ABSTRACT
A mounting body of evidences suggests that patients with chronic heart failure (HF) frequently experience cognitive impairments, but the neuroanatomical mechanism underlying these impairments remains elusive. In this retrospective study, 49 chronic HF patients and 49 healthy controls (HCs) underwent brain structural MRI scans and cognitive assessments. Cortical morphology index (cortical thickness, complexity, sulcal depth and gyrification) were evaluated. Correlations between cortical morphology and cognitive scores and clinical variables were explored. Logistic regression analysis was employed to identify risk factors for predicting 3-year major adverse cardiovascular events. Compared with HCs, patients with chronic HF exhibited decreased cognitive scores (p < .001) and decreased cortical thickness, sulcal depth and gyrification in brain regions involved cognition, sensorimotor, autonomic nervous system (family-wise error correction, all p values <.05). Notably, HF duration and New York Heart Association (NYHA) demonstrated negative correlations with abnormal cortex morphology, particularly HF duration and thickness in left precentral gyrus (r = -.387, p = .006). Cortical morphology characteristics exhibited positive associations with global cognition, particularly cortical thickness in left pars opercularis (r = .476, p < .001). NYHA class is an independent risk factor for adverse outcome (p = .001). The observed correlation between abnormal cortical morphology and global cognition suggested that cortical morphology may serve as a promising imaging biomarker and provide insights into neuroanatomical underpinnings of cognitive impairment in patients with chronic HF.
ABSTRACT
BACKGROUND: The rumen microbiome enables ruminants to digest otherwise indigestible feedstuffs, thereby facilitating the production of high-quality protein, albeit with suboptimal efficiency and producing methane. Despite extensive research delineating associations between the rumen microbiome and ruminant production traits, the functional roles of the pervasive and diverse rumen virome remain to be determined. RESULTS: Leveraging a recent comprehensive rumen virome database, this study analyzes virus-microbe linkages, at both species and strain levels, across 551 rumen metagenomes, elucidating patterns of microbial and viral diversity, co-occurrence, and virus-microbe interactions. Additionally, this study assesses the potential role of rumen viruses in microbial diversification by analyzing prophages found in rumen metagenome-assembled genomes. Employing CRISPR-Cas spacer-based matching and virus-microbe co-occurrence network analysis, this study suggests that the viruses in the rumen may regulate microbes at strain and community levels through both antagonistic and mutualistic interactions. Moreover, this study establishes that the rumen virome demonstrates responsiveness to dietary shifts and associations with key animal production traits, including feed efficiency, lactation performance, weight gain, and methane emissions. CONCLUSIONS: These findings provide a substantive framework for further investigations to unravel the functional roles of the virome in the rumen in shaping the microbiome and influencing overall animal production performance. Video Abstract.
Subject(s)
Metagenome , Rumen , Viruses , Rumen/microbiology , Rumen/virology , Animals , Viruses/classification , Viruses/genetics , Gastrointestinal Microbiome , Virome , Ruminants/microbiology , Ruminants/virology , Methane/metabolism , Animal Feed , Bacteria/classification , Bacteria/geneticsABSTRACT
OBJECTIVES: The study investigated whether percutaneous partial pressure of oxygen (PtcO2), percutaneous partial pressure of carbon dioxide (PtcCO2), and the derived tissue perfusion index (TPI) can predict the severity and short-term outcomes of severe and critical COVID-19. DESIGN: Prospective observational study conducted from January 1, 2023 to February 10, 2023. SETTING: A teaching hospital specializing in tertiary care in Nanjing City, Jiangsu Province, China. PARTICIPANTS: Adults (≥18 years) with severe and critical COVID-19. INTERVENTIONS: Not applicable. MAIN OUTCOME MEASURES: The general information and vital signs of the patients were collected. The PtcO2 and PtcCO2 were monitored in the left dorsal volar. The ratio of TPI was defined as the ratio of PtcO2/fraction of inspired oxygen (FiO2) to PtcCO2. Mortality at 28 was recorded. The ability of the TPI to assess disease severity and predict prognosis was determined. ENDPOINT: Severity of the disease on the enrollment and mortality at 28. RESULTS: A total of 71 patients with severe and critical COVID-19, including 40 severe and 31 critical cases, according to the COVID-19 treatment guidelines published by WHO, were recruited. Their median age was 70 years, with 56 (79%) males. The median SpO2/FiO2, PtcO2, PtcCO2, PtcO2/ FiO2, and TPI values were 237, 61, 42, 143, and 3.6â mm Hg, respectively. Compared with those for severe COVID-19, the TPI, PtcO2/ FiO2, SpO2/FiO2, and PtcO2 were significantly lower in critical COVID-19, while the PtcCO2 was significantly higher. After 28 days, 26 (37%) patients had died. TPI values < 3.5 were correlated with more severe disease status (AUC 0.914; 95% CI: 0.847-0.981, P < 0.001), and TPI < 3.3 was associated with poor outcomes (AUC 0.937; 95% CI 0.880-0.994, P < 0.001). CONCLUSIONS: The tissue perfusion index (TPI), PtcCO2, and PtcO2/ FiO2 can predict the severity and outcome of severe and critical COVID-19.
ABSTRACT
Inherited neuromuscular disorder (IND) is a broad-spectrum, clinically diverse group of diseases that are caused due to defects in the neurosystem, muscles and related tissue. Since IND may originate from mutations in hundreds of different genes, the resulting heterogeneity of IND is a great challenge for accurate diagnosis and subsequent management. Three pediatric cases with IND were enrolled in the present study and subjected to a thorough clinical examination. Next, a genetic investigation was conducted using whole-exome sequencing (WES). The suspected variants were validated through Sanger sequencing or quantitative fluorescence PCR assay. A new missense variant of the Spastin (SPAST) gene was found and analyzed at the structural level using molecular dynamics (MD) simulations. All three cases presented with respective specific clinical manifestations, which reflected the diversity of IND. WES detected the diagnostic variants in all 3 cases: A compound variation comprising collagen type VI α3 chain (COL6A3) (NM_004369; exon19):c.6322G>T(p.E1208*) and a one-copy loss of COL6A3:exon19 in Case 1, which are being reported for the first time; a de novo SPAST (NM_014946; exon8):c.1166C>A(p.T389K) variant in Case 2; and a de novo Duchenne muscular dystrophy (NM_004006; exon11):c.1150-17_1160delACTTCCTTCTTTGTCAGGGGTACATGATinsC variant in Case 3. The structural and MD analyses revealed that the detected novel SPAST: c.1166C>A(p.T389K) variant mainly altered the intramolecular hydrogen bonding status and the protein segment's secondary structure. In conclusion, the present study expanded the IND mutation spectrum. The study not only detailed the precise diagnoses of these cases but also furnished substantial grounds for informed consultations. The approach involving the genetic evaluation strategy using WES for variation screening followed by validation using appropriate methods is beneficial due to the considerable heterogeneity of IND.
ABSTRACT
The structural characteristics of fucoidans exhibit species and regional diversity. Previous studies have demonstrated that Laminaria japonica- and Ascophyllum nodosum-derived fucoidans have type I and type II fucosyl chains, respectively. These chemical differences may contribute to distinct hypolipidemic effects and mechanisms of action. Chemical analysis demonstrated that the percentage contents of sulfate, glucuronic acid, and galactose were higher in L. japonica-derived fucoidans than those of A. nodosum-derived fucoidans. In hyperlipidemic apolipoprotein E-deficient mice, both A. nodosum- and L. japonica-derived fucoidans significantly decreased the plasma and hepatic levels of total cholesterol and triglyceride, leading to the reduction of atherosclerotic plaques. Western blotting experiments demonstrated that these fucoidans significantly enhanced the expression and levels of scavenger receptor B type 1, cholesterol 7 alpha-hydroxylase A1, and peroxisome proliferator-activated receptor (PPAR)-α, contributing to circulating lipoprotein clearance and fatty acid degradation, respectively. Differentially, L. japonica-derived fucoidan significantly increased the LXR/ATP-binding cassette G8 signaling pathway in the small intestine, as revealed by real-time quantitative PCR, which may lead to further cholesterol and other lipid excretion. Collectively, these data are useful for understanding the hypolipidemic mechanisms of action of seaweed-derived fucoidans, and their potential application for the prevention and/or treatment of atherosclerotic cardiovascular diseases.
ABSTRACT
BACKGROUND: ICU readmissions and post-discharge mortality pose significant challenges. Previous studies used EHRs and machine learning models, but mostly focused on structured data. Nursing records contain crucial unstructured information, but their utilization is challenging. Natural language processing (NLP) can extract structured features from clinical text. This study proposes the Crucial Nursing Description Extractor (CNDE) to predict post-ICU discharge mortality rates and identify high-risk patients for unplanned readmission by analyzing electronic nursing records. OBJECTIVE: Developed a deep neural network (NurnaNet) with the ability to perceive nursing records, combined with a bio-clinical medicine pre-trained language model (BioClinicalBERT) to analyze the electronic health records (EHRs) in the MIMIC III dataset to predict the death of patients within six month and two year risk. DESIGN: A cohort and system development design was used. SETTING(S): Based on data extracted from MIMIC-III, a database of critically ill in the US between 2001 and 2012, the results were analyzed. PARTICIPANTS: We calculated patients' age using admission time and date of birth information from the MIMIC dataset. Patients under 18 or over 89â¯years old, or who died in the hospital, were excluded. We analyzed 16,973 nursing records from patients' ICU stays. METHODS: We have developed a technology called the Crucial Nursing Description Extractor (CNDE), which extracts key content from text. We use the logarithmic likelihood ratio to extract keywords and combine BioClinicalBERT. We predict the survival of discharged patients after six months and two years and evaluate the performance of the model using precision, recall, the F1-score, the receiver operating characteristic curve (ROC curve), the area under the curve (AUC), and the precision-recall curve (PR curve). RESULTS: The research findings indicate that NurnaNet achieved good F1-scores (0.67030, 0.70874) within six months and two years. Compared to using BioClinicalBERT alone, there was an improvement in performance of 2.05â¯% and 1.08â¯% for predictions within six months and two years, respectively. CONCLUSIONS: CNDE can effectively reduce long-form records and extract key content. NurnaNet has a good F1-score in analyzing the data of nursing records, which helps to identify the risk of death of patients after leaving the hospital and adjust the regular follow-up and treatment plan of relevant medical care as soon as possible.
ABSTRACT
Chili pepper (Capsicum) is known for its unique fruit pungency due to the presence of capsaicinoids. The evolutionary history of capsaicinoid biosynthesis and the mechanism of their tissue specificity remain obscure due to the lack of high-quality Capsicum genomes. Here, we report two telomere-to-telomere (T2T) gap-free genomes of C. annuum and its wild nonpungent relative C. rhomboideum to investigate the evolution of fruit pungency in chili peppers. We precisely delineate Capsicum centromeres, which lack high-copy tandem repeats but are extensively invaded by CRM retrotransposons. Through phylogenomic analyses, we estimate the evolutionary timing of capsaicinoid biosynthesis. We reveal disrupted coding and regulatory regions of key biosynthesis genes in nonpungent species. We also find conserved placenta-specific accessible chromatin regions, which likely allow for tissue-specific biosynthetic gene coregulation and capsaicinoid accumulation. These T2T genomic resources will accelerate chili pepper genetic improvement and help to understand Capsicum genome evolution.
Subject(s)
Capsaicin , Capsicum , Evolution, Molecular , Genome, Plant , Phylogeny , Telomere , Capsicum/genetics , Capsicum/metabolism , Capsaicin/metabolism , Telomere/genetics , Telomere/metabolism , Fruit/genetics , Fruit/metabolism , Retroelements/genetics , Gene Expression Regulation, PlantABSTRACT
Neuronal reconstruction-a process that transforms image volumes into 3D geometries and skeletons of cells-bottlenecks the study of brain function, connectomics and pathology. Unlike artistic domains with similar challenges (e.g., hair modeling), scientists need exact and complete segmentations to study subtle topological differences. Existing methods are disk-bound, dense-access, coupled, single-threaded, algorithmically unscalable and require manual cropping of small windows and proofreading of skeletons due to low topological accuracy. Designing a data-intensive parallel solution suited to a neurons' shape, topology and far-ranging connectivity is particularly challenging due to I/O and load-balance, yet by abstracting vision tasks such as segmentation and skeletonization into strategically ordered specializations of search, we progressively lower memory by 4 orders of magnitude. This enables 1 mouse brain to be fully processed in-memory on a single server, at 67× the scale with 870× less memory while having 78% higher automated yield than the highest performing alternative methods.
ABSTRACT
OBJECTIVE: In this study, we used ultra-wide field swept-source optical coherence tomography angiography (UWF SS-OCTA) to assess changes in retinal thickness (RT) and choroidal parameters in individuals who had received a diagnosis of central serous chorioretinopathy (CSC). METHODS: The study encompassed the evaluation of 59 eyes from 47 patients with a diagnosis of CSC, alongside 33 fellow eyes and 31 eyes from healthy individuals (controls). The parameters assessed included RT, choroidal thickness (CT), choriocapillaris density, vascular density of the large choroidal vessel layer, three-dimensional choroidal vascularity index (3D-CVI), choroidal vessel volume per unit area (mCVV/a), and choroidal stroma volume per unit area (mCSV/a). RESULTS: Metrics including mCVV/a, mCSV/a, 3D-CVI, CT, and RT exhibited significantly elevated values in the eyes affected by CSC compared to those of the control group across nine subfields. Moreover, a substantial number of the subfields in both CSC-affected and fellow eyes exhibited increased values for mCVV/a, mCSV/a, 3D-CVI, CT, and RT when compared with the control group. Additionally, acute and chronic CSC subfields demonstrated significantly elevated values for mCVV/a, mCSV/a, 3D-CVI, CT, and RT in comparison to healthy control eyes. Notably, specific subfields associated with complex and atypical forms of CSC revealed higher metrics compared to those of the control group. CONCLUSION: In conclusion, the UWF SS-OCTA proved to be a valuable tool for exploring the anatomical etiology and clinical classification and diagnosis of CSC.
Subject(s)
Central Serous Chorioretinopathy , Humans , Central Serous Chorioretinopathy/diagnosis , Cross-Sectional Studies , Fluorescein Angiography/methods , Tomography, Optical Coherence/methods , Visual Acuity , Choroid/blood supply , Retrospective StudiesABSTRACT
Background: The relationship between gut microbiota composition and coronary heart disease (CHD) has been recently reported in several observational studies. However, the causal effect of gut microbiota on coronary heart disease is uncharted. Objective: This study attempted to investigate the effect of gut microbiota on coronary heart disease by Mendelian randomization (MR) analysis. Methods: Through the two-sample MR method, single-nucleotide polymorphisms relevant to gut microbiota were selected as instrument variables to evaluate the causal association between gut microbiota and the risk of CHD. Results: According to the selection criteria of the inverse variance-weighted average method, Class Actinobacteria, Class Lentisphaeria, Family Clostridiales vadinBB60group, Genus Clostridium innocuum group, Genus Bifidobacterium, Genus Butyricicoccus, Genus Oxalobacter, Genus Turicibacter, and Order Victivallales, presented a suggestive association with coronary heart disease. Conclusion: This two-sample Mendelian randomization study found that gut microbiota was causally associated with coronary heart disease. Further randomized controlled trials are needed to clarify the protective effect of probiotics on coronary heart disease and their specific protective mechanisms.
ABSTRACT
Age-related macular degeneration (AMD) and diabetic retinopathy (DR) are the world's leading causes of blindness. The retinal pigment epithelium (RPE) and vascular endothelial cell exposed to oxidative stress is the major cause of AMD and DR. DJ-1, an important endogenous antioxidant, its overexpression is considered as a promising antioxidant treatment for AMD and DR. Here, we modified the tetrahedral frame nucleic acids (tFNAs) with DJ-1 saRNAs as a delivery system, and synthesized a novel nanocomplex (tFNAs-DJ-1 saRNAs). In vitro studies show that tFNAs-DJ-1 saRNAs can efficiently transfer DJ-1 saRNAs to human umbilical vein endothelial cells (HUVECs) and ARPE-19s, and significantly increased their cellular DJ-1 level. Reactive oxygen species expression in H2O2-treated HUVECs and ARPE-19s were decreased, cell viability was enhanced and cell apoptosis were inhibited when tFNAs-DJ-1 saRNAs were delivered. Moreover, tFNAs-DJ-1 saRNAs preserved mitochondrial structure and function under oxidative stress conditions. In the aspect of molecular mechanism, tFNAs-DJ-1 saRNAs activated Erk and Nrf2 pathway, which might contribute to its protective effects against oxidative stress damage. To conclude, this study shows the successfully establishment of a simple but effective delivery system of DJ-1 saRNAs associated with antioxidant effects in AMD and DR, which may be a promising agent for future treatment in oxidative stress-related retinal disorders.
ABSTRACT
Microtubule-associated protein 1a (Map1a) is a microtubule (MT) regulatory protein that binds to the MT protofilaments in mammalian cells to promote MT stabilization. Maps work with MT cleavage proteins and other MT catastrophe-inducing proteins to confer MT dynamics to support changes in the Sertoli cell shape to sustain spermatogenesis. However, no functional studies are found in the literature to probe its role in spermatogenesis. Using an RNAi approach, coupled with the use of toxicant-induced testis (in vivo)- and Sertoli cell (in vitro)-injury models, RNA-Seq analysis, transcriptome profiling, and relevant bioinformatics analysis, immunofluorescence analysis, and pertinent biochemical assays for cytoskeletal organization, we have delineated the functional role of Map1a in Sertoli cells and testes. Map1a was shown to support MT structural organization, and its knockdown (KD) also perturbed the structural organization of actin, vimentin, and septin cytoskeletons as these cytoskeletons are intimately related, working in concert to support spermatogenesis. More importantly, cadmium-induced Sertoli cell injury that perturbed the MT structural organization across the cell cytoplasm was associated with disruptive changes in the distribution of Map1a and a surge in p-p38-MAPK (phosphorylated p38-mitogen-activated protein kinase) expression but not total p38-MAPK. These findings thus support the notion that p-p38-MAPK activation is involved in cadmium-induced Sertoli cell injury. This conclusion was supported by studies using doramapimod, a specific p38-MAPK phosphorylation (activation) inhibitor, which was capable of restoring the cadmium-induced disruptive structural organization of MTs across the Sertoli cell cytoplasm. In summary: this study provides mechanistic insights regarding restoration of toxicant-induced Sertoli cell and testis injury and male infertility.
Subject(s)
Actins , Sertoli Cells , Rats , Animals , Male , Actins/metabolism , Sertoli Cells/metabolism , Cadmium , Rats, Sprague-Dawley , Blood-Testis Barrier/metabolism , Microtubules/metabolism , Testis/metabolism , Spermatogenesis/physiology , MammalsABSTRACT
Background: The value of semiquantitative resting myocardial perfusion imaging (MPI) in coronary artery disease (CAD) is limited. At present, quantitative MPI can be performed by a new cadmium zinc tellurium single-photon emission computed tomography (CZT-SPECT) scan. The quantitative index of resting myocardial blood flow (MBF) has received little attention, and its manifestations and clinical value in the presence of unstable coronary blood flow have not been clarified. Purpose: In patients with ST-segment elevation myocardial infarction (STEMI), whether resting MBF can provide additional value of blood flow than semi-quantitative resting MPI is not sure. We also explored the influencing factors of resting MBF. Methods: This was a retrospective clinical study. We included 75 patients with STEMI in the subacute phase who underwent resting MPI and dynamic scans after reperfusion therapy. General patient information, STEMI-related data, MPI, gated MPI (G-MPI), and resting MBF data were collected and recorded. According to the clinically provided culprit vessels, the resting MBF was divided into ischemic MBF and non-ischemic MBF. The paired Wilcoxon signed-rank test was used for resting MBF. The receiver operating characteristic (ROC) curves were used to determine the optimal threshold for ischemia, and multiple linear regression analysis was used to analyze the influencing factors of resting MBF. Results: There was a statistically significant difference between the ischemic MBF and non-ischemic MBF [0.59 (0.47-0.72) vs. 0.76 (0.64-0.93), p < 0.0001]. The ROC curve analysis revealed that resting MBF could identify ischemia to a certain extent, with a cutoff value of 0.5975, area under the curve (AUC) = 0.666, sensitivity = 55.8%, and specificity = 68.7%. Male sex and summed rest score (SRS) were influencing factors for resting MBF. Conclusion: To a certain extent, resting MBF can suggest residual ischemia after reperfusion therapy in patients with STEMI. There was a negative correlation between male sex, SRS, and ischemic MBF. A lower resting MBF may be associated with more severe myocardial ischemia.
ABSTRACT
Triple-negative breast cancer (TNBC) has negative expressions of ER, PR and HER2. Due to the insensitivity to both endocrine therapy and HER2-targeted therapy, the main treatment method for TNBC is cytotoxic chemotherapy. However, the curative effect of chemotherapy is limited because of the existence of acquired or intrinsic multidrug resistance. MicroRNAs (miRNAs) are frequently dysregulated in malignant tumors and involved in tumor occurrence and progression. Interestingly, growing studies show that miRNAs are involved in chemoresistance in TNBC. Thus, targeting dysregulated miRNAs could be a plausible way for better treatment of TNBC. Here, we present the updated knowledge of miRNAs associated with chemoresistance in TNBC, which may be helpful for the early diagnosis, prognosis and treatment of this life-threatening disease.
Triple-negative breast cancer (TNBC) is a subtype of breast cancer, which is characterized by high rates of invasion, recurrence and distant metastasis. At present, chemotherapy is still the main treatment option for TNBC. However, after some time, the sensitivity of tumor cells to chemotherapeutic drugs gradually decreases, which makes tumor cells develop chemoresistance. MicroRNAs (miRNAs) are a class of small RNA molecules with length of 1925 nucleotides that do not encode proteins. The expression level of miRNAs in cancer is usually abnormal. More and more studies have shown that miRNAs are involved in cancer development and associated with drug resistance. Therefore, this review summarizes the miRNAs associated with chemoresistance in TNBC.
ABSTRACT
A highly efficient ratiometric electrochemiluminescence (ECL) immunoassay was explored by bidirectionally regulating the ECL intensity of two luminophors. The immunoassay was conducted in a split-type mode consisting of an ECL detection procedure and a sandwich immunoreaction. The ECL detection was executed using a dual-disk glassy carbon electrode modified with two potential-resolved luminophors (g-C3N4-Ag and Ru-MOF-Ag nanocomposites), and the sandwich immunoreaction using glucose oxidase (GOx)-modified SiO2 nanospheres as labels was carried out in a 96-well plate. The Ag nanoparticles (NPs) acted as bifunctional units both for triggering the resonance energy transfer (RET) with g-C3N4 and for accelerating the electron transfer rate of the Ru-MOF-Ag ECL reaction. When the H2O2 catalyzed by GOx in the 96-well plate was transferred to the dual-disk glass carbon electrode, the doped Ag NPs in the two luminophors could be etched, thus destroying the RET between C3N4 and the accelerated reaction to Ru-MOF, resulting in an opposite trend in the ECL signal outputted from the dual disks. Using the ratio of the two signals for quantification, the constructed immunosensor for a model target, i.e. myoglobin, exhibited a low detection limit of 4.7 × 10-14 g/mL. The ingenious combination of ECL ratiometry, bifunctional Ag NPs, and a split-type strategy effectively reduces environmental and human errors, offering a more precise and sensitive analysis for complex samples.
ABSTRACT
The purpose of this study was to evaluate the economics of Annao Pills combined with antihypertensive drugs in the treatment of primary hypertension in the Chinese medical setting. TreeAge pro 2018 was used for cost-effect analysis and sensitivity analysis of the two treatment regimens. The intervention time of the simulation model was 2 weeks. The cost parameters were derived from Yaozhi.com, and the effect parameters were based on Meta-analysis of randomized controlled trial(RCT) involving Annao Pills. The experimental group was treated with Annao Pills combined with anti-hypertensive drugs(nifedipine controlled-release tablets + losartan potassium tablets), and the control group was treated with anti-hypertensive drugs(nifedipine controlled-release tablets + losartan potassium tablets). The basic analysis showed that the incremental cost-effect ratio(ICER) of the two groups was 2 678.67 yuan, which was less than 7.26% of the per capita disposable income in 2022. That is, compared with anti-hypertensive drugs alone, Annao Pills combined with antihypertensive drugs cost 2 678.67 yuan more for each additional patient with primary hypertension. The results of sensitivity analysis verified the robustness of the basic analysis results. The probability sensitivity results showed that when the patient's personal willingness to pay the price was higher than 2 650 yuan, the probability of the regimen in the experimental group was higher, which was consistent with the results of the basic analysis. In conclusion, when the price was higher than 2 650 yuan, Annao Pills combined with anti-hypertensive drugs was more economical than anti-hypertensive drugs alone in terms of improving the response rate of the patients with primary hypertension.
Subject(s)
Antihypertensive Agents , Nifedipine , Humans , Antihypertensive Agents/therapeutic use , Cost-Benefit Analysis , Decision Trees , Delayed-Action Preparations , Essential Hypertension , Losartan/therapeutic useABSTRACT
Due to the lack of specialized guidance, the post-marketing research on clinical effectiveness of Chinese patent medicines demonstrates varied quality and lacks high-quality evidence, failing to meet the demands of policy-making, clinical decision-making, and industrial decision-making. To address this issue, this project gathered experts in clinical medicine, clinical pharmacy, evidence-based medicine, drug epidemiology, medical ethics, and policy and regulation in China. They referred to the model of international post-marketing research on medicines and developed Guidelines for post-marketing research on clinical effectiveness of Chinese patent medicines under the framework of relevant laws and regulations and technical guidance documents in China. The guidelines were developed with consideration to the characteristics of Chinese patent medicines, China's national conditions, and all the stakeholders including marketing authorization holders, clinical researchers, drug administration, and users. The development of the guidelines followed the requirements for developing group standards set by the China Association of Chinese Medicine. The guidelines fully implement the concept of full life-cycle research, emphasizing the combination of traditional Chinese medicine(TCM) theory, human use experience, and clinical trials and pay attention to the compliance, scientificity, and ethics of research. The guidelines clarify the topic selection and decision-making path of the post-marketing research on effectiveness of Chinese patent medicines through six steps: determining research purpose, analyzing drug characteristics, evaluating research basis, proposing clinical orientation, clarifying research purpose, and implementing classified research. The general principles of research design and implementation were clarified from eight aspects: research type, research objects, sample size, efficacy indicators, bias, missing data, evidence level, and practicality. It focuses on the research on the TCM syndrome-based efficacy evaluation, clinical value-oriented mechanism of action, and the effectiveness of Chinese patent medicines with different routes of administration. The guidelines provide a universal methodological basis for the post-marketing research on clinical effectiveness of Chinese patent medicines.
Subject(s)
Drugs, Chinese Herbal , Nonprescription Drugs , Humans , Nonprescription Drugs/therapeutic use , Medicine, Chinese Traditional , Evidence-Based Medicine , Treatment Outcome , China , Drugs, Chinese Herbal/therapeutic useABSTRACT
With the premise of drug safety and effectiveness, pharmacoeconomic evaluation can provide optimal solutions for diversified decision-making application scenarios from different research perspectives while maximizing the rational utilization of existing healthcare resources. Chinese patent medicine is an essential component of pharmaceutical utilization in China and a significant part of healthcare expenditure in China. However, the economic evaluation of post-marketing Chinese patent medicine is lacking. These evaluations often lack standardization, exhibit varying quality, and are unable to effectively support healthcare decisions, indicating a need for improvement in overall quality. Given this situation, this project has gathered leading experts from China and has strictly adhered to the requirements of the group standards set by the China Association of Traditional Chinese Medicine in developing Guidelines for economic evaluation of post-marketing Chinese patent medicine, aiming to provide methodological guidance for the post-market pharmacoeconomic evaluation of Chinese patent medicine, enhancing the standardization of pharmacoeconomic evaluations of Chinese patent medicine and the scientific validity of research results, and thereby elevating the overall quality of pharmacoeconomic evaluations for post-marketing Chinese patent medicine. The guidelines adhere to the framework provided by relevant laws and regulations in China and technical guidance documents. It is based on guidance from traditional Chinese medicine(TCM) theories, focusing on the unique characteristics of TCM. It covers various aspects of pharmacoeconomic evaluation, including fundamental principles, research topic selection, research question definition, study design type selection, cost identification and measurement, health outcomes, and evaluation methods. The guidelines offer methodological recommendations and decision guidance to address common issues and challenges in the pharmacoeconomic evaluation of post-marketing Chinese patent medicine.
Subject(s)
Drugs, Chinese Herbal , Nonprescription Drugs , Product Surveillance, Postmarketing , Cost-Benefit Analysis , Medicine, Chinese Traditional , ChinaABSTRACT
This study systematically combed the randomized controlled trial(RCT) of Chinese patent medicines in treatment of type 2 diabetes mellitus(T2DM) in recent five years by using the method of evidence map. It understood the distribution and quality of evidence in this field and found the existing Chinese patent medicines in treatment of T2DM and the problems in its research. The study collected the commonly used Chinese patent medicines for the treatment of T2DM from three drug catalogs, retrieved Chinese and English databases to obtain RCT literature related to Chinese patent medicines in recent five years, and extracted information such as sample size, study drug, combination medication, course of treatment, and outcome indicators from the literature. It also conducted quality evaluation based on the Cochrane collaborative network bias risk assessment tool and used charts to display the analysis results. A total of 19 kinds of Chinese patent medicines are collected, of which 13 kinds of Chinese patent medicines are mentioned in 131 articles related to RCT. The literature concerning Shenqi Jiangtang Capsules/Granules, Jinlida Granules, and Xiaoke Pills accounts for a large proportion. Outcome indicators include blood glucose, blood lipids, pancreatic islet cell function, and clinical symptoms. In terms of literature quality, 75 articles have correct random methods, and 1 article performs allocation hiding and blind methods. Therefore, the clinical orientation of Chinese patent medicines for the treatment of T2DM is broad, failing to reflect their own characteristics and lacking safety information. Insufficient attention has been paid to TCM syndrome scores, quality of life, and blood lipid outcome indicators that reflect the characteristics of traditional Chinese medicine(TCM). The number of studies on the treatment of T2DM by Chinese patent medicines varies greatly among varieties, and the quality of the studies is low. It is suggested that the holders of the marketing license of T2DM Chinese patent medicines should carry out a post-marketing re-evaluation of the varieties of traditional Chinese patent medicines for treating T2DM according to the relevant requirements of the State Food and Drug Administration, standardize the clinical positioning, and revise and improve the safety information in the instructions. It is recommended that researchers construct a core indicator dataset for Chinese patent medicine treatment of T2DM, improve the efficacy evaluation system, and develop an experimental plan based on CONSORT before conducting RCT.