Glucose metabolism profile recorded by flash glucose monitoring system in patients with hypopituitarism during prednisone replacement.

BACKGROUND: Commonly used glucocorticoids replacement regimens in patients with hypopituitarism have difficulty mimicking physiological cortisol rhythms and are usually accompanied by risks of over-treatment, with adverse effects on glucose metabolism. Disorders associated with glucose metabolism are established risk factors of cardiovascular events, one of the life-threatening ramifications. AIM: To investigate the glycometabolism profile in patients with hypopituitarism receiving prednisone (Pred) replacement, and to clarify the impacts of different Pred doses on glycometabolism and consequent adverse cardiovascular outcomes. METHODS: Twenty patients with hypopituitarism receiving Pred replacement [patient group (PG)] and 20 normal controls (NCs) were recruited. A flash glucose monitoring system was used to record continuous glucose levels during the day, which provided information on glucose-target-rate, glucose variability (GV), period glucose level, and hypoglycemia occurrence at certain periods. Islet ß-cell function was also assessed. Based on the administered Pred dose per day, the PG was then regrouped into Pred > 5 mg/d and Pred ≤ 5 mg/d subgroups. Comparative analysis was carried out between the PG and NCs. RESULTS: Significantly altered glucose metabolism profiles were identified in the PG. This includes significant reductions in glucose-target-rate and nocturnal glucose level, along with elevations in GV, hypoglycemia occurrence and postprandial glucose level, when compared with those in NCs. Subgroup analysis indicated more significant glucose metabolism impairment in the Pred > 5 mg/d group, including significantly decreased glucose-target-rate and nocturnal glucose level, along with increased GV, hypoglycemia occurrence, and postprandial glucose level. With regard to islet ß-cell function, PG showed significant difference in homeostasis model assessment (HOMA)-ß compared with that of NCs; a notable difference in HOMA-ß was identified in Pred > 5 mg/d group when compared with those of NCs; as for Pred ≤ 5 mg/d group, significant differences were found in HOMA-ß, and fasting glucose/insulin ratio when compared with NCs. CONCLUSION: Our results demonstrated that Pred replacement disrupted glycometabolic homeostasis in patients with hypopituitarism. A Pred dose of > 5 mg/d seemed to cause more adverse effects on glycometabolism than a dose of ≤ 5 mg/d. Comprehensive and accurate evaluation is necessary to consider a suitable Pred replacement regimen, wherein, flash glucose monitoring system is a kind of promising and reliable assessment device. The present data allows us to thoroughly examine our modern treatment standards, especially in difficult cases such as hormonal replacement mimicking delicate natural cycles, in conditions such as diabetes mellitus that are rapidly growing in worldwide prevalence.

Incidence of total hip arthroplasty in patients with Legg-Calve-Perthes disease after conservative or surgical treatment: a meta-analysis.

PURPOSE: This systematic review and meta-analysis aimed to determine the incidence of total hip arthroplasty (THA) in patients with Legg-Calve-Perthes disease (LCPD) treated conservatively or surgically and factors influencing the incidence of THA. METHODS: Long-term follow-up studies on the conservative or surgical treatments of LCPD from 1950 to 2021 were conducted using six public databases. Articles were screened by two investigators (PRISMA guidelines), and the quality of the included publications (n = 27) was assessed (MINORS criteria). R version 4.2.1 was used for statistical analysis. RESULTS: The overall incidences of THA were 6.8% and 5.14% in patients who were treated conservatively and surgically, respectively. At disease onset, the incidences of THA were 6.79% and 6.17% after conservative treatment and surgery in patients aged < seven years, respectively, and 16.97% and 3.61% in patients aged > seven years, respectively. The incidences of THA were 4.91%, 5.19%, and 23.18% in patients who were treated conservatively with ≤ 30, 30-40, and > 40 years of follow-up, respectively, and 3.68%, 3.11%, 9.66%, and 17.92% in patients who were treated surgically with ≤ ten, ten to 20, 20-40, and > 40 years of follow-up, respectively. In patients who received conservative treatment, the incidences of THA were 5.79% and 5.29% in patients with Stulberg I-II and III-V, respectively. In surgically treated patients, the incidence of THA was 0% in Stulberg I-II and 8% in Stulberg III-V. CONCLUSION: Patients with LCPD had relatively low incidences of THA. The greater the age at disease onset and longer the follow-up, the higher the incidence of THA; however, the Stulberg classification was not directly associated with the incidence of THA.

Primary Generalized Glucocorticoid Hypersensitivity Treated with Mifepristone: A Case Report.

Here, we report a case of a patient with symptoms of Cushing syndrome, who is diagnosed with primary generalized glucocorticoid hypersensitivity in the end. The patient's relevant laboratory tests and imaging examinations are described. Mifepristone, a glucocorticoid receptor antagonist, was prescribed and its therapeutic effect on the patient's electrolyte level, lipid metabolism, and bone metabolism was observed during the treatment. The endocrine assessment indicated normal pituitary-adrenal axis regulation function but reduced cortisol secretion. Quantitative reverse transcription-polymerase chain reaction indicated reduced mRNA level of mineralocorticoid receptor gene. Pituitary magnetic resonance imaging showed normal pituitary anatomy, while adrenal computed tomography scan showed bilateral adrenal atrophy and increased content of visceral and abdominal subcutaneous fat. Moreover, chromosome examination revealed a normal 46, XY chromosome. In this case, mifepristone was administered to treat primary generalized glucocorticoid hypersensitivity. To the best of our knowledge, there are a few reports on mifepristone-treated primary generalized glucocorticoid hypersensitivity. In the one-year follow-up visits, the evaluated results of electrolyte level, lipid metabolism, and bone metabolism indicated that the patient's symptoms resulting from cortisol hypersensitivity were relieved progressively.

Flash glucose monitoring system was applied to cortisol treatment for a patient with congenital adrenal hyperplasia and 17α-hydroxylase deficiency.

BACKGROUND: Congenital adrenal hyperplasia (CAH) with 17α-hydroxylase deficiency is a rare disease; patients often require lifetime cortisol treatment. In this case report, we presented a patient with CAH and 17α-hydroxylase deficiency, who was previously misdiagnosed as having primary aldosteronism. Furthermore, the flash glucose monitoring system (FGMS) was used to ascertain a suitable cortisol therapeutic regimen for this patient. CASE PRESENTATION: A 29-year-old woman presented with sex dysgenesis, hypertension and hypokalaemia. She had been diagnosed with primary aldosteronism at a local hospital. The re-measured aldosterone level in our hospital was below the normal range after antihypertensive medication adjustment, suggesting that the primary aldosteronism was a misdiagnosis. The patient was finally diagnosed as having CAH with 17α-hydroxylase deficiency according to the endocrine profile, adrenocorticotropic hormone stimulation test, and genetic analysis. Then, the patient was recommended cortisol treatment, during which the endocrine profile, blood pressure, plasma potassium level, and blood glucose level were observed to ascertain a suitable dosage. The FGMS was used to monitor blood glucose level, which indicated that the patient's glucose metabolism was maintained normally under the final treatment dosage. CONCLUSION: The misdiagnosis might have been because of the effects of the antihypertension medications on aldosterone and renin levels. The final dosage of cortisol treatment achieved a normal endocrine profile, while maintaining the homeostasis of blood glucose level, plasma potassium level and blood pressure. FGMS may be an effective method to ascertain a suitable cortisol therapeutic regimen for patients with CAH and 17α-hydroxylase deficiency.

Liquorice-induced severe hypokalemic rhabdomyolysis with Gitelman syndrome and diabetes: A case report.

BACKGROUND: Licorice-induced severe hypokalemic rhabdomyolysis is clinically rare. Gitelman syndrome (GS) is the most common inherited renal tubular disease, while diabetes is one of the most prevalent diseases in the world. Recently, some studies have found that GS patients had higher diabetic morbidity. However, the coexistence of these three diseases has yet to be reported. CASE SUMMARY: We report the case of a 62-year-old Chinese man who was admitted with weakness in the extremities, muscle pain, and dark-colored urine. He had consumed liquorice water daily for seven days prior to admission. The laboratory tests revealed a serum potassium level of 1.84 mmol/L, magnesium 0.68 mmol/L, creatinine phosphokinase (CK) 10117 IU/L, and marked hemoglobinuria. Fractional chloride excretion and fractional magnesium excretion were increased. Plasma renin activity and aldosterone concentration were within the normal ranges. Sequence analysis of the SLC12A3 gene revealed that he had compound heterozygous mutations. The diagnosis of liquorice-induced severe hypokalemic rhabdomyolysis with GS and diabetes was thus genetically confirmed. Serum potassium and CK quickly improved with potassium replacement therapy, hydration, and discontinuation of liquorice ingestion. Upon follow-up at 3 mo, the levels of CK, myoglobin, and potassium remained normal, and magnesium was above 0.6 mmol/L. CONCLUSION: This case emphasizes that liquorice consumption and GS should be considered causes of hypokalemia and that the diabetic status of GS patients should be noted in the clinic.

Analysis of endocrine hormone metabolism level in a Chinese patient with mucopolysaccharidosis IVA: A case report.

RATIONALE: Mucopolysaccharidosis IVA (Morquio A) is a catabolic mucopolysaccharide disorder caused by galactose-6-sulfate sulfatase deficiency. It is an autosomal recessive inherited disease. Previous reports on clinical characteristics of Morquio A mainly focused on growth retardation, skeletal deformities, and organ damage in children and adolescents, while the effects of mucopolysaccharide metabolism disorders on endocrine hormone metabolism level have not been reported. Herein, we reported the endocrine hormone metabolism in a case diagnosed as Morquio A. PATIENT CONCERNS: The patient was a 17-year-old girl with growth retardation, hearing loss, and severe skeletal dysplasia(scoliosis and chicken breast), and was evaluated to have normal nervous system function and intelligence by physicians. DIAGNOSES: She was diagnosed as Morquio A based on gene analysis, mucopolysaccharide-related enzymes and her clinical features. INTERVENTIONS: The patient didn't accepted the enzyme replacement therapy. OUTCOMES: She had a homozygous mutation of the GALNS gene. The b-glucuronidase content in the blood was reduced. The serum sodium, serum adrenocorticotropic hormone, and cortisol rhythms (8 AM) were decreased. The levels of PRA(plasma renin activity) , PAII(plasma angiotensin II), and PALD(plasma aldosterone) were elevated. Bone mineral density suggests osteoporosis. There were no abnormalities in bone metabolism indicators, growth hormone, thyroid hormone, and sex hormones. In summary, the level of endocrine hormones in patients with mucopolysaccharidosis IV changes. LESSONS: This is the report on endocrine hormone level in a patient with mucopolysaccharidosis IV in China. Due to the disease may have relatively incomplete adrenal function, which provides a basis for future understanding and diagnosis of this disease.

A novel 55-basepair deletion of hydroxymethylbilane synthase gene found in a Chinese patient with acute intermittent porphyria and her family: A case report.

RATIONALE: Acute intermittent porphyria (AIP) is caused by hydroxymethylbilane synthase (HMBS) gene mutation. PATIENT CONCERNS: A Chinese female patient with very typical AIP symptoms of severe abdominal pain, seizures, hypertension, and tachycardia, accompanied with hyponatremia, anemia, and hyperbilirubinemia. DIAGNOSES: She was diagnosed as AIP based on positive result of urine porphobilinogen and her clinical syndrome. INTERVENTIONS: The proband was treated with intravenous glucose (at least 250 g per day) for 4 days. HMBS mutation was investigated in this family by Sanger sequencing. OUTCOMES: A heterozygous mutation of the HMBS gene was identified in the proband and 7 other family members. Genetic sequencing showed a deletion of 55 basepairs (C.1078_1132delGCCCATTAACTGGTTTGTGGGGCACAGATGCCTGGGTTGCTGCTGTCCAGTGCCT) including the stop codon position, leading to frameshift mutation. The mutation has not been documented in current gene databases. Further prediction of mutated protein structure suggests that the mutation is likely to produce prolonged peptide with structural change and less stability. LESSONS: Physicians should pay attention to AIP attack in patients with suspected symptoms and make use of genetic testing to increase identification of mutated HMBS gene carriers for further preventive strategy.