometric functions of the azimuthal angle to tailor the spiral phase distributions, we numerically demonstrate generating perfect vortex beams (PVBs) with sine-function TC based on the all-dielectric geometric metasurfaces, whose unit structure is optimized to an ideal half-wave plate. To seek the intrinsic advancements of the proposed PVBs, their orbital angular momentum (OAM) as well as optical gradient force distributions are calculated for diverse particle manipulation. We believe our proposed scheme is desired to provide an original thought for OAM manipulation, information storage, and optical communication.
ABSTRACT
BACKGROUND: At present, the methods generally used to detect α-thalassemia mutations are confined to detecting common mutations, which may lead to misdiagnosis or missed diagnosis. The single-molecule real-time (SMRT) sequencing enables long-read single-molecule sequencing with high detection accuracy, and long-length DNA chain reads in high-fidelity read mode. This study aimed to identify novel large deletions and complex variants in the α-globin locus in Chinese population. METHODS: We used SMRT sequencing to detect rare and complex variants in the α-globin locus in four individuals whose hematological data indicated microcytic hypochromic anemia. However, the conventional thalassemia detection result was negative. Multiplex ligation-dependent probe amplification and droplet digital polymerase chain reaction were used to confirm SMRT sequencing results. RESULTS: Four novel large deletions were observed ranging from 23 to 81 kb in the α-globin locus. One patient also had a duplication of upstream of HBZ in the deletional region, while another, with a 27.31-kb deletion on chromosome 16 (hg 38), had abnormal hemoglobin Siriraj (Hb Siriraj). CONCLUSION: We first identified the four novel deletions in the α-globin locus using SMRT sequencing. Considering that the conventional methods might lead to misdiagnosis or missed diagnosis, SMRT sequencing proved to be an excellent method to discover rare and complex variants in thalassemia, especially in prenatal diagnosis.
Subject(s)
East Asian People , alpha-Globins , Humans , alpha-Globins/genetics , alpha-Thalassemia/genetics , Anemia, Hypochromic/genetics , East Asian People/genetics , MutationABSTRACT
OBJECTIVE: To provide guidance for hip replacement by analyzing the variation of femoral head rotation center in different hip diseases. METHODS: A total of 5 459 patients were collected from March 2016 to June 2021, who took positive and proportional plain films of both hips for various reasons. The relative position between the rotation center of the femoral head and the apex of the greater trochanter was measured. The positive variation is more than 2 mm above the top of the great trochanter, and the negative variation is more than 2 mm below the top of the great trochanter. A total of 831 patients with variation of femoral head rotation center were collected and were divided into 4 groups according to different diseases, and the variation was counted respectively. There were 15 cases in the normal group involving 10 cases of positive variation and 5 cases of negative variation. There were 145 cases of avascular necrosis of femoral head involving 25 cases of positive variation and 120 cases of negative variation. There were 346 cases of congenital hip dysplasia involving 225 cases of positive variation(including 25 cases of typeâ , 70 cases of type â ¡, 115 cases of type â ¢ and 15 cases of type â £), and 121 cases of negative variation(including 50 cases of crowe typeâ , 60 cases of typeâ ¡, 10 cases of type â ¢ and 1 case of type â £). There were 325 cases of hip osteoarthritis group involving 45 cases of positive variation and 280 cases of negative variation. RESULTS: There was significant difference in variation of femoral head rotation center among the four groups(P<0.05). There was significant difference in variation of femoral head rotation center among different types of congenital hip dysplasia(P<0.05). There were significant differences in cervical trunk angle and eccentricity among different variations of femoral head rotation center(P<0.05). CONCLUSION: The variation of femoral head rotation center is related to cervical trunk angle and eccentricity. The variation of femoral head rotation center is an important factor in hip diseases. The variation of femoral head rotation center is different in different hip diseases. Avascular necrosis of the femoral head and osteoarthritis of the hip were mostly negative variations. With the aggravation of congenital hip dysplasia, the variation of femoral head rotation center gradually changed from negative variation to positive variation.The variation of femoral head rotation center should be paid attention to in the preoperative planning of hip arthroplasty. It is of great significance to select the appropriate prosthesis and place the prosthesis accurately.
Subject(s)
Arthroplasty, Replacement, Hip , Hip Dislocation, Congenital , Hip Prosthesis , Humans , Femur Head/diagnostic imaging , Femur Head/surgery , Hip Dislocation, Congenital/surgery , Arthroplasty, Replacement, Hip/methods , Femur/surgery , Retrospective Studies , Treatment OutcomeABSTRACT
BACKGROUND: Hb Chapel Hill [Alpha2 74(EF3) Asp > Gly] results from an GAC > GGC substitution at codon 74 of the HBA1 or HBA2 genes. Hb Chapel Hill has not been reported since 1986. METHODS: A heterozygous mutation, HBA2: c.224A > G, was identified in the proband, her father and sister. We compared the haematological and clinical data of this family with the data reported in the limited number of individuals. RESULTS: Having excluded iron deï¬ciency, the Hb Chapel Hill was asymptomatic in heterozygous state. The cases presented here characterize cases in new techniques including capillary electrophoresis (CE). Two aberrant peaks were identified by CE, a major peak migrating in the zone 7 that correspond to Hb Chapel Hill (αChapel Hill 2ß2) and a minor peak migrating in the zone 1 that correspond to Hb Chapel Hill2 (αChapel Hill 2δ2). Focusing on the variant expression, the Hb Chapel Hill plus Hb A2 variant were around 18.9-20.6% of total Hb in three members. CONCLUSION: This data will be useful for providing up-to-date and high quality information on the Hb Chapel Hill.
Subject(s)
Hemoglobins, Abnormal , alpha-Thalassemia , Female , Humans , alpha-Globins/genetics , alpha-Thalassemia/genetics , East Asian People , Hemoglobins, Abnormal/genetics , Hemoglobins, Abnormal/metabolism , Heterozygote , Mutation , MaleABSTRACT
OBJECTIVE: In the present study, two unrelated cases of Hb Q-Thailand heterozygosity unlinked with the (-α4.2/) α+-thalassemia deletion allele were identified by long-read single molecule real-time (SMRT) sequencing in southern China. The aim of this study was to report the hematological and molecular features as well as diagnostic aspects of the rare manifestation. METHODS: Hematological parameters and hemoglobin analysis results were recorded. A suspension array system for routine thalassemia genetic analysis and long-read SMRT sequencing were applied in parallel for thalassemia genotyping. Traditional methods, including Sanger sequencing, multiplex gap-polymerase chain reaction (gap-PCR) and multiplex ligation-dependent probe amplification (MLPA), were used together to confirm the thalassemia variants. RESULTS: Long-read SMRT sequencing was used to diagnose two Hb Q-Thailand heterozygous patients for whom the hemoglobin variant was unlinked to the (-α4.2/) allele for the first time. The hitherto undescribed genotypes were verified by traditional methods. Hematological parameters were compared with those of Hb Q-Thailand heterozygosity linked with the (-α4.2/) deletion allele in our study. For the positive control samples, long-read SMRT sequencing revealed a linkage relationship between the Hb Q-Thailand allele and the (-α4.2/) deletion allele. CONCLUSIONS: Identification of the two patients confirms that the linkage relationship between the Hb Q-Thailand allele and the (-α4.2/) deletion allele is a common possibility but not a certainty. Remarkably, as it is superior to traditional methods, SMRT technology may eventually serve as a more comprehensive and precise method that holds promising prospects in clinical practice, especially for rare variants.