IDD10-NAC079 transcription factor complex regulates sheath blight resistance by inhibiting ethylene signaling in rice.

INTRODUCTION: Rhizoctonia solani Kühn is a pathogen causing rice sheath blight (ShB). Ammonium transporter 1 (AMT1) promotes resistance of rice to ShB by activating ethylene signaling. However, how AMT1 activates ethylene signaling remains unclear. OBJECTIVE: In this study, the indeterminate domain 10 (IDD10)-NAC079 interaction model was used to investigate whether ethylene signaling is modulated downstream of ammonium signaling and modulates ammonium-mediated ShB resistance. METHODS: RT-qPCR assay was used to identify the relative expression levels of nitrogen and ethylene related genes. Yeast two-hybrid assays, Bimolecular fluorescence complementation (BiFC) and Co-immunoprecipitation (Co-IP) assay were conducted to verify the IDD10-NAC079-calcineurin B-like interacting protein kinase 31 (CIPK31) transcriptional complex. Yeast one-hybrid assay, Chromatin immunoprecipitation (ChIP) assay, and Electrophoretic mobility shift assay (EMSA) were used to verify whether ETR2 was activated by IDD10 and NAC079. Ethylene quantification assay was used to verify ethylene content in IDD10 transgenic plants. Genetic analysis is used to detect the response of IDD10, NAC079 and CIPK31 to ShB infestation. RESULTS: IDD10-NAC079 forms a transcription complex that activates ETR2 to inhibit the ethylene signaling pathway to negatively regulating ShB resistance. CIPK31 interacts and phosphorylates NAC079 to enhance its transcriptional activation activity. In addition, AMT1-mediated ammonium absorption and subsequent N assimilation inhibit the expression of IDD10 and CIPK31 to activate the ethylene signaling pathway, which positively regulates ShB resistance. CONCLUSION: The study identified the link between ammonium and ethylene signaling and improved the understanding of the rice resistance mechanism.

Overexpression of COX7A1 Promotes the Resistance of Gastric Cancer to Oxaliplatin and Weakens the Efficacy of Immunotherapy.

Gastric cancer (GC) is one of the most common clinical malignant tumors worldwide, with high morbidity and mortality. Presently, the overall response rate to immunotherapy is low, and current methods for predicting the prognosis of GC are not optimal. Therefore, novel biomarkers with accuracy, efficiency, stability, performance ratio and wide clinical application are needed. Based on public data sets, the Chemotherapy Cohort and the Immunotherapy Cohort from Sun Yat-sen University Cancer Center, a series of bioinformatics analyses, such as differential expression analysis, survival analysis, drug sensitivity prediction, enrichment analysis, tumor immune dysfunction and exclusion (TIDE) analysis, single-sample gene set enrichment analysis (ssGSEA), stemness index calculation, immune cell infiltration analysis, were performed for screening and preliminary exploration. Immunohistochemical staining and in vitro experiments were performed for further verification. Overexpression of COX7A1 promoted the resistance of GC cells to Oxaliplatin. COX7A1 may induce immune escape by regulating the number of fibroblasts and their cellular communication with immune cells. In summary, measuring the expression levels of COX7A1 in the clinic may be useful to predict the prognosis of GC patients, the degree of chemotherapy resistance and the efficacy of immunotherapy.

Genus_Ruminococcus and order_Burkholderiales affect osteoporosis by regulating the microbiota-gut-bone axis.

Background: This study aimed to clarify the relationship between the gut microbiota and osteoporosis combining Mendelian randomization (MR) analysis with animal experiments. Methods: We conducted an analysis on the relationship between differential bacteria and osteoporosis using open-access genome-wide association study (GWAS) data on gut microbe and osteoporosis obtained from public databases. The analysis was performed using two-sample MR analysis, and the causal relationship was examined through inverse variance weighting (IVW), MR Egger, weighted median, and weighted mode methods. Bilateral oophorectomy was employed to replicate the mouse osteoporosis model, which was assessed by micro computed tomography (CT), pathological tests, and bone transformation indexes. Additionally, 16S rDNA sequencing was conducted on fecal samples, while SIgA and indexes of IL-6, IL-1ß, and TNF-α inflammatory factors were examined in colon samples. Through immunofluorescence and histopathology, expression levels of tight junction proteins, such as claudin-1, ZO-1, and occludin, were assessed, and conduct correlation analysis on differential bacteria and related environmental factors were performed. Results: A positive correlation was observed between g_Ruminococcus1 and the risk of osteoporosis, while O_Burkholderiales showed a negative correlation with the risk of osteoporosis. Furthermore, there was no evidence of heterogeneity or pleiotropy. The successful replication of the mouse osteoporosis model was assessed, and it was found that the abundance of the O_Burkholderiales was significantly reduced, while the abundance of g_Ruminococcus was significantly increased in the ovariectomized (OVX)-mice. The intestinal SIgA level of OVX mice decreased, the expression level of inflammatory factors increased, barrier damage occurred, and the content of LPS in the colon and serum significantly increased. The abundance level of O_Burkholderiales is strongly positively correlated with bone formation factors, gut barrier indicators, bone density, bone volume fraction, and trabecular bone quantity, whereas it was strongly negatively correlated with bone resorption factors and intestinal inflammatory factors, The abundance level of g_Ruminococcus shows a strong negative correlation with bone formation factors, gut barrier indicators, and bone volume fraction, and a strong positive correlation with bone resorption factors and intestinal inflammatory factors. Conclusion: O_Burkholderiales and g_Ruminococcus may regulate the development of osteoporosis through the microbiota-gut-bone axis.

Clinical Observation and Cause Analysis of Perioperative Superior Cluneal Neuralgia in Vertebral Augmentation.

BACKGROUND: In our clinical practice, we observed that some osteoporotic vertebral compression fracture patients undergoing vertebral augmentation exhibited pain in the iliac crest region. This pain aligned with the diagnostic criteria for superior cluneal neuralgia (SCN) and affected treatment satisfaction. OBJECTIVE: This study aims to clinically observe patients undergoing vertebral augmentation in a hospital setting and analyze the etiology and risk factors associated with SCN. STUDY DESIGN: Retrospective cohort study. SETTING: Inpatient population of a single center. METHODS: We retrospectively analyzed clinical data from 630 patients who underwent vertebral augmentation in our hospital from March 2022 to March 2023. Fifty-two patients enrolled in the study experienced pain that met the diagnostic criteria for superior cluneal neuralgia during the perioperative period of the vertebral augmentation procedures. Those patients were divided into 2 subgroups according to the conditions involved in the occurrence of SCN: Group A (26 patients) had either no preoperative SCN but developed it postoperatively, or had preoperative SCN that worsened or did not alleviate postoperatively. Group B (26 patients) had preoperative SCN that was relieved postoperatively. Additionally, 52 consecutive patients in March 2022 to March 2023. who did not experience SCN during the perioperative period were selected as the control group (Group C). Variables such as surgical segment, age, height, weight, body mass index, duration of hospitalization, chronic low back pain (CLBP), duration of pain, anesthesia, surgical approach, fracture pattern, preoperative visual analog scale (pre-op VAS) score, intraoperative VAS score, one-day VAS score, one-month VAS score, lumbar sacral angle, and sacral tilt angle were statistically described and analyzed. RESULTS: In our hospital, the incidence of SCN during the perioperative period of vertebral augmentation procedures is 8.25% (52/630). Among all the segments of patients who developed SCN during the perioperative period, the L1 segment had the highest proportion, which was 29.03% and 35.14% in Groups A and B, respectively. Group B and Group C showed significant differences in duration of hospitalization (P = 0.012), pre-op VAS scores (P = 0.026), and CLBP (P < 0.001). Group A had significantly higher VAS scores preoperatively (P = 0.026) and intraoperatively (P = 0.004) and in CLBP (P = 0.001) than did Group C. LIMITATIONS: This is a retrospective study. Single-center noncontrolled studies may introduce selection bias. The small sample size in each group might have also led to bias. CONCLUSION: Perioperative SCN associated with vertebral augmentation is significantly correlated with preoperative VAS scores and CLBP. In addition, intraoperative VAS scores might be a factor contributing to the nonalleviation or exacerbation of postoperative SCN.

Machine Learning Model for Predicting Axillary Lymph Node Metastasis in Clinically Node Positive Breast Cancer Based on Peritumoral Ultrasound Radiomics and SHAP Feature Analysis.

OBJECTIVE: This study seeks to construct a machine learning model that merges clinical characteristics with ultrasound radiomic analysis-encompassing both the intratumoral and peritumoral-to predict the status of axillary lymph nodes in patients with early-stage breast cancer. METHODS: The study employed retrospective methods, collecting clinical information, ultrasound data, and postoperative pathological results from 321 breast cancer patients (including 224 in the training group and 97 in the validation group). Through correlation analysis, univariate analysis, and Lasso regression analysis, independent risk factors related to axillary lymph node metastasis in breast cancer were identified from conventional ultrasound and immunohistochemical indicators, and a clinical feature model was constructed. Additionally, features were extracted from ultrasound images of the intratumoral and its 1-5 mm peritumoral to establish a radiomics feature formula. Furthermore, by combining clinical features and ultrasound radiomics features, six machine learning models (Logistic Regression, Decision Tree, Support Vector Machine, Extreme Gradient Boosting, Random Forest, and K-Nearest Neighbors) were compared for diagnostic efficacy, and constructing a joint prediction model based on the optimal ML algorithm. The use of Shapley Additive Explanations (SHAP) enhanced the visualization and interpretability of the model during the diagnostic process. RESULTS: Among the 321 breast cancer patients, 121 had axillary lymph node metastasis, and 200 did not. The clinical feature model had an AUC of 0.779 and 0.777 in the training and validation groups, respectively. Radiomics model analysis showed that the model including the Intratumor +3 mm peritumor area had the best diagnostic performance, with AUCs of 0.847 and 0.844 in the training and validation groups, respectively. The joint prediction model based on the XGBoost algorithm reached AUCs of 0.917 and 0.905 in the training and validation groups, respectively. SHAP analysis indicated that the Rad Score had the highest weight in the prediction model, playing a significant role in predicting axillary lymph node metastasis in breast cancer. CONCLUSION: The predictive model, which integrates clinical features and radiomic characteristics using the XGBoost algorithm, demonstrates significant diagnostic value for axillary lymph node metastasis in breast cancer. This model can provide significant references for preoperative surgical strategy selection and prognosis evaluation for breast cancer patients, helping to reduce postoperative complications and improve long-term survival rates. Additionally, the utilization of SHAP enhancing the global and local interpretability of the model.

Ts2O mediated deoxygenative C2-dithiocarbamation of quinoline N-oxides with CS2 and amines.

A general, efficient and practical protocol for Ts2O promoted deoxygenative dithiocarbamation of quinoline N-oxides with in situ generated dithiocarbamic acids from CS2 and amines is reported. The reaction proceeded well under transition-metal free conditions to obtain a variety of novel quinoline-dithiocarbamate compounds with wide functional group tolerance and good to high yields.

The efficacy and safety of adding PD-1 blockade to induction chemotherapy and concurrent chemoradiotherapy (IC-CCRT) for locoregionally advanced nasopharyngeal carcinoma: an observational, propensity score-matched analysis.

BACKGROUND: Despite the success of PD-1 blockade in recurrent/metastatic nasopharyngeal carcinoma (NPC), its effect for locoregionally advanced NPC (LANPC) remains unclear. This study aimed to evaluate the benefit of adding PD-1 blockade to the current standard treatment (gemcitabine and cisplatin IC  plus cisplatin CCRT ) for LANPC patients. METHODS: From January 2020 to November 2022, 347 patients with non-metastatic high-risk LANPC (stage III-IVA, excluding T3-4N0) were included. Of the 347 patients, 268 patients were treated with standard treatment (IC-CCRT), and 79 received PD-1 blockade plus IC-CCRT (PD-1 group). For the PD-1 group, PD-1 blockade was given intravenously once every 3 weeks for up to 9 cycles (3 induction and 6 adjuvant). The primary endpoint was disease-free survival (DFS) (i.e. freedom from local/regional/distant failure or death). The propensity score matching (PSM) with the ratio of 1:2 was performed to control confounding factors. RESULTS: After PSM analysis, 150 patients receiving standard treatment and 75 patients receiving additional PD-1 blockade remained in the current analysis. After three cycles of IC, the PD-1 group had significantly higher rates of complete response (defined as disappearance of all target lesions; 24% vs. 9%; P = 0.006) and complete biological response (defined as undetectable cell-free Epstein-Barr virus DNA, cfEBV DNA; 79% vs. 65%; P = 0.046) than that in the standard group. And the incidence of grade 3-4 toxicity during IC was 47% in the PD-1 group and 41% in the standard group, with no significant difference (P = 0.396). During follow-up period, additional PD-1 blockade to standard treatment improved 3-year DFS from 84 to 95%, with marginal statistical significance (HR, 0.28; 95%CI, 0.06-1.19; P = 0.064). CONCLUSION: Additiaonl PD-1 blockade to gemcitabine and cisplatin IC and adjuvant treatment results in significant improvement in tumor regression, cfEBV DNA clearance, superior DFS, and comparable toxicity profiles in high-risk LANPC patients.

A ResNet mini architecture for brain age prediction.

The brain presents age-related structural and functional changes in the human life, with different extends between subjects and groups. Brain age prediction can be used to evaluate the development and aging of human brain, as well as providing valuable information for neurodevelopment and disease diagnosis. Many contributions have been made for this purpose, resorting to different machine learning methods. To solve this task and reduce memory resource consumption, we develop a mini architecture of only 10 layers by modifying the deep residual neural network (ResNet), named ResNet mini architecture. To support the ResNet mini architecture in brain age prediction, the brain age dataset (OpenNeuro #ds000228) that consists of 155 study participants (three classes) and the Alzheimer MRI preprocessed dataset that consists of 6400 images (four classes) are employed. We compared the performance of the ResNet mini architecture with other popular networks using the two considered datasets. Experimental results show that the proposed architecture exhibits generality and robustness with high accuracy and less parameter number.

Identification of novel variations in three cases with rare inherited neuromuscular disorder.

Inherited neuromuscular disorder (IND) is a broad-spectrum, clinically diverse group of diseases that are caused due to defects in the neurosystem, muscles and related tissue. Since IND may originate from mutations in hundreds of different genes, the resulting heterogeneity of IND is a great challenge for accurate diagnosis and subsequent management. Three pediatric cases with IND were enrolled in the present study and subjected to a thorough clinical examination. Next, a genetic investigation was conducted using whole-exome sequencing (WES). The suspected variants were validated through Sanger sequencing or quantitative fluorescence PCR assay. A new missense variant of the Spastin (SPAST) gene was found and analyzed at the structural level using molecular dynamics (MD) simulations. All three cases presented with respective specific clinical manifestations, which reflected the diversity of IND. WES detected the diagnostic variants in all 3 cases: A compound variation comprising collagen type VI α3 chain (COL6A3) (NM_004369; exon19):c.6322G>T(p.E1208*) and a one-copy loss of COL6A3:exon19 in Case 1, which are being reported for the first time; a de novo SPAST (NM_014946; exon8):c.1166C>A(p.T389K) variant in Case 2; and a de novo Duchenne muscular dystrophy (NM_004006; exon11):c.1150-17_1160delACTTCCTTCTTTGTCAGGGGTACATGATinsC variant in Case 3. The structural and MD analyses revealed that the detected novel SPAST: c.1166C>A(p.T389K) variant mainly altered the intramolecular hydrogen bonding status and the protein segment's secondary structure. In conclusion, the present study expanded the IND mutation spectrum. The study not only detailed the precise diagnoses of these cases but also furnished substantial grounds for informed consultations. The approach involving the genetic evaluation strategy using WES for variation screening followed by validation using appropriate methods is beneficial due to the considerable heterogeneity of IND.

Serum bile acid and unsaturated fatty acid profiles of non-alcoholic fatty liver disease in type 2 diabetic patients.

BACKGROUND: The understanding of bile acid (BA) and unsaturated fatty acid (UFA) profiles, as well as their dysregulation, remains elusive in individuals with type 2 diabetes mellitus (T2DM) coexisting with non-alcoholic fatty liver disease (NAFLD). Investigating these metabolites could offer valuable insights into the pathophy-siology of NAFLD in T2DM. AIM: To identify potential metabolite biomarkers capable of distinguishing between NAFLD and T2DM. METHODS: A training model was developed involving 399 participants, comprising 113 healthy controls (HCs), 134 individuals with T2DM without NAFLD, and 152 individuals with T2DM and NAFLD. External validation encompassed 172 participants. NAFLD patients were divided based on liver fibrosis scores. The analytical approach employed univariate testing, orthogonal partial least squares-discriminant analysis, logistic regression, receiver operating characteristic curve analysis, and decision curve analysis to pinpoint and assess the diagnostic value of serum biomarkers. RESULTS: Compared to HCs, both T2DM and NAFLD groups exhibited diminished levels of specific BAs. In UFAs, particular acids exhibited a positive correlation with NAFLD risk in T2DM, while the ω-6:ω-3 UFA ratio demonstrated a negative correlation. Levels of α-linolenic acid and γ-linolenic acid were linked to significant liver fibrosis in NAFLD. The validation cohort substantiated the predictive efficacy of these biomarkers for assessing NAFLD risk in T2DM patients. CONCLUSION: This study underscores the connection between altered BA and UFA profiles and the presence of NAFLD in individuals with T2DM, proposing their potential as biomarkers in the pathogenesis of NAFLD.

Catalytic Hairpin Assembly-Based Self-Ratiometric Gel Electrophoresis Detection Platform for Reliable Nucleic Acid Analysis.

The development of gel electrophoresis-based biodetection assays for point-of-care analysis are highly demanding. In this work, we proposed a ratiometric gel electrophoresis-based biosensing platform by employing catalytic hairpin assembly (CHA) process functions as both the signal output and the signal amplification module. Two types of nucleic acids, DNA and miRNA, are chosen for demonstration. The proposed strategy indeed provides a new paradigm for the design of a portable detection platform and may hold great potential for sensitive diagnoses.

Apigenin suppresses epithelial-mesenchymal transition in high glucose-induced retinal pigment epithelial cell by inhibiting CBP/p300-mediated histone acetylation.

Epithelial mesenchymal transition (EMT) is a critical process implicated in the pathogenesis of retinal fibrosis and the exacerbation of diabetic retinopathy (DR) within retinal pigment epithelium (RPE) cells. Apigenin (AP), a potential dietary supplement for managing diabetes and its associated complications, has demonstrated inhibitory effects on EMT in various diseases. However, the specific impact and underlying mechanisms of AP on EMT in RPE cells remain poorly understood. In this study, we have successfully validated the inhibitory effects of AP on high glucose-induced EMT in ARPE-19 cells and diabetic db/db mice. Notably, our findings have identified CBP/p300 as a potential therapeutic target for EMT in RPE cells and have further substantiated that AP effectively downregulates the expression of EMT-related genes by attenuating the activity of CBP/p300, consequently reducing histone acetylation alterations within the promoter region of these genes. Taken together, our results provide novel evidence supporting the inhibitory effect of AP on EMT in RPE cells, and highlight the potential of specifically targeting CBP/p300 as a strategy for inhibiting retinal fibrosis in the context of DR.

Hypoglycemic TCM formulas (Huangqi-Gegen drug pair) have the potential as an Alzheimer's disease.

BACKGROUND: Alzheimer's disease (AD) is a neurological disorder. There is a considerable unmet medical need among those suffering from it. HYPOTHESIS AND PURPOSE: Given the link between type-2 diabetes mellitus (T2DM) and AD, hypoglycemic traditional Chinese medicine formulas (TCMFs) may be a treatment for AD. We investigated the possibility of identifying anti-AD medicines in hypoglycemic TCMFs and presented another option for the screening of AD medications. STUDY DESIGN AND METHODS: Paralysis of the transgenic Caenorhabditis elegans (C. elegans) strain CL4176 (caused by amyloid beta (Aß)1-42 aggregates) was used to evaluate the anti-AD effect. The toxicity and neurodegeneration induced by neuronal expression of Aß in the transgenic C. elegans strain CL2355 were determined using a 5-hydroxytryptamine (5-HT) assay. The transgenic Aß-expressing strain CL 2006 and transgenic tau-expressing strain BR5270 were used to explore the effect of TCMFs on protein expression in C. elegans using ELISAs. Then, network pharmacology was used to determine the mechanism of action. The Traditional Chinese Medicine Inheritance Support System platform was used to investigate prescription patterns, core drugs, and optimum combinations of hypoglycemic TCMFs for AD. RESULTS: Sixteen hypoglycemic TCMFs prolonged the PT50 (half paralysis time) of the CL4176 strain of C. elegans, reduced the percentage of worms paralyzed. The results of network pharmacology showed that prostaglandin-endoperoxide synthase 2 (PTGS2) and acetylcholine esterase (AChE) are main targets of hypoglycemic TCMFs. Enriched pathway analysis showed that the cholinergic receptor-related pathway was the core pathway of hypoglycemic TCMFs. According to the "four qi and five flavors" system of TCM theory, the main pharmacological qualities were "cold" and "sweet." Through the analysis by TCMISS, we found that Huangqi-Gegen drug pair as the significant Chinese herbs of hypoglycemic TCMFs. The Huangqi-Gegen pairing had the most robust therapeutic effect when delivered at a 2:1 (v/v) ratio. It reduced the paralysis caused by 5-HT, decreased protein expression of AChE and PTGS2, and reduced Aß deposition in the brain of the CL2006 strain of C. elegans. CONCLUSIONS: Huangqi-Gegen is a promising treatment of AD, and its mechanism may be induced by suppressing the protein production of AChE and PTGS2, reducing 5-HT intake, and then decreasing Aß deposition.

A filtering reconfigurable intelligent surface for interference-free wireless communications.

The powerful capability of reconfigurable intelligent surfaces (RISs) in tailoring electromagnetic waves and fields has put them under the spotlight in wireless communications. However, the current designs are criticized due to their poor frequency selectivity, which hinders their applications in real-world scenarios where the spectrum is becoming increasingly congested. Here we propose a filtering RIS to feature sharp frequency-selecting and 2-bit phase-shifting properties. It permits the signals in a narrow bandwidth to transmit but rejects the out-of-band ones; meanwhile, the phase of the transmitted signals can be digitally controlled, enabling flexible manipulations of signal propagations. A prototype is designed, fabricated, and measured, and its high quality factor and phase-shifting characteristics are validated by scattering parameters and beam-steering phenomena. Further, we conduct a wireless communication experiment to illustrate the intriguing functions of the RIS. The filtering behavior enables the RIS to perform wireless signal manipulations with anti-interference ability, thus showing big potential to advance the development of next-generation wireless communications.

E-CLEAP: An ensemble learning model for efficient and accurate identification of antimicrobial peptides.

With the increasing problem of antimicrobial drug resistance, the search for new antimicrobial agents has become a crucial task in the field of medicine. Antimicrobial peptides, as a class of naturally occurring antimicrobial agents, possess broad-spectrum antimicrobial activity and lower risk of resistance development. However, traditional screening methods for antimicrobial peptides are inefficient, necessitating the development of an efficient screening model. In this study, we aimed to develop an ensemble learning model for the identification of antimicrobial peptides, named E-CLEAP, based on the Multilayer Perceptron Classifier (MLP Classifier). By considering multiple features, including amino acid composition (AAC) and pseudo amino acid composition (PseAAC) of antimicrobial peptides, we aimed to improve the accuracy and generalization ability of the identification process. To validate the superiority of our model, we employed five-fold cross-validation and compared it with other commonly used methods for antimicrobial peptide identification. In the experimental results on an independent test set, E-CLEAP achieved accuracies of 97.33% and 84% for the AAC and PseAAC features, respectively. The results demonstrated that our model outperformed other methods in all evaluation metrics. The findings of this study highlight the potential of the E-CLEAP model in enhancing the efficiency and accuracy of antimicrobial peptide screening, which holds significant implications for drug development, disease treatment, and biotechnology advancement. Future research can further optimize the model by incorporating additional features and information, as well as validating its reliability on larger datasets and in real-world environments. The source code and all datasets are publicly available at https://github.com/Wangsicheng52/E-CLEAP.

Meiotic transcriptional reprogramming mediated by cell-cell communications in humans and mice revealed by scATAC-seq and scRNA-seq.

Meiosis is a highly complex process significantly influenced by transcriptional regulation. However, studies on the mechanisms that govern transcriptomic changes during meiosis, especially in prophase I, are limited. Here, we performed single-cell ATAC-seq of human testis tissues and observed reprogramming during the transition from zygotene to pachytene spermatocytes. This event, conserved in mice, involved the deactivation of genes associated with meiosis after reprogramming and the activation of those related to spermatogenesis before their functional onset. Furthermore, we identified 282 transcriptional regulators (TRs) that underwent activation or deactivation subsequent to this process. Evidence suggested that physical contact signals from Sertoli cells may regulate these TRs in spermatocytes, while secreted ENHO signals may alter metabolic patterns in these cells. Our results further indicated that defective transcriptional reprogramming may be associated with non-obstructive azoospermia (NOA). This study revealed the importance of both physical contact and secreted signals between Sertoli cells and germ cells in meiotic progression.

The effect of music therapy on language communication and social skills in children with autism spectrum disorder: a systematic review and meta-analysis.

Background: Studies have shown that music therapy can be used as a therapeutic aid for clinical disorders. To evaluate the effects of music therapy (MT) on language communication and social skills in children with autism spectrum disorder (ASD), a meta-analysis was performed on eligible studies in this field. Methods: A systematic search was conducted in eight databases: PubMed, Embase, Web of Science, Cochrane Library databases, the China National Knowledge Infrastructure (CNKI), Wanfang Data, the Chinese Biomedical Literature (CBM) Database, and the VIP Chinese Science and Technology Periodicals Database. The standard mean difference (SMD) values were used to evaluate outcomes, and the pooled proportions and SMD with their 95% confidence intervals (CIs) were also calculated. Results: Eighteen randomized controlled trial (RCT) studies were included, with a total of 1,457 children with ASD. This meta-analysis revealed that music therapy improved their language communication [SMD = -1.20; 95%CI -1.45, -0.94; χ2 (17) = 84.17, I2 = 80%, p < 0.001] and social skills [SMD = -1. 13; 95%CI -1.49, -0.78; χ2 (17) = 162.53, I2 = 90%, p < 0.001]. In addition, behavior [SMD = -1.92; 94%CI -2.56, -1.28; χ2 (13) = 235.08, I2 = 95%, p < 0.001], sensory perception [SMD = -1.62; 95%CI -2.17, -1.08; χ2 (16) = 303.80, I2 = 95%, p < 0.001], self-help [SMD = -2. 14; 95%CI -3.17, -1.10; χ2 (6) = 173.07, I2 = 97%, p < 0.001] were all improved. Conclusion: Music therapy has a positive effect on the improvement of symptoms in children with ASD. Systematic review registration: https://www.crd.york.ac.uk/PROSPERO/.

Chemical constituents from the Saposhnikovia divaricata and their antiproliferative activity.

Nine compounds were isolated and identified from ethanolic extracts of Saposhnikovia divaricata, including one new alkaloid (1), one new pentacyclic triterpenoid (9), and seven known alkaloids (2-8). Structural elucidation of compounds 1 and 9 was established by 1D and 2D NMR spectra referring to the literature, together with high-resolution mass spectrometric analysis. All compounds were evaluated for antiproliferative activity against two cancer cell lines (LN229, A549) in vitro. Compounds (1-9) showed no significant antiproliferative activity.