Preparation of Ti/SnO2-Sb2O4-La Electrode with TiO2 Nanotubes Intermediate Layer and the Electrochemical Oxidation Performance of Rhodamine B.

A La-doped Ti/SnO2-Sb2O4 electrode with TiO2-NTs intermediate layer (Ti/TiO2-NTs/SnO2-Sb2O4-La) was created via the electrodeposition technique. The physicochemical and electrochemical properties of the electrode were analyzed through FESEM, XRD, XPS, CV, and LSV electrochemical tests. The results showed that TiO2-NTs were tightly packed on the surface of Ti substrate, thus improving the binding force of the SnO2-Sb2O4-La coating, offering greater specific surface area, more active spots, higher current response, and longer lifespan for the degradation of rhodamine B. The lifespan of the Ti/TiO2-NTs/SnO2-Sb2O4-La electrode reached 200 min (1000 mA cm-2, 1 M H2SO4), while the actual service life was up to 3699 h. Under the conditions of initial pH 3.0, Na2SO4 concentration of 0.1 M, current density of 30 mA cm-2, and initial rhodamine B concentration of 20 mg L-1, the color and TOC removal rate of rhodamine B reached 100% and 86.13% within 15 and 30 min, respectively. Rhodamine B was decomposed into acids, esters, and other molecular compounds under the action of •OH and SO4•- free radicals and electrocatalysis, and finally completely mineralized into CO2 and H2O. It is anticipated that this work will yield a novel research concept for producing DSA electrodes with superior catalytic efficacy and elevated stability.

Chitosan derived N-doped carbon anchored Co3O4-doped MoS2 nanosheets as an efficient peroxymonosulfate activator for degradation of dyes.

Peroxymonosulfate (PMS), which is dominated by non-free radical pathway, has a good removal effect on organic pollutants in complex water matrices. In this article, a biodegradable cobalt-based catalyst (Co3O4/MoS2@NCS) was synthesized by a simple hydrothermal method with chitosan (CS) as nitrogen­carbon precursor and doped with Cobaltic­cobaltous oxide (Co3O4) and Molybdenum disulfide (MoS2), and was used to activate PMS to degrade dye wastewater. Electrochemical tests showed that Co3O4/MoS2@NCS exhibited higher current density and cycling area than MoS2@NCS and MoS2. In the Co3O4/MoS2@NCS/PMS system, the degradation rate of 30 mg·L-1 rhodamine B (RhB) reached 97.75 % within 5 min, and kept as high as 94.34 % after 5 cycles. Its rate constant was 1.91 and 8.37 times that of MoS2@NCS/PMS and MoS2/PMS, respectively. It had good complex background matrices and acid-base anti-interference ability, and had good universality and reusability. The degradation rate of methyl orange (MO) and methylene blue (MB) were more than 91 % within 5 min at pH 4.8. The experimental results demonstrated that MoS2-modified CS as a carrier exposed a large number of active sites, which not only dispersed Co3O4 nanoparticles and improved the stability of the catalyst, but also provided abundant electron rich groups, and promoted the activation of PMS and the production of reactive oxygen species (ROS). PMS was effectively activated by catalytic sites (Co3+/Co2+, Mo4+/Mo5+/Mo6+, CO, pyridine N, pyrrole N, hydroxyl group and unsaturated sulfur), producing a large number of radicals that attack RhB molecules, causing chromophore cleavage, ring opening, and mineralization. Among them, non-free radical 1O2 was the main ROS for RhB degradation. This work is expected to provide a new idea for the design and synthesis of environmentally friendly and efficient MoS2-modified cobalt-based catalysts.

Preparation of La-doped Ti/SnO2-Sb2O4 anode and its electrochemical oxidation performance of rhodamine B.

In this paper, La-doped Ti/SnO2-Sb2O4 electrode was prepared by electrodeposition and used for electrochemical degradation of rhodamine B. The optimum preparation conditions of the electrode were optimized as deposition time of 15 min and calcination at 500 ℃ for 2 h. The water treatment conditions were selected as initial pH 3.0, electrolyte Na2SO4 concentration 0.1 M, current density 30 mA cm-2, and initial rhodamine B concentration 20 mg L-1; the color and TOC removal of RhB reached 99.78% and 82.41% within 30 min. The FESEM, XRD, XPS, CV, LSV, and EIS characterization studies demonstrated that Ti/SnO2-Sb2O4-1%La electrode had a dense structure and the highest oxygen evolution potential (2.14 V) and lowest charge transfer resistance (0.198 Ω cm-2), indicating that doped La has lower energy consumption. Moreover, La doping can expand the specific surface area, active site, performance of pollutant degradation, and service life of the electrode. Especially, the service life of Ti/SnO2-Sb2O4-1%La is increased by three times, and the maximum life span reaches 90 min (1000 mA cm-2, 1 M H2SO4). Free radical quenching experiments show that ·OH plays a major role in the degradation of RhB. The Ti/SnO2-Sb2O4-1%La electrode prepared in this paper and its results will provide data support and reference for the design of efficient electrocatalytic electrode.

Adsorption performance of Ni(II) by KOH-modified biochar derived from different microalgae species.

Microalgae biochar is potential adsorbents to remove heavy metals from wastewater due to abundant functional groups, high porosity and wide sources, but performance is not fully developed since it depends on microalgae species attributing to distinct morphology and biomass compositions. Here, two microalgae species Chlorella Pyrenoidosa and Scenedesmus Obliquus were used for biochar preparation via KOH-modification, biochar properties and their influences on Ni(II) adsorption were investigated. Ni(II) adsorption performances responding to biochar properties and operating conditions were upgraded via progressive optimization and response surface methodology. Together, adsorption isotherms and kinetics were analyzed to obtain significant factors for Ni(II) removal. As results, 100 % of Ni(II) removal was achieved under 100 mg/L initial Ni(II) concentration as pH was higher than the biochar zero-charge point of 6.87 with low biochar dosage (0.5 g/L), which provides an efficient approach for heavy metal removal from wastewater with microalgae biochar.

Nitrogen-doped Zn/Fe@PCN derived from metal-organic frameworks activating persulfate to efficiently degrade rhodamine B.

The Zn/Fe@N-doped porous graphitic carbon catalyst (Zn/Fe@PCN) was successfully produced through one-step pyrolysis of g-C3N4 and Zn/Fe-MOF and was used for the activation of persulfate (PS) for the degradation of RhB. The Zn/Fe@PCN/PS system was able to degrade 95.92% of RhB in 30 min at a rate of 0.6453 min-1 when RhB was concentrated at 50 mg L-1. The efficient degradation of RhB is primarily realized through the synergistic activation of PS by Zn, Fe, and N to produce reactive oxygen species 1O2, [Formula: see text], [Formula: see text], and ·OH. Zn0/Fe0 in Zn/Fe@PCN forms a galvanic cell with carbon to release electrons to join in the activation of PS. The doping of Zn not only provides sufficient electrons for the activation of PS but also promotes the effective reduction of Fe2+ and thus the Fe2+/Fe3+ cycle. The N doping accelerates the electron transfer during the reaction progress.

Residual acetabular dysplasia after Pavlik harness treatment for Graf type II hips.

Purpose: To evaluate the residual acetabular dysplasia in Graf type II hips after Pavlik harness treatment with a radiographic follow-up at 2 years of age. Methods: We retrospectively reviewed the developmental dysplasia of the hip patients who were treated with the Pavlik harness between March 2018 and February 2022. Patients with Graf type II hip dysplasia who had at least one radiographic follow-up after 2 years of age were included. The following information, sex, laterality, affected side, age at harness initiation, treatment duration, α angle, and the morphology of bony roof, was collected and studied. We evaluated the radiographic acetabular index at the last follow-up and defined the value of greater than 2 standard deviations as residual acetabular dysplasia. Results: A total of 33 patients (53 hips) met the criteria. The mean initial α angle was 53.4°; the mean age at Pavlik harness initiation was 10.9 weeks. The mean treatment duration was 10 weeks. The mean α angle at the last ultrasound follow-up was 64.9°. The mean age of the last radiographic follow-up was 2.6 years, and 26 hips had a residual acetabular dysplasia with acetabular indexes greater than 2 standard deviations above the mean. The morphology of the acetabular bony rim (odds ratio = 4.333, P = 0.029) and age of initial treatment <12 weeks (odds ratio = 7.113, P = 0.014) were seen as significant predictors for a higher acetabular index more than 2 years of age. Conclusions: A notable incidence of residual acetabular dysplasia after Pavlik harness treatment in Graf type II hips, wherein the acetabular bony roof with a blunt rim at the end of treatment and initial age after 12 weeks were independent predictors associated with residual acetabular dysplasia. Levels of evidence: Therapeutic studies, IV.

Zr4+ and glutaraldehyde cross-linked polyethyleneimine functionalized chitosan composite: Synthesis, characterization, Cr(VI) adsorption performance, mechanism and regeneration.

In order to improve the stability, electrostatic interaction and ion exchange ability of chitosan for Cr (VI) removal, it is an effective strategy to introduce polyvalent metal ions and polymers into chitosan molecular chain through crosslinking. In this paper, Zr4+ and glutaraldehyde crosslinked polyethyleneimine functionalized chitosan (CGPZ) composite was successfully synthesized and characterized by XRD, SEM, FTIR, BET, and XPS. The results showed that polyethyleneimine was successfully grafted onto chitosan by Schiff base reaction, while the appearance of ZrO and ZrN bonds verified the successful preparation of CGPZ. The monolayer maximum adsorption capacity of Cr(VI) by CGPZ was 593.72 mg g-1 at 298 K and t = 210 min. The removal efficiency of 100 mg L-1 Cr(VI) reached 95.7 %. The thermodynamic, isotherm and kinetic results show that the adsorption process of Cr (VI) by CGPZ is a spontaneous endothermic process controlled by entropy, which accords with Freundlich model and pseudo-second-order kinetic model. The regeneration experiments show that both HCl and NaOH can effectively desorb Cr(III) and Cr(VI) from the adsorbent surface, and the adsorbent has good acid-base resistance and regeneration performance. The removal of Cr(VI) mainly involves electrostatic attraction, ion exchange, reduction and complexation. CGPZ can synergistically adsorb Cr(VI) by electrostatic interaction of -NH2/-C=N and ion exchange of Cl- ion in the center of Zr, then reduce Cr(VI) to Cr(III) (45.4 % at pH = 2.0) by the -OH group on its surface, and chelate Cr(III) through COO- and -NH- groups.

Polyaniline/g-C3N4/Bi2O3/Ti photoanode for visible light responsive photocatalytic fuel cell degradation of rhodamine B and electricity generation.

In order to develop efficient photoanode to improve the performance of visible light responsive photocatalytic fuel cell (PFC), in this work, polyaniline/g-C3N4/Bi2O3/Ti photoanode was successfully prepared using silica-sol drop coating method, and assembled with Cu cathode to construct PFC to decompose rhodamine B and generate electricity simultaneously. The degradation rate, maximum photocurrent density and maximum power density of this PFC were 91.23%, 0.086 mA cm-2 and 4.78 µW cm-2, respectively, which were 1.4 and 1.8 times, 2.4 and 4.5 times, and 1.9 and 7.3 times those of the corresponding values of the PFCs with g-C3N4/Bi2O3/Ti and Bi2O3/Ti photoanodes, respectively. This is attributed to the type II heterojunction structure formed among polyaniline, g-C3N4 and Bi2O3 in the polyaniline/g-C3N4/Bi2O3/Ti photoanode. Among them, polyaniline has π-π conjugated structure, which can rapidly transfer the electronic charge between g-C3N4 and Bi2O3, thus enhancing the separation efficiency of photo-generated e--h+ pairs spatially and reducing their recombination, extending the visible light response wavelength of the photocatalyst, and finally improving its photocatalytic properties. This study can provide significant reference for the research of Bi2O3-based visible light responsive PFC.

Photocatalytic synergistic biofilms enhance tetracycline degradation and conversion.

Tetracyclines are refractory pollutants that cause persistent harm to the environment and human health. Therefore, it is urgently necessary to develop methods to promote the efficient degradation and conversion of tetracyclines in wastewater. This report proposes a photobiocatalytic synergistic system involving the coupling of GeO2/Zn-doped phosphotungstic acid hydrate/TiO2 (GeO2/Zn-HPW/TiO2)-loaded photocatalytic optical hollow fibers (POHFs) and an algal-bacterial biofilm. The GeO2/Zn-HPW/TiO2 photocatalyst exhibits a broad absorption edge extending to 1000 nm, as well as high-efficiency photoelectric conversion and electron transfer, which allow the GeO2/Zn-HPW/TiO2-coated POHFs to provide high light intensity to promote biofilm growth. The resulting high photocatalytic activity rapidly and stably reduces the toxicity and increases the biodegradability of tetracycline-containing wastewater. The biofilm enriched with Salinarimonas, Coelastrella sp., and Rhizobium, maintains its activity for the rapid photocatalytic degradation and biotransformation of intermediates to generate the O2 required for photocatalysis. Overall, the synergistic photocatalytic biofilm system developed herein provides an effective and efficient approach for the rapid degradation and conversion of water containing high concentrations of tetracycline.

Copper sulphide/cuprous sulphide doped zero-valent iron@carbon (ZVI@C/CuS/Cu2S) activate PMS for rapid and effective decomposition of Ni-EDTA.

Ni-EDTA is widely present in electroplating effluents. It cannot be effectively removed by traditional wastewater treatment methods due to its chemical stability. In this study, copper sulphide/cuprous sulphide doped zero-valent iron@carbon (ZVI@C/CuS/Cu2S) was prepared to active peroxymonsulphate (PMS) to decomposition Ni-EDTA. The ZVI@C/CuS/Cu2S + PMS process shows excellent performance under neutral or even alkaline conditions. This is due to the acceleration of ZVI electron transport by CuS/Cu2S, the autocatalysis of CuS/Cu2S itself, and the synergistic effect of CuS/Cu2S and Ni-EDTA. The removal efficiency of 50 ppm Ni-EDTA electroplating effluents reached 99.53% at 10 min, and the discharge water can meet the Chinese emission standard. The influences of the main parameters such as initial pH value, catalyst, PMS and initial Ni-EDTA concentration on removal efficiency was systematically investigated.

Polyacrylate stabilized ZVI/Cu bimetallic nanoparticles for removal of hexavalent chromium from wastewater.

In this work, a magnetic core-shell composite zero-valent iron/copper-polyacrylate (ZVI/Cu-PAA) was synthesized by a simple liquid-phase reduction process and used for hexavalent chromium Cr(VI) removal from wastewater. The optimization experiments show that the optimal dosages of polyacrylate and Cu are 7.00 wt% and 8.25 wt%, respectively. The maximum adsorption capacity and removal rate of Cr(VI) by ZVI/Cu-PAA reached 106.12 mg g-1 and 99.05% at pH 5.5, respectively. Furthermore, the presence of coexisting ions such as Ca2+, Mg2+, Na+, and NO3- had no significant effect on its Cr(VI) removal performance. The excellent performance of ZVI/Cu-PAA is attributed to that the modification of polyacrylate can not only give more active sites but also inhibit agglomeration of nano-metallic particles, while Cu doping promotes the electron generation and transformation of Fe(III)/Fe(II) and Cu(II)/Cu(I) redox cycles. This makes ZVI/Cu-PAA has rich active sites and excellent stability, and has broad application prospects in the remediation of Cr (VI) polluted wastewater. The magnetic core-shell composite ZVI/Cu-PAA has excellent Cr (VI) removal performance because of its rich active sites and high electron transformation efficiency.

Zr4+ cross-linked chitosan-thiourea composite for efficient detoxification of Cr(VI) ions in aqueous solution.

The effective strategy to solve the problems of low mechanical strength, low adsorption efficiency and poor stability of chitosan is to modify it. In this work, Zr4+ cross-linked chitosan-thiourea (CS-thiourea-Zr) composite was synthesized for the first time and used to remove Cr(VI). CS, ZrO, CN bonds in FTIR spectrum and Zr, S elements in XPS spectrum, SEM-mapping and EDS results verify the successful preparation of CS-thiourea-Zr. The main mechanism of Cr(VI) removal by CS-thiourea-Zr includes electrostatic action, ion exchange, reduction and complexation. The adsorption of Cr(VI) is enhanced by electrostatic adsorption and ion exchange, 80.6 % of the adsorbed Cr(VI) is reduced to Cr(III) by -OH group, and the adsorption of Cr(III) is enhanced by COO- group and CS bond. The maximum adsorption capacity of CS-thiourea-Zr is 246.72 mg g-1 at 298 K and pH = 2.0. CS-thiourea-Zr has excellent acid-base resistance (suitable pH 2-12) and reusability.

Gradient electro-processing strategy for efficient conversion of harmful algal blooms to biohythane with mechanisms insight.

Globally eruptive harmful algal blooms (HABs) have caused numerous negative effects on aquatic ecosystem and human health. Conversion of HABs into biohythane via dark fermentation (DF) is a promising approach to simultaneously cope with environmental and energy issues, but low HABs harvesting efficiency and biohythane productivity severely hinder its application. Here we designed a gradient electro-processing strategy for efficient HABs harvesting and disruption, which had intrinsic advantages of no secondary pollution and high economic feasibility. Firstly, low current density (0.888-4.444 mA/cm2) was supplied to HABs suspension to harvest biomass via electro-flocculation, which achieved 98.59% harvesting efficiency. A mathematic model considering coupling effects of multi-influencing factors on HABs harvesting was constructed to guide large-scale application. Then, the harvested HABs biomass was disrupted via electro-oxidation under higher current density (44.44 mA/cm2) to improve bioavailability for DF. As results, hydrogen and methane yields of 64.46 mL/ (g VS) and 171.82 mL/(g VS) were obtained under 6 min electro-oxidation, along with the highest energy yield (50.1 kJ/L) and energy conversion efficiency (44.87%). Mechanisms of HABs harvesting and disruption under gradient electro-processing were revealed, along with the conversion pathways from HABs to biohythane. Together, this work provides a promising strategy for efficient disposal of HABs with extra benefit of biohythane production.

Peroxymonosulfate activated by photocatalytic fuel cell with g-C3N4/BiOI/Ti photoanode to enhance rhodamine B degradation and electricity generation.

The development of traditional photocatalytic fuel cell (PFC) is severely hindered by poor visible-light response and limited reaction space. In this study, a visible-light responsive PFC with g-C3N4/BiOI/Ti photoanode was proposed and applied to activate peroxymonosulfate (PMS) to degrade rhodamine B. The degradation rate, maximum power density and maximum photocurrent density of the PMS/PFC system were respectively 95.39%, 103.87 µW cm-2 and 0.62 mA cm-2, which was respectively 1.28, 2.18, and 1.98 times that of PFC. The excellent performance is attributed to the production of more reactive oxygen species and the extension of the reaction space range after the activation of PMS. The activation pathway of PMS and charge transfer pathway of the photoanode were discussed in detail, and it was proposed that PMS was activated by Z-scheme heterojunction g-C3N4/BiOI/Ti photoanode.

Identification of the genetic basis of sporadic polydactyly in China by targeted sequencing.

PURPOSE: Polydactyly is a highly heterogeneous group of skeletal deformities in clinical and genetic background. The variation spectrum in Chinese sporadic polydactyly has not been comprehensively analyzed. To elucidate genetic variation spectrum and genotype-phenotype correlations in Chinese patients with polydactyly, we conducted comprehensive genetic analysis of patients nationwide using targeted sequencing. METHODS: A total of 181 patients diagnosed with polydactylies were recruited. We designed a targeted capture panel for sequencing 721 genes that are associated with the pathogenesis of skeletal dysplasia. We performed rigorous variant- and gene-level filtrations to identify potentially damaging variants, followed by enrichment analysis and gene prioritization. RESULTS: A total of 568 deleterious variants of 293 genes were identified in 173 of 181 patients with a positive rate of 95.6% by targeted sequencing. For each sample, an average of 3.17 deleterious variants were identified. Especially, 14 pathogenic or likely pathogenic variants were identified in 10 genes in 14 patients out of the 181 patients, providing a positive molecular diagnostic rate of 7.7%. CONCLUSION: Targeted sequencing analysis provides a high efficiency approach for the genetic diagnosis of polydactyly. This is the largest next generation sequencing study performed to date in patients with polydactyly and represents the genetic basis of polydactyly typically encountered in genetics clinics.

Pyrite/H2O2/hydroxylamine system for efficient decolorization of rhodamine B.

To improve the efficiency of the Fe(II)/Fe(III) cycle and continuous reactivity of pyrite, a pyrite/H2O2/hydroxylamine (HA) system was proposed to treat rhodamine B (RhB). The results showed that near-complete decolorization and 52.8% mineralization 50 mg L-1 RhB were achieved under its optimum conditions: HA 0.8 mM, H2O2 1.6 mM, pyrite 0.4 g L-1, and initial pH 4.0. The degradation reaction was dominated by an •OH radical produced by the reaction of Fe2+ with H2O2 in solution. HA primarily had two roles: in solution, HA could accelerate the Fe(II)/Fe(III) cycle through its strong reducibility to enhance RhB decolorization; on the pyrite surface, HA could improve the continuous reactivity of pyrite by inhibiting the oxidation of pyrite. In addition, the dosing manner of HA had a significant effect on RhB decolorization. In addition, the high decolorization and mineralization efficiency of other dye pollutants suggested that the pyrite/H2O2/HA system might be widely used in textile wastewater treatment.

Characterization of Pediatric Extension Trigger Thumb: An Insight Into a Rare Manifestation From a Single-Center Retrospective Cohort Analysis.

PURPOSE: This study aimed to evaluate the clinical features, possible etiology, and surgical outcomes of a rare manifestation of pediatric trigger thumb, extension trigger thumb (ETT). METHODS: We retrospectively reviewed a database of surgically treated trigger thumb patients and identified patients with ETT who had a minimum of 1-year follow-up after surgery from 2012 to 2018. We reviewed demographic and clinical information and recorded active and passive interphalangeal (IP) joint flexion before, during (intraoperative simulated active flexion), and after surgery (at final follow-up). These measurements were compared with those obtained from the unaffected thumb in unilaterally affected patients. RESULTS: Eighteen patients with ETT (21 affected thumbs) were identified. The incidence of ETT was 1%, with an increasing incidence through the years of the study. We found that 14 of 18 ETT patients had a history of fixed flexion trigger thumb managed with nonsurgical treatment. There was an average 38° ± 10° improvement in active IP joint flexion after surgery and at the final follow-up. For unilaterally affected patients, active IP joint flexion improved but did not reach the same level as on the unaffected side. CONCLUSIONS: Extension trigger thumb is a rare manifestation with a low incidence in pediatric trigger thumbs. Surgical release of the A1 pulley achieves a moderate improvement in flexion function at the IP joint. TYPE OF STUDY/LEVEL OF EVIDENCE: Prognostic IV.

Nonframeshifting indel variations in polyalanine repeat of HOXD13 gene underlies hereditary limb malformation for two Chinese families.

BACKGROUND: Polydactyly and syndactyly are the most common hereditary limb malformations. Molecular genetic testing is of great significance for hereditary limb malformations, which can establish prognosis and recurrence risk of surgical intervention. METHODS: The present study aimed to identify the genetic etiologies of a three-generation family with postaxial polydactyly and a four-generation family with postaxial syndactyly. Whole exome sequencing was used, followed by standard mutation screening procedure, Sanger sequencing and bioinformatics analysis. RESULTS: Two nonframeshifting insertion/deletion (indel) mutations in HOXD13 (c.206_207ins AGCGGCGGCTGCGGCGGCGGCGGC:p.A68insAAAAAAAA or c.171_182delGGCGGCGGCGGC: p.56_60delAAAA) were successfully identified as the pathogenic mutation. The two nonframeshifting indel mutations led to truncation or expansion of homopolymeric alanine (Poly-Ala) repeats of HOXD13 proteins. Sequence alignment of HOXD13 protein among many different species for Poly-Ala position is highly conserved. Hypothetical three-dimensional (3-D) structural analysis further showed mutant HOXD13 proteins (p.A68insAAAAAAAA and p.56_60delAAAA) converted the disordered fragment into a short ß-strand (residues 63-68 or residues 64-68), thereby forming a conformational change. CONCLUSIONS: The present study identified two nonframeshifting mutations of HOXD13 polyalanine repeat location in two Chinese families with postaxial polydactyly or postaxial syndactyly. Our results also provide new insights into genetic counseling and clinical management.

Clinical Characteristics and Surgical Outcomes of Congenital Ulnar-deviated Thumbs: Delta Triphalangeal Thumbs and Irregular Epiphyses.

BACKGROUND: Delta triphalangeal thumbs (DTPT) and irregular epiphysis thumbs (IET) had different anatomic deformities. Our primary purpose was to evaluate the clinical and radiographic outcomes of surgical treatment in DTPT and IET. METHODS: In total, 43 ulnar-deviated thumbs were included and categorized into 2 types according to x-ray and exploration during surgery, DTPT and IET. Surgical excision of the delta phalanx in DTPT and intraepiphysis osteotomy in IET was conducted. RESULTS: In total, 23 ulnar-deviated thumbs were classified as DTPT and 20 as IET. Ten thumbs that could not be classified initially were followed-up until they could be categorized at the mean age of 24 months. The preoperative mean degrees of ulnar deviation at the interphalangeal joints were 40 and 33 degrees, in DTPT and IET, respectively. The mean degrees were 2 and 5 degrees in final follow-up, showing significant improvement (DTPT, P<0.05; IET, P<0.05). Complications during the study included residual ulnar deviation, overcorrection, and nonunion. The stability and range of movement at the interphalangeal joint were good overall. According to the Japanese Society for Surgery of the Hand scoring system, results were excellent in 29 cases, good in 13, and fair in 1. CONCLUSIONS: Ulnar clinodactyly of the thumb occurs because of different anatomic features such as DTPT or IET. We recommend surgical treatment be postponed until the anatomic abnormality can be ascertained. Furthermore, almost all patients with ulnar-deviated thumbs had significant improvement in clinical and radiographic outcomes after surgery.

A Novel Nonsense GLI3 Variant Is Associated With Polydactyly and Syndactyly in a Family by Blocking the Sonic Hedgehog Signaling Pathway.

Polydactyly and syndactyly are congenital limb malformations that may occur either as non-syndromic or syndromic forms. In the present study, massively parallel sequencing was performed on a proband in a four-generation family with polydactyly and syndactyly to identify disease-causing variant(s). A pathogenic variant c.739C > T (p.Gln247∗) in the glioma-associated oncogene family zinc finger 3 (GLI3) gene was identified and co-segregated with the affected members of the family. Firstly, we examined GLI3 mRNA and GLI3 protein levels in peripheral blood mononuclear cells (PBMCs) of patients carrying this variant. The results showed that the truncated GLI3 p.Gln247∗ (c.739C > T) protein was detectable in patients and the GLI3 transcript and protein levels were not significantly altered in the PBMCs of patients compared with healthy controls. Furthermore, functional analysis showed that the truncated GLI3 p.Gln247∗ (c.739C > T) protein variant could lead to cytoplasmic accumulation of mutant protein and loss of ability to bind to the Suppressor of Fused protein. Alterations in protein expression levels of core components of the Sonic hedgehog signaling pathway were also observed. Our study shows that this novel GLI3 variant contributes to the malformations in this family and provides evidence for the mechanism by which GLI3 c.739C > T (p.Gln247∗) was implicated in the pathogenesis of polydactyly and syndactyly.