ABSTRACT
Peas (Pisum sativum L.) are widely cultivated in temperate regions and are susceptible hosts for various viruses across different families. The discovery and identification of new viruses in peas has significant implications for field disease management. Here, we identified a mixed infection of two viruses from field-collected peas exhibiting virus-like symptoms using metatranscriptome and small RNA sequencing techniques. Upon identification, one of the viruses was determined to be a newly isolated and discovered bymovirus from peas, named "pea bymovirus 1 (PBV1)". The other was identified as a novel variant of bean yellow mosaic virus (BYMV-HZ1). Subsequently, mechanical inoculation and RT-PCR assays confirmed that both viruses could be inoculated back onto peas and tobaccos, showing mixed infection by PBV1 and BYMV-HZ1. To our knowledge, this is the first isolation of a bymovirus from pea and the first documented case of mixed infection of peas by PBV1 and BYMV-HZ1 in China.
ABSTRACT
Communication between insects and plants relies on the exchange of bioactive molecules that traverse the species interface. Although proteinic effectors have been extensively studied, our knowledge of other molecules involved in this process remains limited. In this study, we investigate the role of salivary microRNAs (miRNAs) from the rice planthopper Nilaparvata lugens in suppressing plant immunity. A total of three miRNAs were confirmed to be secreted into host plants during insect feeding. Notably, the sequence-conserved miR-7-5P is specifically expressed in the salivary glands of N. lugens and is secreted into saliva, distinguishing it significantly from homologues found in other insects. Silencing miR-7-5P negatively affects N. lugens feeding on rice plants, but not on artificial diets. The impaired feeding performance of miR-7-5P-silenced insects can be rescued by transgenic plants overexpressing miR-7-5P. Through target prediction and experimental testing, we demonstrate that miR-7-5P targets multiple plant genes, including the immune-associated bZIP transcription factor 43 (OsbZIP43). Infestation of rice plants by miR-7-5P-silenced insects leads to the increased expression of OsbZIP43, while the presence of miR-7-5P counteracts this upregulation effect. Furthermore, overexpressing OsbZIP43 confers plant resistance against insects which can be subverted by miR-7-5P. Our findings suggest a mechanism by which herbivorous insects have evolved salivary miRNAs to suppress plant immunity, expanding our understanding of cross-kingdom RNA interference between interacting organisms.
Subject(s)
Hemiptera , MicroRNAs , Oryza , Animals , RNA Interference , MicroRNAs/genetics , MicroRNAs/metabolism , Saliva , Hemiptera/physiology , Plant Immunity/genetics , Oryza/geneticsABSTRACT
Trees and shrubs provide important ecological services. However, few studies have surveyed the virome in trees and shrubs. In this study, we discovered a new positive-sense RNA virus originating from Viburnum odoratissimum, which we named "Vo narna-like virus". The complete genome of Vo narna-like virus is 3,451 nt in length with an open reading frame (ORF) encoding the RNA-dependent RNA polymerase (RdRP) protein. Phylogenetic analysis placed this virus within the betanarnavirus clade, sharing 53.63% amino acid sequence identity with its closest relative, Qingdao RNA virus 2. The complete sequence of the virus was confirmed by rapid amplification of cDNA ends (RACE) and Sanger sequencing. Small interfering RNA (siRNA) analysis indicated that this virus interacts with the RNA interference (RNAi) pathway of V. odoratissimum. This is the first report of a narnavirus in V. odoratissimum.
Subject(s)
RNA Viruses , Viburnum , Viburnum/genetics , RNA, Viral/genetics , Phylogeny , Genome, Viral , RNA Viruses/genetics , Open Reading FramesABSTRACT
Lysine acetylation is a dynamic post-translational modification of proteins. Extensive studies have revealed that the acetylation modulated by histone acetyltransferases and histone deacetylases (HDACs) plays a crucial role in regulating protein function. However, there has been limited focus on how HDACs regulate jasmonic acid (JA) biosynthesis in plants. Here, we uncover that the protein stability of OsLOX14, a critical enzyme involved in JA biosynthesis, is regulated by a histone deacetylase, OsHDA706, and is hindered by a viral protein. Our results show that OsHDA706 deacetylates OsLOX14 and enhances the stability of OsLOX14, leading to JA accumulation and an improved broad-spectrum rice antiviral defense. Furthermore, we found that the viral protein P2, encoded by the destructive rice stripe virus, disrupts the association of OsHDA706-OsLOX14, promoting viral infection. Overall, our findings reveal how HDAC manipulates the interplay of deacetylation and protein stability of a JA biosynthetic enzyme to enhance plant antiviral responses.
Subject(s)
Histone Acetyltransferases , Histone Deacetylases , Histone Deacetylases/metabolism , Histone Acetyltransferases/metabolism , Protein Processing, Post-Translational , Viral Proteins/metabolism , AcetylationABSTRACT
Chinese bayberry (Myrica rubra) is an economically significant fruit tree native to eastern Asia and widely planted in south-central China. However, studies about the viruses infecting M. rubra remain largely lacking. In the present study, we employed the metatranscriptomic method to identify viruses in M. rubra leaves exhibiting yellowing and irregular margin symptoms collected in Fuzhou, a city located in China's Fujian province in the year 2022. As a consequence, a novel member of the genus Totivirus was identified and tentatively named "Myrica rubra associated totivirus 1" (MRaTV1). The genome sequencing of MRaTV1 was determined by overlapping reverse transcription polymerase chain reaction (RT-PCR) and rapid amplification of cDNA ends (RACE). The two deduced proteins encoded by MRaTV1 have the highest amino acid (aa) sequence identity to the coat protein (CP) and RNA-dependent RNA polymerase (RdRP) of Panax notoginseng virus A (PNVA), a member of the genus Totivirus within the family Totiviridae, at 49.7% and 61.7%, respectively. According to the results of the phylogenetic tree and the species demarcation criteria of the International Committee on Taxonomy of Viruses (ICTV) for the genus Totivirus, MRaTV1 is considered a new member of the genus Totivirus.
Subject(s)
Myrica , Totivirus , Myrica/genetics , Phylogeny , Genome, Viral , Base SequenceABSTRACT
Gardenia (Gardenia jasminoides) is a popular and economically vital plant known for its ornamental and medicinal properties. Despite its widespread cultivation, there has been no documentation of plant viruses on gardenia yet. In the present study, gardenia leaves exhibiting symptoms of plant viral diseases were sampled and sequenced by both metatranscriptome and small RNA sequencing. As a consequence, bean common mosaic virus (BCMV) was identified in gardenia for the first time and named BCMV-gardenia. The full genome sequence of BCMV-gardenia is 10,054 nucleotides (nt) in length (excluding the poly (A) at the 3' termini), encoding a large polyprotein of 3,222 amino acids. Sequence analysis showed that the N-termini of the polyprotein encoded by BCMV-gardenia is less conserved when compared to other BCMV isolates, whereas the C-termini is the most conserved. Maximum likelihood phylogenetic analysis showed that BCMV-gardenia was clustered closely with other BCMV isolates identified outside the leguminous plants. Our results indicated that the majority of BCMV-gardenia virus-derived small interfering RNAs (vsiRNAs) were 21 nt and 22 nt, with 21 nt being more abundant. The first nucleotide at the 5' termini of vsiRNAs derived from BCMV-gardenia preferred U and A. The ratio of vsiRNAs derived from sense (51.1%) and antisense (48.9%) strands is approaching, and the distribution of vsiRNAs along the viral genome is generally even, with some hot spots forming in local regions. Our findings could provide new insights into the diversity, evolution, and host expansion of BCMV and contribute to the prevention and treatment of this virus.
ABSTRACT
The complete genomic sequence of a novel robigovirus, provisionally named "Mentha arvensis robigovirus 1" (MARV1), was determined by combining next-generation sequencing (NGS), reverse transcription polymerase chain reaction (RT-PCR), and rapid amplification of cDNA ends (RACE) PCR. The complete genomic sequence of this new virus is 7617 nucleotides in length, excluding the 3' poly(A) tail. The MARV1 genome encodes a putative replicase, "triple gene block" proteins, and a coat protein. Phylogenetic analysis demonstrated that MARV1 is a member of the genus Robigovirus, with closest relationships to African oil palm ringspot virus (AOPRV). Furthermore, MARV1-derived small interfering RNAs (siRNAs) showed typical patterns of plant-virus-derived siRNAs produced by the host antiviral RNA interference pathway. This is the first report of a plant virus of the genus Robigovirus in M. arvensis.
Subject(s)
Flexiviridae , Mentha , Phylogeny , Genomics , High-Throughput Nucleotide Sequencing , RNA, Messenger , RNA, Small Interfering/geneticsABSTRACT
Apolipoprotein D (ApoD), a member of the lipocalin superfamily of proteins, is involved in lipid transport and stress resistance. Whereas only a single copy of the ApoD gene is found in humans and some other vertebrates, there are typically several ApoD-like genes in insects. To date, there have been relatively few studies that have examined the evolution and functional differentiation of ApoD-like genes in insects, particularly hemi-metabolous insects. In this study, we identified 10 ApoD-like genes (NlApoD1-10) with distinct spatiotemporal expression patterns in Nilaparvata lugens (BPH), which is an important pest of rice. NlApoD1-10 were found to be distributed on 3 chromosomes in a tandem array of NlApoD1/2, NlApoD3-5, and NlApoD7/8, and show sequence and gene structural divergence in the coding regions, indicating that multiple gene duplication events occurred during evolution. Phylogenetic analysis revealed that NlApoD1-10 can be clustered into 5 clades, with NlApoD3-5 and NlApoD7/8 potentially evolving exclusively in the Delphacidae family. Functional screening using an RNA interference approach revealed that only NlApoD2 was essential for BPH development and survival, whereas NlApoD4/5 are highly expressed in testes, and might play roles in reproduction. Moreover, stress response analysis revealed that NlApoD3-5/9, NlApoD3-5, and NlApoD9 were up-regulated after treatment with lipopolysaccharide, H2 O2 , and ultraviolet-C, respectively, indicating their potential roles in stress resistance.
Subject(s)
Hemiptera , Animals , Apolipoproteins D/genetics , Apolipoproteins D/metabolism , Hemiptera/physiology , Phylogeny , RNA InterferenceABSTRACT
Watermelon silver mottle virus (WSMoV), a member of the genus Orthotospovirus of the family Bunyaviridae, was first identified in watermelon in Okinawa prefecture, in Japan (Iwaki et al. 1984). Subsequently, it was reported in a variety of solanaceae and cucurbitaceae crops such as tomato, pepper, and watermelon (Jones et al. 2005). WSMoV is naturally transmitted by vector thrips, and cause chlorotic, ring spots, and crinkling in the hosts (Yeh et al. 1992; Jones et al. 2005). So far, no confirmed reports exist regarding the WSMoV infecting peanut (Arachis hypogaea L.). In a field survey conducted in Yunnan Province, China during July 2022, young peanut plants were observed that were severely stunted (Fig. S1A). The leaves of five symptomatic peanut plants were randomly collected and used to identify potential pathogens via high throughput sequencing (HTS) analysis. Total RNA was extracted using TRIzol® Reagent (Invitrogen, CA, USA) according to the manufacturer's instructions. Approximately 10 µg of total RNA was purified using magnetic beads (Thermo Fischer Scientific, U.S.A.). A TruSeq RNA sample prep kit (Illumina, San Diego, CA, USA) was utilized for constructing the RNA sequencing library and transcriptome sequencing was performed on an Illumina HiSeq4000 platform (LC Sciences, USA) with a paired-end 150 bp manner. After RNA-seq, 35962944 raw reads were generated as paired-end data. Following quality control, a total of 34026806 clean reads were retained and subsequently assembled into contigs using Trinity software (version 2.8.5). The BLASTn analysis showed that three contigs mapped to the L, M, and S RNA segments of the WSMoV isolates, respectively (accession no. AY863200.1; no. AB042650.1; no. U75379.1). The lengths of three contigs were 8913 bp, 4921 bp, and 3558 bp, and the breadth coverage were 99.97%, 100%, and 100%, respectively. The sequences for L, M and S RNA segments of the WSMoV isolate from Yunnan were submitted to NCBI with the accession number OR123869-OR123871. Specific primers were designed for the nucleocapsid protein (NP) on WSMoV S RNA (5'-ATGTCTAACGTTAAGCAGCT-3'; 5'-TTACACTTCTAAGGAGGTGCT-3'; 828 bp) and the RNA-dependent RNA polymerase (RdRP) on WSMoV L RNA (5'-CTATATGTGCAGGGGGCTGG-3'; 5'- ACCCCTCAATTATGCTCGGC -3'; 948 bp) to verify the presence of WSMoV in peanut plants by RT-PCR. The expected PCR products were successfully amplified from each of the symptomatic tested plants, while not in negative controls (Fig. S1, B and C). Furthermore, the extracted total RNA was subjected to small RNA sequencing, and the results showed the detected small RNAs present a major peak at 21 nt and 22 nt (Fig. S1D). This further confirmed the natural infection of WSMoV in stunted peanut plants. RDRP, an important conserved protein in RNA viruses, which is in the L RNA segment of WSMoV, was selected to construct the phylogenetic tree. The results showed that the WSMoV isolate from Yunnan (OR123869) clustered separately from previously reported isolates (Fig. S2). Numerous economically important crops infected with WSMoV in China have experienced severe economic losses (Rao et al. 2011; Tang et al. 2015). Our data has provided the first confirmation of WSMoV naturally infecting peanuts in China, increasing our knowledge of the virus's host range. Further research is needed to determine this virus's specific vectors, the scope of its spread, and its impact on China's peanut production.
ABSTRACT
Non-retroviral endogenous viral elements (nrEVEs) are widely dispersed throughout the genomes of eukaryotes. Although nrEVEs are known to be involved in host antiviral immunity, it remains an open question whether they can be domesticated as functional proteins to serve cellular innovations in arthropods. In this study, we found that endogenous toti-like viral elements (ToEVEs) are ubiquitously integrated into the genomes of three planthopper species, with highly variable distributions and polymorphism levels in planthopper populations. Three ToEVEs display exonâintron structures and active transcription, suggesting that they might have been domesticated by planthoppers. CRISPR/Cas9 experiments revealed that one ToEVE in Nilaparvata lugens, NlToEVE14, has been co-opted by its host and plays essential roles in planthopper development and fecundity. Large-scale analysis of ToEVEs in arthropod genomes indicated that the number of arthropod nrEVEs is currently underestimated and that they may contribute to the functional diversity of arthropod genes.
Subject(s)
Arthropods , Hemiptera , Animals , Arthropods/genetics , Hemiptera/genetics , RetroviridaeABSTRACT
China is the leading country for pumpkin production in the world. As other cucurbits, diseases caused by viruses are among the serious threats to pumpkin production, but our knowledge on the virus species infecting pumpkin plants is fragmentary. To understand the occurrence of viral diseases on pumpkin, we determined the geographical distribution characteristics, relative abundance and evolutionary relationship of pumpkin infected viruses by meta-transcriptome sequencing (RNA-seq) and viromic analysis of 159 samples exhibited typical viral symptoms collected across China in this study. Totally, 11 known and 3 new viruses were identified. Interestingly, 3 new viruses identified in this study should be positive-sense single-stranded RNA virus whose hosts are prokaryotes. The viruses identified in different sampling locations exhibit significant variations in term of virus species and relative abundance. Here, the results provide valuable information for understanding the virus species and their diversity in cultivated pumpkin across major growing regions of China.
Subject(s)
Cucurbita , Viruses , Phylogeny , ChinaABSTRACT
Viruses in the order Picornavirales possess a positive-strand RNA genome that encodes structural proteins (SPs) and nonstructural proteins (NSPs). According to the recent report of the International Committee on Taxonomy of Viruses (ICTV), there are 8 families in Picornavirales, and monopartite picornaviruses in each family exhibit distinct types of genome organizations with rearranged genes coding for SPs and NSPs, namely, TypeI (5'-SPs-NSPs-3') and TypeII (5'-NSPs-SPs-3'). In the present study, 2 iflaviruses with the 2 genome types were unexpectedly identified in a damselfly host species, suggesting that these 2 genome types coexisted in the same host species, and the families of order Picornavirales might be more complex than previously thought. The consequent systematic homologous screening with all the publicly available picornaviruses successfully revealed a considerable number of candidates rearranged genome types of picornaviruses in various families of Picornavirales. Subsequently, phylogenetic trees were reconstructed based on RNA dependent RNA polymerase and coat protein, which evidently confirmed the prevalence of the 10 typeII iflaviruses in the Iflaviridae family. This suggests that genome types may not be relevant to viral taxonomy in this family. However, candidate picornaviruses with reversed genome types in the Secoviridae and Dicistroviridae families require further investigation. All in all, as the number of newly discovered viruses increases, more viruses with non-canonical genome arrangements will be uncovered, which can expand our current knowledge on the genome complexity and evolution of picornaviruses. IMPORTANCE Monopartite viruses in the order Picornavirales exhibit distinct genome arrangement of nonstructural proteins and structural proteins for each of the 8 families. Recent studies indicated that at least 4 ifla-like viruses possessed reversed genome organization in the family Iflaviridae, raising the possibility that this phenomenon may commonly present in different families of picornaviruses. Since we discovered 2 iflaviruses with exchanged structural and nonstructural proteins simultaneously in the damselfly, a systematic screening was subsequently performed for all of the current available picornaviruses (1,543 candidates). The results revealed 10 picornaviruses with reversed genome organization in the family Iflaviridae, implying that this phenomenon might prevalence in the order Picornavirales. These results will contribute to a better understanding for the future study on the genome complexity and taxonomy of picornaviruses.
Subject(s)
Picornaviridae , RNA Viruses , Viruses , Phylogeny , Prevalence , Viruses/genetics , Picornaviridae/genetics , Genome, ViralABSTRACT
The complete genome of a new virus belonging to the family Betaflexiviridae was identified in garlic and sequenced by next-generation sequencing and reverse transcription PCR. The complete RNA genome (GenBank accession number OP021693) is 8191 nucleotides in length, excluding the 3' poly(A) tail, and contains five open reading frames (ORFs). These open reading frames encode the viral replicase, triple gene block, and coat protein, and the genome organization is typical of members of the subfamily Quinvirinae. The virus has been tentatively named "garlic yellow curl virus" (GYCV). Phylogenetic analysis suggested that it represents an independent evolutionary lineage in the subfamily, clustering with the currently unclassified garlic yellow mosaic associated virus (GYMaV) and peony betaflexivirus 1 (PeV1). Differences between the phylogenies inferred for the replicase and coat protein indicate that the new virus does not belong to any established genus of the family Betaflexiviridae. This is the first report of GYCV in China.
Subject(s)
Flexiviridae , Garlic , Garlic/genetics , Phylogeny , Genome, Viral , Flexiviridae/genetics , RNA , RNA, Messenger , Open Reading Frames , RNA, Viral/genetics , Plant DiseasesABSTRACT
An efficient carbon trading market can effectively curb excessive carbon emissions and thus slow down the pace of global warming, which heightens the necessity of improving the accuracy of carbon price forecasting. In order to overcome the weakness of previous prediction model that always trained data in one-way neural networks and propagated the data sequentially, this paper proposes a novel hybrid learning paradigm WPD-ISSA-BiLSTM combining wavelet packet decomposition (WPD), improved sparrow search algorithm (ISSA), and Bi-directional long short-term memory network for deep feature exploration of carbon prices. Firstly, WPD decomposes and reconstructs the original carbon price series into several independent subseries. Then, the input features of the all subseries are filtered with random forest to select the best input features for the prediction model. Finally, a Bi-directional long short-term memory network optimized by the ISSA is employed to deeply delineate the intrinsic evolutionary trends of carbon prices, and the prediction results of all subseries are superimposed on each other to obtain the final carbon price prediction results. The actual carbon emission trading prices are collected as input to the model, and the experimental results show that the RMSE values of the proposed model are 0.2516 and 0.2962 under the mild and severe volatility scenarios, respectively. The proposed model has superiority and robustness compared to the comparison model and several existing models and better understands the intrinsic correlation between historical carbon price data. The results of this study can provide meaningful references for the carbon market development and emission reduction pathways.
Subject(s)
Carbon , Memory, Short-Term , Algorithms , Forecasting , Neural Networks, ComputerABSTRACT
The small brown planthopper, Laodelphax striatellus (Hemiptera: Delphacidae), is an efficient vector of several economically important plant viruses. In this study, a novel reovirus-like virus was identified in L. striatellus, named Laodelphax striatellus reovirus (LSRV). The complete genome of LSRV was 28,207 nt, comprising of ten segments encoded 11 deduced proteins. All genome segments were conserved with AGUAA at the 5'-terminal and GUUGUC at 3'-terminal and segment-specific inverted terminal repeats. In addition, genomic characteristics and phylogenetic analysis suggested that LSRV was a new member of genus Fijivirus. Importantly, LSRV was widely distributed in various tissues and highest expressed in adult heads. However, LSRV was unable to horizontal replication in rice plants. Moreover, typical profiles of LSRV-derived small interfering RNAs indicated host antiviral RNA interference pathway was involved in LSRV infection. In conclusion, LSRV may be considered as a new species of the genus Fijivirus in the order Reovirales.
Subject(s)
Hemiptera , Orthoreovirus , Plant Viruses , Reoviridae , Animals , Insecta , Orthoreovirus/genetics , Phylogeny , Reoviridae/geneticsABSTRACT
The blood clam (Tegillarca granosa) is being developed into a model bivalve mollusc for assessing and monitoring marine pollution on the offshore seabed. However, the information on the response of blood clam to PAHs, an organic pollutant usually deposited in submarine sediment, remains limited. Herein, we employed multiple biomarkers, including histological changes, oxidative stress, neurotoxicity and global DNA methylation, to investigate the effects of 10 and 100 µg/L Bap exposure on the blood clams under laboratory conditions, as well as the potential mechanisms. Acute Bap exposure can induce significant morphological abnormalities in gills as shown through hematoxylin-eosin (H.E) staining, providing an intuitive understanding on the effects of Bap on the structural organization of the blood clams. Meanwhile, the oxidative stress was significantly elevated as manifested by the increase of antioxidants activities of superoxide dismutase (SOD), catalase (CAT), peroxidase (POD) and glutathione-s-transferase (GST), lipid peroxidation (LPO) level and 8-hydroxy-2'-deoxyguanosine (8-OHdG) content. The neurotoxicity was also strengthened by Bap toxicity manifested as inhibited acetylcholinesterase (AChE) and choline acetyltransferase (ChAT) activities. In addition, the global DNA methylation level was investigated, and a significant DNA hypomethylation was observed in Bap exposed the blood clam. The correlation analysis showed that the global DNA methylation was negatively correlated with antioxidants (SOD, CAT and POD) activities, but positively correlated choline enzymes (AChE and ChAT) activities. These results collectively suggested that acute Bap exposure can cause damage in gills structures in the blood clam possibly by generating oxidative stress and neurotoxicity, and the global DNA methylation was inhibited to increase the transcriptional expression level of antioxidants genes and consequently elevate antioxidants activities against Bap toxicity. These results are hoped to shed some new light on the study of ecotoxicology effect of PAHs on marine bivalves.
Subject(s)
Benzo(a)pyrene/toxicity , Bivalvia/drug effects , Epigenesis, Genetic/drug effects , Nervous System/drug effects , Oxidative Stress/drug effects , Animals , Bivalvia/genetics , Bivalvia/metabolismABSTRACT
The evolutionarily conserved target of rapamycin (TOR) kinase acts as a master regulator that coordinates cell proliferation and growth by integrating nutrient, energy, hormone and stress signals in all eukaryotes1,2. Research has focused mainly on TOR-regulated translation, but how TOR orchestrates the global transcriptional network remains unclear. Here we identify ethylene-insensitive protein 2 (EIN2), a central integrator3-5 that shuttles between the cytoplasm and the nucleus, as a direct substrate of TOR in Arabidopsis thaliana. Glucose-activated TOR kinase directly phosphorylates EIN2 to prevent its nuclear localization. Notably, the rapid global transcriptional reprogramming that is directed by glucose-TOR signalling is largely compromised in the ein2-5 mutant, and EIN2 negatively regulates the expression of a wide range of target genes of glucose-activated TOR that are involved in DNA replication, cell wall and lipid synthesis and various secondary metabolic pathways. Chemical, cellular and genetic analyses reveal that cell elongation and proliferation processes that are controlled by the glucose-TOR-EIN2 axis are decoupled from canonical ethylene-CTR1-EIN2 signalling, and mediated by different phosphorylation sites. Our findings reveal a molecular mechanism by which a central signalling hub is shared but differentially modulated by diverse signalling pathways using distinct phosphorylation codes that can be specified by upstream protein kinases.
Subject(s)
Arabidopsis Proteins/metabolism , Arabidopsis/growth & development , Arabidopsis/metabolism , Cell Nucleus/metabolism , Phosphatidylinositol 3-Kinases/metabolism , Plant Development , Receptors, Cell Surface/metabolism , Signal Transduction , Arabidopsis/cytology , Arabidopsis/genetics , Catalytic Domain , DNA-Binding Proteins/metabolism , Ethylenes/metabolism , Glucose/metabolism , Intracellular Signaling Peptides and Proteins/metabolism , Meristem/metabolism , Phosphorylation , Plant Growth Regulators/metabolism , Protein Kinases/metabolism , Substrate Specificity , Transcription Factors/metabolism , TranscriptomeABSTRACT
BACKGROUND: Plants are naturally associated with root microbiota, which are microbial communities influential to host fitness. Thus, it is important to understand how plants control root microbiota. Epigenetic factors regulate the readouts of genetic information and consequently many essential biological processes. However, it has been elusive whether RNA-directed DNA methylation (RdDM) affects root microbiota assembly. RESULTS: By applying 16S rRNA gene sequencing, we investigated root microbiota of Arabidopsis mutants defective in the canonical RdDM pathway, including dcl234 that harbors triple mutation in the Dicer-like proteins DCL3, DCL2, and DCL4, which produce small RNAs for RdDM. Alpha diversity analysis showed reductions in microbe richness from the soil to roots, reflecting the selectivity of plants on root-associated bacteria. The dcl234 triple mutation significantly decreases the levels of Aeromonadaceae and Pseudomonadaceae, while it increases the abundance of many other bacteria families in the root microbiota. However, mutants of the other examined key players in the canonical RdDM pathway showed similar microbiota as Col-0, indicating that the DCL proteins affect root microbiota in an RdDM-independent manner. Subsequently gene analysis by shotgun sequencing of root microbiome indicated a selective pressure on microbial resistance to plant defense in the dcl234 mutant. Consistent with the altered plant-microbe interactions, dcl234 displayed altered characters, including the mRNA and sRNA transcriptomes that jointly highlighted altered cell wall organization and up-regulated defense, the decreased cellulose and callose deposition in root xylem, and the restructured profile of root exudates that supported the alterations in gene expression and cell wall modifications. CONCLUSION: Our findings demonstrate an important role of the DCL proteins in influencing root microbiota through integrated regulation of plant defense, cell wall compositions, and root exudates. Our results also demonstrate that the canonical RdDM is dispensable for Arabidopsis root microbiota. These findings not only establish a connection between root microbiota and plant epigenetic factors but also highlight the complexity of plant regulation of root microbiota. Video abstract.
Subject(s)
Arabidopsis/metabolism , Arabidopsis/microbiology , DNA Methylation/genetics , Microbiota , Plant Roots/microbiology , RNA, Plant , Ribonuclease III/metabolism , Arabidopsis/genetics , Gene Expression Regulation, Plant/genetics , Microbiota/genetics , Plant Roots/genetics , RNA, Ribosomal, 16S/genetics , Ribonuclease III/geneticsABSTRACT
The thick shell mussel Mytilus coruscus has developed into a model species for studying the interaction between molluscs and environmental stimuli. Herein, integrated analysis of miRNAome and transcriptome was performed to reveal miRNA-mRNA network regulation in Vibrio alginolyticus infected M. coruscus. There have detected some histological abnormalities in digestive gland and gills of V. alginolyticus challenged mussels, ascertaining the effective irritation by the present bacterial strain. A total of 265 novel miRNAs were finally predicted, of which 26 were differentially expressed miRNAs (DEMs). Additionally, 667 differentially expressed genes (DEGs) were detected, which may be potentially associated with innate immune response to V. alginolyticus infection. A regulatory network linked to 22 important pathways and 16 DEMs and 34 OGs was constructed. Some traditional immune-related signaling pathways such as toll-like receptor signaling pathway (TLR) signaling pathway, transforming growth factor-beta (TGF-beta) signaling pathway, peroxisome, phagosome, lysosome, mammalian target of rapamyoin (mTOR) signaling pathway were linked to specific miRNAs and genes in this network. Further, interactional relationship between certain miRNAs and TLR pathway was dissected, which the results predicted that a number of TLRs and TLR-associated signaling genes including TLR1, TLR2, TLR4, TLR6, IRAK1, TRAF6, MAPK, and IL-17 were negatively regulated by novel_miR_11, novel_miR_145, novel_miR_196, novel_miR_5, novel_miR_163 and novel_miR_217 in the TLR pathway. Additionally, interactional relationship between novel_miR_145 and TLR2 was validated by laboratory experiment. The integrated analysis of mRNA and microRNA deep sequencing data exhibited a sophisticated miRNA-mRNA regulation network in M. coruscus in response to V. alginolyticus challenge, which shed a new light on the underlying mechanism of molluscan confronting bacterial infection.