First Report of Moroccan pepper virus in Association with Yellows on Escarole in the United States and the World.

During the fall of 2013, endive (Cichorium endivia L.) and escarole (C. endivia ssp. latifolia) fields in New Jersey were found with severe disease symptoms. The cores of the heads were necrotic and rotted, while outer leaves were yellow with more pronounced yellowing of veins and occasional veinal necrosis. The disease occurred in plants grown in sandy loam soils, and developed following a period of extended soil moisture; most escarole and endive in the ground at that time developed symptoms. Similar symptoms have been observed for 15 to 20 years in the area and are commonly referred to as yellows. Initial ELISA tests (Agdia) identified tombusvirus infection in two composite samples of 10 plants each from two fields. To confirm tombusvirus infection and determine which tombusvirus was responsible, RNA was extracted from four plant samples using the RNeasy Plant Mini Kit (Qiagen). Complimentary DNA was synthesized using Maxima reverse transcriptase (Fermentas) and random primers. PCR was performed using GenScript enzymes (Genscript) and virus species specific primer sets designed to amplify a portion of the coat protein gene of either Tomato bushy stunt virus (TBSV) or Moroccan pepper virus (MPV) (2,3), the two tombusviruses responsible for a disease of lettuce that develops under similar environmental conditions. All samples tested negative for TBSV, but one sample of escarole was positive for MPV using primers MPVcp2766F 5' CGGTAAGATTGTAGGGTTCATGGTGG 3'; and MPVcp3603R 5' TGCTCCAGTGTCACGGAAGT 3', which amplify an 837-nt section of the MPV coat protein gene. Direct sequencing confirmed 94% identity with an isolate of MPV from Japan (AB704411) and 97% identity to isolates from Morocco (JX197071) and California (JN700748) (3). Secondary confirmation was obtained with an additional primer set designed to amplify a 372-nt region of ORF1 of select tombusviruses (Tombus270F 5' TGAGATACATGAGGACAGG 3'; and Tombus642R 5' AGCTTAAATACCGACAGTT 3'). Direct sequencing confirmed 96 (AB704411) to 99% (JX197071) identity to MPV isolates from Japan and Morocco, respectively. Eight additional samples of symptomatic escarole from three farms were tested, and two samples reacted positive to MPV using the methods described above. Attempts at mechanical transmission of virus from escarole to known hosts of MPV were unsuccessful; however, transmission of MPV from infected lettuce (Lactuca sativa L.) is often low efficiency as well; therefore, this result was not surprising. To our knowledge, this is the first report of MPV in escarole anywhere in the world, and the first report of MPV in a United States field crop outside of California and Arizona. MPV and TBSV are known to cause the disease, lettuce dieback, in the western United States. Like yellows on escarole, lettuce dieback is associated with saturated soils (1) and other stress factors (Wintermantel, unpublished). Further studies will be needed to determine if MPV is the sole cause of yellows in escarole and endive or if it is part of a disease complex; however, the identification of MPV in this important leafy greens production region and its association with yellowing and core rot symptoms in escarole warrant further study of the association of MPV and potentially other tombusviruses with yellows of escarole. References: (1) C. Obermeier et al. Phytopathology 91:797, 2001. (2) W. M. Wintermantel and A. G. Anchieta. Arch. Virol. 157:1407, 2012. (3) W. M. Wintermantel and L. L. Hladky. Phytopathology 105:501, 2013.

First Report of Alfalfa mosaic virus Infecting Basil (Ocimum basilicum) in California.

Basil (Ocimum basilicum L.) plants collected from three fields in Imperial County, CA in May, 2011 were found to be exhibiting yellowing, chlorotic sectors and spots on leaves, resulting in unmarketable plants. Dodder (Cuscuta spp.) was present in one of the fields, but was not visibly associated with symptomatic plants. Total nucleic acid was extracted from four symptomatic and three asymptomatic basil plants, as well as from the dodder plant with the RNeasy Plant Mini Kit (Qiagen, Valencia, CA). Nucleic acid extracts were tested by reverse transcription (RT)-PCR for the presence of Alfalfa mosaic virus (AMV) using primers designed to amplify a 350-nt region of the AMV coat protein gene (3). RT-PCR produced bands of the expected size in extracts from all symptomatic plants and the dodder sample. No amplification was obtained from symptomless plants. A 350-nt band amplified from one plant was gel-extracted, sequenced (TACGen, Richmond, CA), and confirmed to be AMV by comparison to sequences available in GenBank (Accession No. K02703). Although serological tests on an initial basil sample were negative for AMV by ELISA using antiserum produced against AMV by R. Larsen, USDA-ARS, Prosser, WA (unpublished), AMV was confirmed by ELISA and RT-PCR in symptomatic Nicotiana benthamiana, N. clevelandii, and Malva parviflora plants following mechanical transmission from basil source plants. The fields with AMV infections were located at opposite ends of the production region from one another, indicating widespread dispersal of AMV in the region. All AMV positive plants were adjacent to alfalfa. Two additional basil plantings in shade houses open to the outside environment did not have AMV symptomatic plants and were also confirmed negative by RT-PCR, but these plantings were at the extreme north end of Imperial Valley agriculture and well away from any alfalfa fields. At the time the basil plantations were sampled for AMV, no aphids were found in any plantations, but during the several weeks prior to finding the AMV-positive plants, cowpea aphid, Aphis craccivora Koch; pea aphid, Acyrthosiphon pisum Harris; blue alfalfa aphid, Acyrthosiphon kondoi Shinji; and spotted alfalfa aphid, Therioaphis maculata Buckton were colonizing Imperial Valley alfalfa fields, producing winged adults. AMV is transmitted by at least 14 aphid species (1), and most aphid populations increase during the late spring in this important desert agricultural region. The acquisition of AMV by dodder suggests the parasitic plant may serve as a vector of AMV within basil fields, although further study will be necessary for clarification. Significant acreage of basil is grown in the Imperial Valley. This acreage is surrounded by extensive and increasing alfalfa production totaling 55,442 ha (137,000 acres) in Imperial County and representing a 21% increase in acreage over 2009 for the same region (2). To our knowledge, this is the first report of basil infected by AMV in California. The proximity of basil production to such a large alfalfa production region warrants the need for enhanced efforts at aphid management in basil production to reduce vector populations and reduce transmission to basil crops. References: (1) E. M. Jaspars and L. Bos. Alfalfa mosaic virus. No. 229 in: Descriptions of Plant Viruses. Commonw. Mycol. Inst./Assoc. Appl. Biol., Kew, England, 1980. (2) C. Valenzuela. Imperial County California Crop and Livestock Report, 2010. (3) H. Xu and J. Nie. Phytopathology 96:1237, 2006.

Curly top survey in the Western United States.

Curly top in sugar beet continues to be a challenging disease to control in the western United States. To aid in development of host resistance and management options, the curtovirus species composition was investigated by sampling 246 commercial fields along with nursery and field trials in the western United States. DNA was isolated from leaf samples and the species were identified using species-specific polymerase chain reaction primers for the C1 gene. Amplicons from 79 isolates were also sequenced to confirm identifications. Beet severe curly top virus (BSCTV) and Beet mild curly top virus (BMCTV) were widely distributed throughout the western United States, while only a few isolates of Beet curly top virus (BCTV) were found. In phylogenetic analysis, BSCTV, BMCTV, and BCTV isolates formed distinct groups in the dendrogram. Seven isolates not amplifiable with species-specific primers did amplify with curly top coat protein primers, indicating novel curtovirus species or strains may be present. Given the wide host range of the viruses responsible for curly top, frequent co-infections, and genetic diversity within and among species, establishing better host resistance, and controlling curly top will continue to be a challenge.

First Report of Cucurbit yellow stunting disorder virus in Cucurbits in Florida.

In August and September 2007, watermelon plants (Citrullus lanatus L.) in commercial fields in Manatee and Hillsborough counties in Florida exhibited stunting, deformation, interveinal chlorosis, and leaf mottling. Adult and immature whiteflies (Bemisia tabaci biotype B) were observed. Leaf samples were collected from seven watermelon and two squash plants showing different combinations of symptoms. Total RNA was extracted using RNeasy Plant Mini Kit (Qiagen, Valencia, CA) and subjected to reverse transcription (RT)-PCR for the presence of criniviruses using primers specific to regions of the Cucurbit yellow stunting disorder virus (CYSDV) genome encoding the coat protein (CysCP5206F 5' TTTGGAAAAGAACCTGACGAG 3'; CysCP5600R 5' TTCATCAACAGATTGGCTGC 3') and HSP70h genes (2). Total nucleic acids were extracted using Gentra Puregene Kit (Qiagen) and subjected to PCR for the presence of begomoviruses using the degenerate primer pairs AC1048 and AV494, designed to amplify a region of the begomovirus coat protein gene (4), and PBL1v2040 and PCRc154, designed to amplify a region of the hypervariable region of the begomovirus B component (3). RT-PCR amplified the expected 394-bp fragment of the coat protein gene from three symptomatic plants (one squash, two watermelon) and from CYSDV-infected control plants but not from healthy controls. Similarly, the 175-bp HSP70h fragment was amplified from the same samples and from CYSDV-infected control plants but not from healthy controls. The coat protein amplicon was sequenced from one of the Manatee County isolates (GenBank Accession No. EU596528) and the 344 nt sequenced portion of the amplicon was found to be 100% identical to sequences of CYSDV from Texas, California, Jordan, and France (GenBank Accession Nos. AF312823, EU596529, DQ903107, and AY204220, respectively) and shared 99% identity with an isolate from Spain (GenBank Accession No. NC_004810), but only 91% with an isolate from Iran (GenBank Accession No. AY730779). The begomovirus primer pair pBL1v2040 and PCRc154 produced a 678-bp amplicon that is consistent with the presence of a bipartite begomovirus in all nine samples. Sequence analysis of four of the 678-bp amplicons revealed that all had greater than 97% sequence identity to isolates of Cucurbit leaf crumple virus (CuLCrV) from Arizona (GenBank Accession No. AF327559) and California (GenBank Accession No. AF224761). These results are similar to those reported in the first detection of CuLCrV in Florida in 2006 (1). In October 2007, CYSDV was detected in squash plants (Cucurbita pepo L.) in two additional fields in Manatee and Hillsborough counties, and additional fields with CYSDV-like symptoms have been observed with increasing frequency throughout the region. The appearance of CYSDV in Florida follows the recent emergence of CYSDV in California and Arizona and Sonora, Mexico in 2006 where the CYSDV infection of fall melons resulted in severe economic losses (2). The emergence of CYSDV in Florida, where the vector B. tabaci biotype B is well established, warrants concern for all cucurbit production in the southern United States. Disease monitoring efforts are in progress to determine the extent, severity, and impact of CYSDV on Florida cucurbit production. References: (1) F. Akad et al. Plant Dis.92:648, 2008. (2) Y.-W. Kuo et al. Plant Dis. 91:330, 2007. (3) M. R. Rojas et al. Plant Dis. 77:340, 1993. (4) S. D. Wyatt and J. K. Brown. Phytopathology 86:1288, 1996.

First Report of Cucurbit yellow stunting disorder virus in California and Arizona, in Association with Cucurbit leaf crumple virus and Squash leaf curl virus.

In August and September of 2006, melon plants (Cucumis melo L.) near Niland in California's Imperial Valley and near Yuma, AZ began exhibiting interveinal chlorosis and leaf mottling and spotting, symptoms resembling those resulting from infection by viruses of the genus Crinivirus, family Closteroviridae (4). Some plants also exhibited leaf crumpling and curling, symptoms characteristic of begomovirus (genus Begomovirus, family Geminiviridae) infection. Leaves of plants had large populations of silverleaf whitefly (Bemisia tabaci biotype B), a known vector of begomoviruses and some criniviruses. Leaf samples were collected from four plants from California and 13 plants from three separate fields in Arizona. Total RNA was extracted using RNeasy kits (Qiagen, Valencia, CA) and subjected to reverse transcription (RT)-PCR using degenerate primers specific to the conserved polymerase region of a diverse group of criniviruses (3). The expected 500-bp RT-PCR product was amplified from RNA obtained from all the symptomatic melons, whereas no fragment was obtained from RNA extracted from leaves of healthy controls. The 500-bp fragment from four plants from California and five plants from Arizona was sequenced and found to be identical for all nine isolates (GenBank Accession No. EF121768). The sequenced region of the California and Arizona Cucurbit yellow stunting disorder virus (CYSDV) isolates was identical to that from a CYSDV isolate from Texas (GenBank Accession No. AY242077) and shared 99% identity with a CYSDV isolate from Spain (GenBank Accession No. AJ537493). Subsequent RT-PCR analysis of RNA from these nine plants, with primers specific to the capsid protein (CYScp1F 5' GCACGGTGACCAAAAGAAG 3' and CYScp1R 5' GAA-CATTCCAAAACTGCGG 3') and HSP70h (CYShspF 5' TGATGTATG-ACTTCGGAGGAGGAAC 3' and CYShspR 5' TCAGCGGACAAA-CCACCTTTC 3') genes of CYSDV, was used to further confirm virus identity. The expected fragments, 202 and 175 bp, respectively, were amplified from all nine samples, but not from healthy controls. DNA extracts also were prepared from these nine melon samples from California and Arizona, and PCR assays were conducted for the begomoviruses Cucurbit leaf crumple virus (CuLCrV) and Squash leaf curl virus (SLCV) (2). The four plants from California showed crumpling, curling, and yellowing symptoms; all were infected with SLCV and one with CuLCrV. The five plants from Arizona showed mostly yellowing symptoms; five were infected with SLCV and two with CuLCrV. These results demonstrate begomovirus and crinivirus co-infection. The economic impact of mixed infections with CYSDV and begomoviruses remains to be determined. Incidence of CYSDV in melon was directly correlated with incidence of its vector, B. tabaci. Host range information has demonstrated that the primary hosts of CYSDV are members of the Cucurbitaceae (1). A number of experimental hosts have been documented; however, the extensive vegetable production in the southwestern United States warrants further study on the potential for the establishment of local reservoirs in both crop and weed species in the area. The virus causes economic losses worldwide for curcurbit production. References: (1) A. Celix et al. Phytopathology 86:1370, 1996. (2) R. Gilbertson. Ann. Rep. CA Melon Res. Board, 2001. (3) R. Martin et al. Acta Hortic. 656:137, 2004. (4) G. Wisler et al. Plant Dis. 82:270. 1998.

First Report of Beet pseudo-yellows virus and Strawberry pallidosis associated virus in Strawberry in Peru.

During a 2006 survey for the presence of criniviruses in Peru, large numbers of greenhouse whitefly (Trialeurodes vaporariorum) were observed infesting strawberry (Fragaria × ananassa) fields near Huaral on the central coast of Peru. Plants exhibited a wide range of symptoms including stunting and reddening of leaves. These symptoms are characteristic of those induced by the presence of the criniviruses Beet pseudo-yellows virus (BPYV) and/or Strawberry pallidosis associated virus (SPaV) together with any of a number of different strawberry-infecting viruses (1,3). The virus complex causes older leaves to develop a red color, vein and petiole reddening, roots become stunted, and plants fail to develop. Leaf samples with varying symptoms were collected from 22 plants from 2 fields, each planted with a different cultivar. Total nucleic acid was extracted, spotted onto positively charged nylon membranes, and tested by hybridization with probes specific to the minor coat protein (CPm) gene of BPYV (2) and coat protein (CP) gene of SPaV (4). Results identified the presence of BPYV, SPaV, or both viruses in mixed infections in symptomatic strawberry, while control plants were infected with each virus individually. No signal was detected in virus-free strawberry. Secondary confirmation was obtained using probes specific to the RNA-dependent RNA polymerase (RdRp) genes of SPaV and BPYV. The SPaV probe corresponded to nucleotides 6116-6599 of SPaV RNA1 (GenBank Accession No. NC_005895), whereas the BPYV probe corresponded to nucleotides 6076-6447 of BPYV RNA1 (GenBank Accession No. NC_005209). All probes were generated by reverse-transcription polymerase chain reaction (RT-PCR) amplification using sequence-specific primers, cloning of RT-PCR products into pGEM-T Easy (Promega, Madison, WI), confirmation by sequencing, and expression as digoxygenin-labeled transcript probes (Roche, Indianapolis, IN). Field 1, containing cv. Fern Sancho, had the largest number of symptomatic and infected plants (5 of 12 BPYV, 6 of 12 SPaV, and 4 of 12 with both). Only 1 of 10 plants from field 2 containing cv. Tajo Holandesa was infected, but with both SPaV and BPYV. BPYV and SPaV are transmitted by the greenhouse whitefly (T. vaporariorum), although BPYV is transmitted much more efficiently and has a broader host range than SPaV (4). Movement of these viruses in Peru is likely a result of both propagation by runners and vector transmission. To our knowledge, this is the first report of either virus in Peru. References: R. R Martin and I. E. Tzanetakis. Plant Dis. 90:384, 2006. (2) I. E. Tzanetakis and R. R. Martin. Plant Dis. 88:223, 2004. (3) I. E. Tzanetakis et al. Plant Dis. 87:1398, 2003. (4) I. E. Tzanetakis et al. Plant Dis. 90:1343, 2006.

The complete nucleotide sequence and genome organization of tomato chlorosis virus.

The crinivirus tomato chlorosis virus (ToCV) was discovered initially in diseased tomato and has since been identified as a serious problem for tomato production in many parts of the world, particularly in the United States, Europe and Southeast Asia. The complete nucleotide sequence of ToCV was determined and compared with related crinivirus species. RNA 1 is organized into four open reading frames (ORFs), and encodes proteins involved in replication, based on homology to other viral replication factors. RNA 2 is composed of nine ORFs including genes that encode a HSP70 homolog and two proteins involved in encapsidation of viral RNA, referred to as the coat protein and minor coat protein. Sequence homology between ToCV and other criniviruses varies throughout the viral genome. The minor coat protein (CPm) of ToCV, which forms part of the "rattlesnake tail" of virions and may be involved in determining the unique, broad vector transmissibility of ToCV, is larger than the CPm of lettuce infectious yellows virus (LIYV) by 217 amino acids. Among sequenced criniviruses, considerable variability exists in the size of some viral proteins. Analysis of these differences with respect to biological function may provide insight into the role crinivirus proteins play in virus infection and transmission.

First Report of Tomato chlorosis virus in Israel.

During December 2003, symptoms were observed in greenhouse tomato plants in Bet Dagan, Israel that resembled those of Tomato chlorosis virus (ToCV), a crinivirus common in the southeastern United States and southern Europe (2,3). Middle-aged leaves showed interveinal chlorosis, while more mature leaves showed more intense interveinal chlorosis with some interveinal bronzing. Symptoms were associated with the presence of Bemisia tabaci, an efficient vector of ToCV. Total nucleic acids were extracted (1) from middle-aged and mature leaves from two symptomatic plants, as well as from healthy tomato, Physalis wrightii infected with ToCV, and Nicotiana benthamiana infected with Tomato infectious chlorosis virus (TICV), another crinivirus that produces identical symptoms on tomato. Extracts were tested using hybridization with probes specific to the coat protein (CP) gene of ToCV and the HSP70h gene of TICV. Hybridization results identified the presence of ToCV in all samples from symptomatic tomato plants and ToCV-infected P. wrightii, but not in those from healthy tomato or TICV-infected N. benthamiana. TICV was only detected in TICV-infected N. benthamiana. Extracts were also subjected to reverse transcription-polymerase chain reaction using primers specific to the CP gene of ToCV (GenBank Accession No. AY444872; Forward primer: 5' ATGGAGAACAGT GCCGTTGC 3'; Reverse Primer: 5' TTAGCAACCAGTTATCGATGC 3'). All samples from symptomatic tomato and ToCV-infected P. wrightii produced amplicons of the expected size, but no amplicons were produced from extracts of healthy tomato. Laboratory results and observed symptoms confirm the presence of ToCV in symptomatic tomatoes. To our knowledge, this is the first report of ToCV in Israel. References: (1) S. Dellaporta et al. Plant Mol. Biol. Rep. 1:19, 1983. (2) J. Navas-Castillo et al. Plant Dis. 84:835, 2000. (3) G. C. Wisler et al. Phytopathology 88:402, 1998.

Pumpkin (Cucurbita maxima and C. pepo), a new host of Beet pseudo yellows virus in California.

In the summer of 2002, pumpkin plants (Cucurbita pepo L. and C. maxima Duchesne) with extensive leaf chlorosis similar to those observed in crinivirus infections were found in fields at two locations in Monterey County, California. Leaves of diseased plants were observed to have large populations of the greenhouse whitefly (Trialeurodes vaporariorum) present. Double-stranded RNA was extracted from symptomatic leaves of these plants and tested by northern hybridization for numerous criniviruses. A positive signal was identified exclusively with probes against the HSP70h gene of Beet pseudo yellows virus (BPYV) and confirmed by reverse transcription-polymerase chain reaction (RT-PCR) amplification of a 335-nucleotide section of the BPYV minor coat protein (CPm) gene (3). Similar symptoms were observed in additional fields in 2003, and BPYV was again confirmed. In addition, the CPm RT-PCR product was cloned into a TOPO pCR2 vector (Invitrogen, Carlsbad, CA) and sequenced. BLAST analysis of the cloned CPm RT-PCR product sequence corresponded to the published sequence of the CPm gene of BPYV (98%) (3) and Cucumber yellows virus (CuYV), a recently sequenced crinivirus considered to be a strain of BPYV (97%) (2). Incidence of BPYV in pumpkin appears to be variable and probably corresponds to the incidence of viruliferous whiteflies. On the basis of foliar symptoms, BPYV incidence varied from less than 50% in these fields in 2002 to nearly 100% infection of a large commercial field in 2003. BPYV is transmitted semipersistently by the greenhouse whitefly and has an extensive host range (1). The virus causes economic losses worldwide for greenhouse vegetable production and is becoming an increasing problem for field crops in areas of high greenhouse whitefly incidence (3). The impact of BPYV on pumpkin production remains to be determined; however, grower data suggests an increased incidence of fruit abortion and a substantial decrease in fruit weight. To our knowledge, this is the first report of BPYV infecting pumpkin. References: (1) J. E. Duffus. Phytopathology 55:450, 1965. (2) S. Hartono et al. J. Gen. Virol. 84:1007, 2003. (3) I. E. Tzanetakis et al. Plant Dis. 87:1398, 2003.

First Report of Beet pseudo yellows virus in Strawberry in the United States: A Second Crinivirus Able to Cause Pallidosis Disease.

During efforts to characterize strawberry pallidosis disease, we identified a single strawberry plant that indexed positive for pallidosis disease by grafting but it was not infected with the Strawberry pallidosis associated virus (SPaV) based on reverse transcription-polymerase chain reaction (1). Leaves of this plant were grafted onto Fragaria vesca UC-4 and UC-5 and F. virginiana UC-10 and UC-11 indicator plants. The F. vesca plants remained asymptomatic, while the F. virginiana plants gave typical pallidosis symptoms that included marginal leaf chlorosis and epinasty. The combination of these symptoms on F. virginiana and lack of symptoms on F. vesca is used to define pallidosis disease (1). We extracted dsRNA from the original plant, and synthesized and cloned cDNA as previously described (2). Sequence analysis revealed several clones that corresponded to the published sequence of the Beet pseudo yellows virus (BPYV) heat shock protein 70 homolog gene (HSP70h). We transferred the isolate to Nicotiana benthamiana by using the whitefly vector, Trialeuroides vaporariorum, and then reisolated and cloned dsRNA from the infected N. benthamiana. Here we present the complete sequence of the HSP70h and minor coat protein (CPm) genes of the strawberry isolate of BPYV (GenBank Accession Nos. AY 267369 and AY 268107, respectively). Oligonucleotide primers BP CPm F (5' TTCATATTAAGGATGCGCAGA 3') and BP CPm R (5' TGAAAG- ATGTCCACTAATGATA 3') were designed to amplify a 334-nucleotide fragment of the CPm gene of the strawberry isolate of BPYV. Using this primer set, we were able to verify the presence of BPYV in 1- to 3-year-old plants from the major strawberry producing areas of the United States, including California, Oregon, and the Mid-Atlantic States. Infection rates were highest near Watsonville, CA where more than 20% of plants tested were infected with BPYV. To our knowledge, this is the first report of BPYV infecting strawberry. BPYV and the closely related SPaV (2) pose new concerns for the U.S. strawberry industry. Studies are currently underway to determine the effects of these two viruses on strawberry vigor and productivity. References: (1) N. W. Frazier and L. L. Stubbs. Plant Dis. Rep. 53:524, 1969. (2) I. E. Tzanetakis et al. (Abstr.) Phytopathology 92:S82, 2002.

Interactions Between Beet necrotic yellow vein virus and Beet soilborne mosaic virus in Sugar Beet.

Soils naturally infested with cultures of aviruliferous Polymyxa betae and viruliferous P. betae carrying two sugar beet benyviruses, Beet necrotic yellow vein virus (BNYVV) and Beet soilborne mosaic virus (BSBMV), alone and in combination, were compared with noninfested soil for their effects on seedling emergence, plant fresh weight, and virus content as measured by enzyme-linked immunosorbent assay (ELISA). Studies examined sugar beet with and without resistance to the disease rhizomania, caused by BNYVV. The Rz gene, conferring resistance to BNYVV, did not confer resistance to BSBMV. BSBMV ELISA values were significantly higher in single infections than in mixed infections with BNYVV, in both the rhizomania-resistant and -susceptible cultivars. In contrast, ELISA values of BNYVV were high (8 to 14 times the healthy mean) in single and mixed infections in the rhizomania-susceptible cultivar, but were low (approximately three times the healthy mean) in the rhizomania-resistant cultivar. Results indicate BNYVV may suppress BSBMV in mixed infections, even in rhizomania-resistant cultivars in which ELISA values for BNYVV are extremely low. Soils infested with P. betae, and with one or both viruses, showed significantly reduced fresh weight of seedlings, and aviruliferous P. betae significantly decreased sugar beet growth in assays.

First Report of Rhizomania of Sugar Beet in the Columbia River Basin of Washington and Oregon.

Rhizomania, caused by Beet necrotic yellow vein virus (BNYVV) and vectored by the soilborne fungus, Polymyxa betae Keskin, is one of the most economically damaging diseases affecting sugar beet (Beta vulgaris L.) worldwide and has been found in most sugar beet-growing areas of the United States (2). During harvest in October 2000, sugar beet plants exhibiting typical symptoms of rhizomania (1) were found in a field near Paterson, WA. Sugar beet had been planted in the field in 1999 and 2000, but prior to this, the field had not been planted with sugar beet for approximately 20 years. Symptomatic roots from the field exhibited stunting, vascular discoloration, and proliferation of lateral rootlets. Leaves of affected plants were chlorotic. Four soil samples were taken from symptomatic areas of the field and diluted with an equal amount of sterile sand. Seeds of rhizomania-susceptible sugar beet cv. Beta 8422 were planted in the soil and sand mix and maintained in a controlled environment at 24°C and 12 h of daylight at one location and in the greenhouse at another. After 8 weeks, enzyme-linked immunosorbent assay (ELISA) was performed on roots of plants grown at each location. Triple-antibody sandwich (TAS) ELISA (Agdia, Inc., Elkhart, IN) was conducted at the University of Idaho, Twin Falls, ID and double-antibody sandwich (DAS) ELISA was performed at USDA-ARS, Salinas, CA, with antiserum specific for BNYVV (2). Two of four samples were positive for BNYVV in the ELISA tests at both locations based on absorbance values at least three times those of healthy controls. TAS-ELISA tests were conducted on roots collected in July 2001 from a field in Washington, 12.9 km from the first field, as well as from a field across the Columbia River near Boardman, OR. Samples from both fields tested positive for BNYVV. All three fields are within 24 km of one another. Four additional fields have subsequently been confirmed to be infected with BNYVV in this region, based on symptomology and ELISA. There are approximately 3,240 ha of sugar beet grown in the region, and growers have been advised as a result of this confirmation to plant resistant cultivars and increase the sugar beet rotation interval with nonhost crops to a minimum of 4 years. References: (1) J. E. Duffus. Rhizomania. Pages 29-30 in: Compendium of Beet Diseases and Insects. E. D. Whitney and J. E. Duffus, eds. The American Phytopathological Society, St. Paul, MN, 1986. (2) G. C. Wisler et al. Plant Dis. 83:864, 1999.

First Report of Tomato chlorosis virus in Puerto Rico.

Symptoms of interveinal chlorosis, necrotic flecking, thickening, and rolling of leaves were observed on leaves of field-grown tomato (Lycopersicon esculentum) plants in Jauna Diaz, Puerto Rico. These symptoms are indicative of those produced by the whitefly-transmitted criniviruses, Tomato infectious chlorosis virus (TICV) and Tomato chlorosis virus (ToCV) (1). Samples collected from two symptomatic plants were examined by leaf dip and were found to contain long flexuous rods approximately 800 nm in length, characteristic of criniviruses. Symptomatic leaves were used for extraction of total nucleic acid and for whitefly transmission studies. The greenhouse whitefly, Trialeurodes vaporariorum (Westwood), is a highly efficient vector of TICV, but an inefficient vector of ToCV, whereas the banded wing whitefly, T. abutilonea (Haldeman), is an efficient vector of ToCV but does not transmit TICV (2). Whiteflies of both species were allowed to feed separately on symptomatic tomato leaves for 24 h and then transferred to healthy Physalis wrightii and Nicotiana benthamiana indicator plants. Symptoms characteristic of ToCV infection developed on 3 of 3 P. wrightii plants and 2 of 3 N. benthamiana plants following transmission by T. abutilonea. Only 1 of 3 P. wrightii plants developed such symptoms following transmission by T. vaporariorum, while no N. benthamiana plants developed symptoms, suggesting that the virus responsible for the tomato disease was ToCV. Dot blot hybridizations were performed on total nucleic acids extracted from 0.1 g of symptomatic leaves of field samples using probes specific for TICV or ToCV (2), as well as probes specific for four additional criniviruses. Symptomatic and asymptomatic leaves of plants in transmission tests, as well as comparable leaves from control plants, were also tested by dot blot. Although no criniviruses could be detected by dot blot in the original tomato tissue, these hybridizations identified ToCV in all symptomatic plants from the transmission experiments, confirming the presence of ToCV in Puerto Rico. No additional criniviruses were detected in any samples, and negative controls were virus-free. This is the first time a tomato crinivirus has been detected in the Caribbean, outside of the continental United States. The ability of ToCV to be transmitted by four different whitefly species increases the potential for this virus to spread throughout the Caribbean Basin. References: (1) G. C. Wisler et al. Plant Dis. 82:270, 1998. (2) G. C. Wisler et al. Phytopathology 88:402, 1998.

Transgene translatability increases effectiveness of replicase-mediated resistance to cucumber mosaic virus.

Transgenic tobacco plants expressing an altered form of the 2a replicase gene from the Fny strain of Cucumber mosaic virus (CMV) exhibit suppressed virus replication and restricted virus movement when inoculated mechanically or by aphid vectors. Additional transformants have been generated which contain replicase gene constructs designed to determine the role(s) of transgene mRNA and/or protein in resistance. Resistance to systemic disease caused by CMV, as well as delayed infection, was observed in several lines of transgenic plants which were capable of expressing either full-length or truncated replicase proteins. In contrast, among plants which contained nontranslatable transgene constructs, only one of 61 lines examined exhibited delays or resistance. Once infected, plants never recovered, regardless of transgene translatability. Transgenic plants exhibiting a range of resistance levels were examined for transgene copy number, mRNA and protein levels. Although ribonuclease protection assays demonstrated that transgene mRNA levels were very low, resistant lines had consistently more steady-state transgene mRNA than susceptible lines. Furthermore, chlorotic or necrotic local lesions developed on the inoculated leaves of transgenic lines containing translatable transgenes, but not on inoculated leaves of lines containing nontranslatable transgenes. These results demonstrate that translatability of the transgene and possibly expression of the transgene protein itself facilitates replicase-mediated resistance to CMV in tobacco.

Cucumber mosaic virus is restricted from entering minor veins in transgenic tobacco exhibiting replicase-mediated resistance.

Transgenic tobacco plants expressing an altered form of the 2a replicase gene from cucumber mosaic virus (CMV) strain Fny exhibited a suppression of viral replication and restricted viral movement when inoculated mechanically or by insect vectors. Resistant plants could be infected, however, through a graft-union with an infected nontransformed plant. The infectious entity moved quickly through intergrafts of resistant tissue, indicating that it could move without replicating in the vascular system. Viral replication continued to be suppressed in systemically infected transgenic portions of grafted plants, as demonstrated by the synthesis of lower levels of viral RNA than in systemically infected nontransformed portions of the same grafted plants. Cell-to-cell spread within this tissue also occurred much more slowly than in nontransformed tobacco. Young inoculated levels of transgenic-resistant plants exhibited limited cell-to-cell virus movement, revealed as chlorotic lesions, but no long-distance virus movement occurred. The results of in situ hybridization studies on these lesions indicated that CMV RNA does not traffic from bundle-sheath cells to vascular parenchyma or companion cells in chlorotic lesions on the inoculated leaves of transgenic-resistant tobacco plants. The inhibition of long-distance movement was a consequence of restricted entry of the infectious entity into the vascular system.

Light-dependent systemic infection of solanaceous species by cauliflower mosaic virus can Be conditioned by a viral gene encoding an aphid transmission factor.

Gene II of cauliflower mosaic virus (CaMV), which encodes an 18-kDa protein originally identified as an aphid transmission factor (ATF), influences host specificity in a light-dependent manner. A point mutation within the ATF gene that occurs in several CaMV strains was responsible for conditioning light-dependent systemic infections. A point mutant of CaMV strain W260 that carried the single mutation within the ATF gene was able to systemically infect Nicotiana bigelovii at low light intensity (100-180 micromol m-2 sec-1), but not at a higher light intensity level (350-450 micromol m-2 sec-1), while the wild-type W260 virus could systemically infect N. bigelovii under both light conditions. The same point mutation also affected the stability of the amorphous CaMV inclusions and previous studies have shown that it abolishes transmission of CaMV by aphids. The point mutation within the ATF gene that mediated light-dependent infections was complemented by transgenic N. bigelovii plants that express the CaMV gene VI product, a viral protein that has been identified as a translational transactivator. The complementation studies indicated that the ATF gene may influence systemic infections through an interaction with the CaMV gene VI product. The ATF gene of CaMV may contribute to viral infections by regulating expression of downstream genes or by influencing cell-to-cell or long distance movement within the plant.

Isolation of recombinant viruses between cauliflower mosaic virus and a viral gene in transgenic plants under conditions of moderate selection pressure.

We demonstrate that recombinant viruses formed between a wild-type virus and a viral transgene can be isolated from transgenic plants under conditions of moderate to weak selection pressure. We inoculated cauliflower mosaic virus (CaMV) strain W260 to transgenic Nicotiana bigelovii plants that expressed a copy of CaMV gene VI derived from CaMV strain D4, a gene that determines systemic infection of solanaceous species, including N. bigelovii. Because W260 infects nontransformed N. bigelovii systemically, a recombinant virus formed between W260 and the D4 transgene would be expected to have little selective advantage over the wild-type W260 virus W260 was inoculated to approximately 100 plants each of nontransformed and transgenic N. bigelovii and it systemically infected nearly all of the plants. An analysis of viral DNA recovered from 23 transgenic plants infected with W260 revealed that 20 infections resulted from the systemic movement of the wild-type W260 virus, while a recombinant between W260 and the D4 transgene was detected in three of the infections. To determine the percentage of recovery of recombinant viruses under strong selection pressure, we inoculated approximately 100 nontransformed and 100 D4 gene VI transgenic plants with CaMV strain CM1841, a virus that is unable to infect nontransformed N. bigelovii. CM1841 infected 36% of the transgenic plants systemically, but none of the nontransformed controls. An analysis of 24 infected plants showed that a recombination event occurred in every plant, demonstrating that under strong selection conditions, the recovery of CaMV recombinants from transgenic plants can be very high.

Expansion of Viral Host Range through Complementation and Recombination in Transgenic Plants.

We have shown previously that gene VI of cauliflower mosaic virus (CaMV) strain D4 governs systemic infection of Nicotiana bigelovii and that transgenic N. bigelovii expressing the D4 gene VI product can complement at least one CaMV isolate for long-distance transport. We have now found that DNA of two other isolates of CaMV recombine with the gene VI coding sequence present in the transgenic plants. The formation of recombinant viruses occurs as a consequence of CaMV replication, involving two template switches during reverse transcription of the CaMV RNA to DNA. The first template switch occurs at the 5[prime] end of the 35S RNA to the gene VI mRNA produced by the transgenic plants. A second switch occurs at the 5[prime] end of the gene VI mRNA back to the 35S RNA. We also demonstrate that CaMV can acquire sequences from transgenic plants that alter the symptomatology and host range of the virus, an observation that may have important risk assessment implications for strategies using pathogen-derived resistance to protect plants against virus diseases.