Microwave-assisted preparation of yellow fluorescent graphitic carbon nitride quantum dots for trace tetracycline-specific detection.

Tetracycline (TC) is extensively utilized in livestock breeding, aquaculture, and medical industry. TC residues seriously harm food security, the environment, and human health. There is an urgent need to exploit a highly efficient and sensitive testing method to monitor TC residue levels in aquatic environments. In this study, graphitic carbon nitride quantum dots (g-CNQDs) were successfully synthesized by a one-step microwave-assisted method using citric acid and urea as precursors. The as-prepared g-CNQDs with size of 1.25-3.75 nm exhibited bright yellow fluorescence at 523 nm when excited at 397 nm. Interestingly, this characteristic fluorescence emission of g-CNQDs could be selectively and efficiently quenched by TC. Based on this phenomenon, for TC detection was successfully explored and applied in real water samples. Wide linear scope of 7-100 µM, low detection limit (LOD) of 0.48 µM, satisfactory recovery of 97.77%-103.4%, and good relative standard deviation (RSD) of 1.05-5.87% were obtained. Mechanism investigations revealed that the static quenching and the inner filter effect (IFE) were responsible for this fluorescence quenching between g-CNQDs and TC. This work not only provided a facile approach for g-CNQDs synthesis but also constructed a g-CNQDs-based fluorescent sensor platform for the highly sensitive and selective detection of TC in aquatic environments.

Intestinal flora and pregnancy complications: Current insights and future prospects.

Numerous studies have demonstrated the pivotal roles of intestinal microbiota in many physiopathological processes through complex interactions with the host. As a unique period in a woman's lifespan, pregnancy is characterized by changes in hormones, immunity, and metabolism. The gut microbiota also changes during this period and plays a crucial role in maintaining a healthy pregnancy. Consequently, anomalies in the composition and function of the gut microbiota, namely, gut microbiota dysbiosis, can predispose individuals to various pregnancy complications, posing substantial risks to both maternal and neonatal health. However, there are still many controversies in this field, such as "sterile womb" versus "in utero colonization." Therefore, a thorough understanding of the roles and mechanisms of gut microbiota in pregnancy and its complications is essential to safeguard the health of both mother and child. This review provides a comprehensive overview of the changes in gut microbiota during pregnancy, its abnormalities in common pregnancy complications, and potential etiological implications. It also explores the potential of gut microbiota in diagnosing and treating pregnancy complications and examines the possibility of gut-derived bacteria residing in the uterus/placenta. Our aim is to expand knowledge in maternal and infant health from the gut microbiota perspective, aiding in developing new preventive and therapeutic strategies for pregnancy complications based on intestinal microecology.

Evaluation of different types of adjuvants in a malaria transmission-blocking vaccine.

Adjuvants are critical components for vaccines, which enhance the strength and longevity of the antibody response and influence the types of immune response. Limited research has been conducted on the immunogenicity and protective efficacy of various adjuvants in malaria transmission-blocking vaccines (TBVs). In this study, we formulated a promising TBV candidate antigen, the P. berghei ookinete surface antigen PSOP25, with different types of adjuvants, including the TLR4 agonist monophosphoryl lipid A (MPLA), the TLR9 agonist cytosine phosphoguanosine oligodeoxynucleotides (CpG ODN 1826) (CpG), a saponin adjuvant QS-21, aluminum hydroxide (Alum), and two combination adjuvants MPLA + QS-21 and QS-21 + CpG. We demonstrated that adjuvanted vaccines results in elevated elicited antibody levels, increased proliferation of plasma cells, and efficient formation of germinal centers (GCs), leading to enhanced long-term protective immune responses. Furthermore, CpG group exhibited the most potent inhibition of ookinete formation and transmission-blocking activity. We found that the rPSOP25 with CpG adjuvant was more effective than MPLA, QS-21, MPLA + QS-21, QS-21 + CpG adjuvants in dendritic cells (DCs) activation and differentiation. Additionally, the CpG adjuvant elicited more rubust immune memory response than Alum adjuvant. CpG and QS-21 adjuvants could activate the Th1 response and promote the secretion of IFN-γ and TNF-α. PSOP25 induced a higher number of Tfh cells in splenocytes when combined with MPLA, CpG, and QS-21 + CpG; and there was no increase in these cell populations when PSOP25 was administered with Alum. In conclusion, CpG may confer enhanced efficacy for the rPSOP25 vaccine, as evidenced by the ability of the elicited antisera to induce protective immune responses and improved transmission-blocking activity.

Ultra-trace Ag doped carbon quantum dots with peroxidase-like activity for the colorimetric detection of glucose.

Carbon quantum dots (CQDs) have significant applications in nanozymes. However, previous studies have not elucidated the structure-activity relationship and enzyme mechanism. In this study, we employed a one-step microwave method to synthesize ultra-trace Ag-doped carbon quantum dots (Ag-CQDs). In the presence of hydrogen peroxide (H2O2), we used the oxidative coupling reaction of 3,3',5,5'-tetramethylbenzidine (TMB) to evaluate the intrinsic peroxidase-like activity, kinetics, and mechanism of Ag-CQDs. The trace amount of doped Ag (1.64 %) facilitated electron transfer from the CQDs interior to the surface. The electron transfer triggered the peroxide activity of CQDs, producing hydroxyl radical (·OH), which oxidized the colorless TMB to blue-colored TMB (oxTMB). By coupling with glucose oxidase (GOx), the Ag-CQDs/H2O2/TMB system has been used for colorimetric glucose determination. The system demonstrated a low detection limit (0.17 µM), wide linear range (0.5-5.5 µM), and satisfactory results when fruit juice was analyzed. This study reports a feasible method for the colorimetric detection of glucose by synthesizing ultra-trace Ag-doped carbon quantum dots with peroxidase-mimicking activity.

Maternal immune activation mediated prenatal chronic stress induces Th17/Treg cell imbalance may relate to the PI3K/Akt/NF-κB signaling pathway in offspring rats.

Maternal immune activation (MIA), defined as elevated levels of inflammatory markers beyond the normal range, can occur due to psychological stress, infection, and other disruptions during pregnancy. MIA affects the immune system development in offspring and increases the risk of immune-related disorders. Limited studies have investigated the effects of prenatal stress on offspring's immune system. In this study, pregnant rats were exposed to chronic unpredictable mild stress (CUMS) during pregnancy, involving seven different stressors. We examined the impact of prenatal stress stimuli on the offspring's immune system and observed activation of the PI3K/Akt/NF-κB signaling pathway, resulting in an imbalance of Th17/Treg cells in the offspring's spleen. Our findings revealed increased plasma levels of corticosterone, IL-1ß, and IL-6 in female rats exposed to prenatal stress, as well as elevated serum levels of IL-6 and TNF-α in the offspring. Furthermore, we identified a correlation between cytokine levels in female rats and their offspring. Transcriptome sequencing and qPCR experiments indicated differentially expressed mRNAs in offspring exposed to prenatal stress, which may contribute to the imbalance of Th17/Treg cells through the activation of the Gng3-related PI3K/Akt/NF-κB pathway.

A nanoparticle vaccine displaying the ookinete PSOP25 antigen elicits transmission-blocking antibody response against Plasmodium berghei.

BACKGROUND: Safe and effective vaccines are crucial for the control and eventual elimination of malaria. Novel approaches to optimize and improve vaccine efficacy are urgently required. Nanoparticle-based delivery platforms are considered potent and powerful tools for vaccine development. METHODS: In this study, we developed a transmission-blocking vaccine against malaria by conjugating the ookinete surface antigen PSOP25 to the Acinetobacter phage coat protein AP205, forming virus-like particles (VLPs) using the SpyTag/SpyCatcher adaptor system. The combination of AP205-2*SpyTag with PSOP25-SpyCatcher resulted in the formation of AP205-PSOP25 complexes (VLP-PSOP25). The antibody titers and avidity of serum from each immunization group were assessed by ELISA. Western blot and IFA were performed to confirm the specific reactivity of the elicit antisera to the native PSOP25 in Plasmodium berghei ookinetes. Both in vitro and in vivo assays were conducted to evaluate the transmission-blocking activity of VLP-PSOP25 vaccine. RESULTS: Immunization of mice with VLP-PSOP25 could induced higher levels of high-affinity antibodies than the recombinant PSOP25 (rPSOP25) alone or mixtures of untagged AP205 and rPSOP25 but was comparable to rPSOP25 formulated with alum. Additionally, the VLP-PSOP25 vaccine enhanced Th1-type immune response with remarkably increased levels of IgG2a subclass. The antiserum generated by VLP-PSOP25 specifically recognizes the native PSOP25 antigen in P. berghei ookinetes. Importantly, antisera generated by inoculation with the VLP-PSOP25 could inhibit ookinete development in vitro and reduce the prevalence of infected mosquitoes or oocyst intensity in direct mosquito feeding assays. CONCLUSIONS: Antisera elicited by immunization with the VLP-PSOP25 vaccine confer moderate transmission-reducing activity and transmission-blocking activity. Our results support the utilization of the AP205-SpyTag/SpyCatcher platform for next-generation TBVs development.

A colorimetric and fluorometric dual-mode probe for Cu2+detection based on functionalized silver nanoparticles.

A novel colorimetric/fluorescent probe (AgNPs-GSH-Rh6G2) was prepared by linking silver nanoparticles (AgNPs) with rhodamine 6G derivative (Rh6G2) using glutathione (GSH) as a linker molecule. The prepared probe showed obvious fluorescence change and colorimetric response after adding copper ions. Based on this phenomenon, a colorimetric/fluorescence dual-mode detection method was constructed to recognize copper ions. The linear ranges of fluorescence detection and colorimetric detection were 0.10 to 0.45 mM and 0.15 to 0.65 mM, respectively, and the limit of detection were 0.18 µM and 24.90 µΜ. In addition, the dual-mode probe has achieved satisfactory results in the detection of copper ions in sediment samples. The successful construction of AgNPs-GSH-Rh6G2 not only provide a reliable tool for the detection of copper ions, but also shed light on a new idea for the multi-mode development of the detection platform.

Highly photoluminescent tryptophan-coated copper nanoclusters based turn-off fluorescent probe for determination of tetracyclines.

Employing cheap Cu nanoclusters to design a novel fluorescent probe have promising opportunities in the field of optical sensors. Here, we fabricated a highly photoluminescent D-tryptophan (D-Trp)-coated Cu nanoclusters (Trp-Cu NCs) by rapid microwave-assisted method to achieve precise quantification of tetracyclines (TC). Due to protecting groups of Trp, the synthesized Trp-Cu NCs have remarkable fluorescence stability with a quantum yield reached 12.5%. A distinct fluorescence quenching with the incremental addition of TC via the internal filtration effect (IFE). Based on turn-off fluorescence within 1 min, a detection method for detecting TC was constructed with a linear range of 0.3-120 µM and a limit of detection (LOD) of 0.12 µM. Besides, the proposed fluorescent probe has been employed for the determination of practical samples such as water samples, milk and honey, and exhibited satisfactory recoveries of 96.1%-108.2%, with relative standard deviations (RSD) lower than 5.0%. This is a sensitive, rapid and easily recognizable Trp-Cu NCs based sensing platform for the determination of TC, which could offer a powerful tool for ensuring food safety.

In situ microwave-assisted preparation of NS-codoped carbon dots stabilized silver nanoparticles as an off-on fluorescent probe for trace Hg2+ detection.

An off-on fluorescent probe (NS-CDs-AgNPs) was synthesized based on a one-pot microwave process by utilizing N, S co-doping carbon dots (NS-CDs) and silver nitrate as precursors. The significant peak of NS-CDs-AgNPs at 393 nm in ultraviolet spectrum indicated silver nanoparticle (AgNPs) were successfully synthesized. A faint blue fluorescence emission (442 nm) was displayed when excited NS-CDs-AgNPs at 371 nm. A remarkable fluorescence recovery was observed upon adding of trance Hg2+, whereas the other heavy metal ions did not elicit this response. The reason for this phenomenon was revealed in this work that a spontaneous redox reaction occurred between NS-CDs-AgNPs and Hg2+, which leaded to the formation of NS-CDs-Agn-2NPsHg complexes. On the basis of this mechanism, a new off-on fluorescent analytical method was constructed for Hg2+ detection with linear range of 10-400 nM (R2 = 0.9941), and the detection limit (LOD) of 5.16 nM. Additionally, satisfactory recovery (90.28%-106.13%) and the relative standard deviation (RSD) (RSD＜5.21%) were obtained in water sample detection. More importantly, the NS-CDs-AgNPs exhibited lower cytotoxicity and better biocompatibility, indicating a huge potential in cell imaging and clinical medicine.

The effects of chronic unpredicted mild stress on maternal negative emotions and gut microbiota and metabolites in pregnant rats.

Background: Chronic long-term stress is associated with a range of disorders, including depression and a variety of other chronic illnesses. It is well known that maternal exposure to psychosocial stress during pregnancy significantly increases the likelihood of adverse pregnancy outcomes. The gut microbiota has been a popular topic, it is a key mediator of the gut-brain axis and plays an important role in human health; changes in the gut microbiota have been related to chronic stress-induced health impairment, however, the relationship between maternal negative emotions and abnormal gut microbiota and its metabolites during maternal exposure to chronic stress during pregnancy remains unclear. Methods: Pregnant rats were subjected to chronic unpredicted mild stress (CUMS) to establish the rat model of chronic stress during pregnancy. The behavioral changes were recorded using sucrose preference test (SPT) and open-field test (OFT), plasma corticosterone levels were determined by radioimmunoassay, and a comprehensive method combining 16S rRNA gene sequencing and gas chromatography-mass spectrometry (GC-MS) metabolomics was used to study the effects of stress during pregnancy on the function of intestinal microbiota and its metabolites. Results: Chronic stress during pregnancy not only increased maternal plasma corticosterone (P < 0.05), but also caused maternal depression-like behaviors (P < 0.05). Chronic stress during pregnancy changed the species composition at the family level of maternal gut microbiota, the species abundance of Ruminococcaceae in the stress group (23.45%) was lower than the control group (32.67%) and the species abundance of Prevotellaceae in the stress group (10.45%) was higher than the control group (0.03%) (P < 0.05). Vertical locomotion and 1% sucrose preference percentage in pregnant rats were negatively correlated with Prevotellaceae (r =  - 0.90, P < 0.05). Principal component analysis with partial least squares discriminant analysis showed that the integration points of metabolic components in the stress and control groups were completely separated, indicating that there were significant differences in the metabolic patterns of the two groups, and there were seven endogenous metabolites that differed (P < 0.05). Conclusions: The negative emotional behaviors that occur in pregnant rats as a result of prenatal chronic stress may be associated with alterations in the gut microbiota and its metabolites. These findings provide a basis for future targeted metabolomics and gut flora studies on the effects of chronic stress during pregnancy on gut flora.

Gut microbiome dysbiosis contributes to abdominal aortic aneurysm by promoting neutrophil extracellular trap formation.

Abdominal aortic aneurysm (AAA) is an insidious and lethal vascular disease that lacks effective nonsurgical interventions. Gut microbiota dysbiosis plays key roles in many diseases, but its relationship with AAA has not been fully elucidated. Herein, we reveal significant abnormalities in the gut microbe composition of AAA patients and confirm that gut microbiota dysbiosis is an important cause of AAA. Specifically, R. intestinalis was significantly reduced in AAA patients. Using AAA mice, we show that R. intestinalis and its metabolite butyrate significantly reduce neutrophil infiltration and NOX2-dependent neutrophil extracellular trap formation, inflammation, and abnormal phenotypic switching of vascular smooth muscle cells in the aortic wall, thereby markedly alleviating AAA development. Our research uncovers the role and mechanism of the gut microbiota in AAA development and provides insights into AAA prophylaxis from a microecological perspective.

An integrated multi-omics analysis of topoisomerase family in pan-cancer: Friend or foe?

BACKGROUND: Topoisomerases are nuclear enzymes that get to the bottom of topological troubles related with DNA all through a range of genetic procedures. More and more studies have shown that topoisomerase-mediated DNA cleavage plays crucial roles in tumor cell death and carcinogenesis. There is however still a lack of comprehensive multi-omics studies related to topoisomerase family genes from a pan-cancer perspective. METHODS: In this study, a multiomics pan-cancer analysis of topoisomerase family genes was conducted by integrating over 10,000 multi-dimensional cancer genomic data across 33 cancer types from The Cancer Genome Atlas (TCGA), 481 small molecule drug response data from cancer therapeutics response portal (CTRP) as well as normal tissue data from Genotype-Tissue Expression (GTEx). Finally, overall activity-level analyses of topoisomerase in pan-cancers were performed by gene set variation analysis (GSVA), together with differential expression, clinical relevancy, immune cell infiltration and regulation of cancer-related pathways. RESULTS: Dysregulated gene expression of topoisomerase family were related to genomic changes and abnormal epigenetic modifications. The expression levels of topoisomerase family genes could significantly impact cancer progression, intratumoral heterogeneity, alterations in the immunological condition and regulation of the cancer marker-related pathways, which in turn caused the differences in potential drugs sensitivity and the distinct prognosis of patients. CONCLUSION: It was anticipated that topoisomerase family genes would become novel prognostic biomarkers for cancer patients and provide new insights for the diagnosis and treatment of tumors.

Targeted next generation sequencing revealed a novel deletion-frameshift mutation of KCNH2 gene in a Chinese Han family with long QT syndrome: A case report and review of Chinese cases.

INTRODUCTION: Long QT syndrome (LQTS) is electrocardiographically characterized by a prolonged QT interval and manifests predisposition to life-threatening arrhythmia which often leads to sudden cardiac death. Type 2 LQTS (LQT2) is the second most common subtype of LQTS and caused by mutations in KCNH2 gene. Up to date, >900 mutations have been reported to be related to LQT2. However, mutational screening of the KCNH2 gene is still far from completeness. Identification of KCNH2 mutations is particularly important in diagnosis of LQT2 and will gain more insights into the molecular basis for the pathogenesis of LQT2. PATIENT CONCERNS: A Chinese Han family with LQTS phenotypes was examined. DIAGNOSIS: A novel deletion-frameshift mutation, c.381_408delCAATTTCGAGGTGGTGATGGAGAAGGAC, in exon 3 of KCNH2 gene was identified in a Chinese family with LQTS. On the basis of this finding and clinical manifestations, the final diagnosis of LQT2 was made. INTERVENTIONS: Next-generation sequencing (NGS) of DNA samples was performed to detect the mutation in the LQTS-related genes on the proband and her mother, which was confirmed by Sanger sequencing. The proband was then implanted with an implantable cardioverter defibrillator and prescribed metoprolol 47.5 mg per day. OUTCOMES: This novel heterozygous mutation results in a frameshift mutation after the 128 residue (Asparagine), which replaced the original 1031 amino acids with 27 novel amino acids (p.N128fsX156). CONCLUSION: This novel mutation presumably resulted in a frameshift mutation, p.N128fsX156. Our data expanded the mutation spectrum of KCNH2 gene and facilitated clinic diagnosis and genetic counseling for this family with LQTS.

Identification of a novel mutation of FGFR3 gene in a large Chinese pedigree with hypochondroplasia by next-generation sequencing: A case report and brief literature review.

RATIONALE: Hypochondroplasia (HCH) is the mildest form of chondrodysplasia characterized by disproportionate short stature, short extremities, and variable lumbar lordosis. It is caused by mutations in fibroblast growth factor receptor 3 (FGFR3) gene. Up to date, at least thirty mutations of FGFR3 gene have been found to be related to HCH. However, mutational screening of the FGFR3 gene is still far from completeness. Identification of more mutations is particularly important in diagnosis of HCH and will gain more insights into the molecular basis for the pathogenesis of HCH. PATIENT CONCERNS: A large Chinese family consisting of 53 affected individuals with HCH phenotypes was examined. DIAGNOSES: A novel missense mutation, c.1052C>T, in FGFR3 gene was identified in a large Chinese family with HCH. On the basis of this finding and clinical manifestations, the final diagnosis of HCH was made. INTERVENTIONS: Next-generation sequencing (NGS) of DNA samples was performed to detect the mutation in the chondrodysplasia-related genes on the proband and her parents, which was confirmed by Sanger sequencing in the proband and most of other living affected family members. OUTCOMES: A novel missense mutation, c.1052C>T, in the extracellular, ligand-binding domain of FGFR3 was identified in a large Chinese family with HCH. This heterozygous mutation results in substitution of serine for phenylalanine at amino acid 351 (p.S351F) and co-segregates with the phenotype in this family. Molecular docking analysis reveals that this unique FGFR3 mutation results in an enhancement of ligand-binding affinity between FGFR3 and its main ligand, fibroblast growth factor 9. LESSONS: This novel mutation is the first mutation displaying an increase in ligand-binding affinity, therefore it may serve as a model to investigate ligand-dependent activity of FGF-FGFR complex. Our data also expanded the mutation spectrum of FGFR3 gene and facilitated clinic diagnosis and genetic counseling for this family with HCH.