Five Species of Xanthomonads Associated with Bacterial Leaf Spot Symptoms in Tomato from Tanzania.

From 2008 to 2010, leaf spot symptoms were observed on tomato (Solanum lycopersicum Mill.) plants growing in the northern, central and southern highland regions of Tanzania. Symptoms were dark, circular to irregular, water-soaked spots surrounded by chlorotic halos. A total of 136 yellow-pigmented, gram-negative bacteria were isolated from 117 symptomatic plants on nutrient agar. Loopfuls from 24-h-old bacterial cultures were suspended in 500 µl of sterile distilled water and 50 µl of the suspensions were printed on strips of 3MM Whatman chromatography paper. Isolates belonging to the genus Xanthomonas were subsequently identified by PCR amplification of a 402-bp fragment of the Xanthan synthesis pathway gene, gumD (primers: X-gumD-fw 5'GGCCGCGAGTTCTACATGTTCAA and X-gumD-rv 5'CACGATGATGCGGATATCCAGCCACAA). Thirty of the 136 isolates reacted positively in gumD PCR. Pathogenicity of the 30 gumD-positive isolates was confirmed by spraying cell suspensions containing 108 CFU/ml (OD600 = 0.01) of each isolate on four 14-day-old tomato seedlings (cv. Tanya) and sweet pepper (Capsicum annuum L.) cv. Early-Calwonder in a growth chamber at 28 ± 2°C and maintained under humid conditions. Plants sprayed with X. euvesicatoria, X. vesicatoria, X. perforans, and X. gardneri (2) strains NCPPB 2968, 422, 4321, and 881, respectively, served as positive controls. Plants sprayed with sterile distilled water alone served as negative control. The 30 tested isolates were pathogenic on tomato and pepper within 7 to 14 days and induced similar symptoms as those observed on tomato field plants and plants sprayed with reference strains of xanthomonads. Symptoms were not observed on negative control plants. Yellow-pigmented colonies were reisolated from symptomatic plants and their identity confirmed with GumD-PCR. Based on partial sequencing of the fyuA gene using primers developed by Young et al. (4), all 30 isolates were subsequently grouped into five clusters of the genus Xanthomonas. With recent taxonomy of Xanthomonas (2,4), four of these clusters displayed more than 99% sequence identity to known species of Xanthomonas: X. arboricola EU498923 (18 isolates); X. perforans EU498944 (6 isolates), X. vesicatoria EU498876 (2 isolates), and X. euvesicatoria EU498912 (1 isolate). The remaining three isolates formed a fifth cluster displaying less than 94% sequence identity to any known sequence of fyuA (93% matching strains: X. axonopodis EU498914; X. melonis EU498918, and X. cucurbitae EU498891). Representative sequences for each of the five clusters of bacterial leaf spot (BLS) strains mentioned have been deposited in GenBank (Nos. JQ418487, JQ418488, JQ418489, JQ418490, and JQ418491, respectively). BLS of tomato plants and its economic impact has been reported in Tanzania (3). Different BLS causal agents have recently been reported from the Southwest Indian Ocean Region (1), however, corresponding information for Tanzania has been lacking. On the basis of fyuA sequences, this study reports four genotypes of BLS causal agents corresponding to known species of Xanthomonas. In addition, Xanthomonas isolates with a fyuA genotype not previously assigned to any known species has been identified as part of the BLS pathosystem in Tanzania. References: (1) A. A. Hamza et al. Plant Dis. 94:993, 2010. (2) B. J. Jones et al. Syst. Appl. Microbiol. 27:755, 2004. (3) K. C. Shenge et al. Afr. J. Biotechnol. 6:15, 2007. (4) J. M. Young et al. Syst. Appl. Microbiol. 31:366, 2008.

Prospects of molecular markers in Fusarium species diversity.

Recent developments in genomics have opened up for newer opportunities to study the diversity and classification of fungi. The genus Fusarium contains many plant pathogens that attack diverse agricultural crops. Fusarium spp. are not only pathogenic to plants but are also known as toxin producers that negatively affect animal and human health. The identification of Fusarium species still remains one of the most critical issues in fungal taxonomy, given that the number of species recognized in the genus has been constantly changing in the last century due to the different taxonomic systems. This review focuses of various molecular-based techniques employed to study the diversity of Fusarium species causing diseases in major food crops. An introduction of fusarial diseases and their mycotoxins and molecular-marker-based methods for detection introduce the concept of marker application. Various well-known molecular techniques such as random amplified polymorphic DNA, amplification fragment length polymorphism, etc. to more modern ones such as DNA microarrays, DNA barcoding, and pyrosequencing and their application form the core of the review. Target regions in the genome which can be potential candidates for generation of probes and their use in phylogeny of Fusarium spp. are also presented. The concluding part emphasizes the value of molecular markers for assessing genetic variability and reveals that molecular tools are indispensable for providing information not only of one Fusarium species but on whole fungal community. This will be of extreme value for diagnosticians and researchers concerned with fungal biology, ecology, and genetics.

Recent Outbreaks of Black Rot of Brassicas Caused by Xanthomonas campestris pv. campestris in Southern Mozambique.

In August and September of 2007, black rot symptoms were observed on seedbed and field plants of Brassica spp. grown in the southern districts of Boane, Mahotas, and Chòkwé in Mozambique. One hundred eighty-two cabbage-growing households were evaluated for the incidence of Xanthomonas campestris pv. campestris. Five Brassica cultivars, Glory F1, Glory of Enkhuizen, Copenhagen Market, Starke (Brassica oleracea pv. capitata L.), and Tronchuda (B. oleracea L. var. costata DC) were grown in the areas for several years. The hybrid Glory F1 was the most popular grown cultivar in the surveyed areas. In the Boane district, the highest incidence of black rot was recorded on Copenhagen Market (70%), Starke (67.9%), and Glory F1 (67.3%). In Chòkwé, Tronchuda (Portuguese kale) was the least affected Brassica crop. Water-soaked lesions starting at the edge of leaves with typical V-shaped necrotic lesions and vein discoloration were the most commonly observed symptoms. When examined with a microscope, cut edges of symptomatic stem and leaf tissues consistently exhibited bacterial streaming. The bacteria were isolated from commercial seed and field-grown plants on semiselective agar media (2). Forty-six X. campestris pv. campestris strains that were gram negative, aerobic, starch positive, nitrate negative, and oxidase negative or weakly positive (3) were further identified on the basis of ELISA (Agdia Inc., Elhart, IN), GN Biolog Microbial Identification System, version 4.2 (Biolog Inc., Hayward, CA), and PCR-specific primers (1). Pathogenicity tests were conducted by pin inoculating two upper leaves of cabbage (cv. Wirosa) in the 2- to 3-leaf stage with bacterial growth from 24-h-old agar cultures (2). Black rot symptoms developed on nearly all inoculated plants within 7 to 14 days. No symptoms were observed on control plants inoculated with a sterile pin without bacterial inoculum. The severity of black rot of Brassica spp. in three important farming districts caused significant losses in Mozambique. References: (1) T. Berg et al. Plant Pathol. 54:416, 2005. (2) S. J. Roberts and H. Koenraadt. Page 1 in: International Rules for Seed Testing: Annexe to Chapter 7 Seed Health Methods. ISTA, 2007. (3) N. W. Schaad et al. Laboratory Guide for Identification of Plant Pathogenic Bacteria. 3rd ed. The American Phytopathological Society, St. Paul, MN, 2001.