Positron emission computed tomography/single photon emission computed tomography in Parkinson disease.

Parkinson disease (PD) is the second-most common neurodegenerative disorder. Its main pathological mechanism is the selective degeneration and deletion of dopaminergic neurons in the dense part of the substantia nigra and the damage of dopaminergic neurons caused by the abnormal deposition of a Lewy body, leading to a decreased dopamine level. Positron emission computed tomography (PET)/single photon emission computed tomography (SPECT) is a molecular imaging technology that can directly or indirectly reflect changes in molecular levels by using a specific tracer. With the research and development on the tracers of related enzymes for labeling dopamine transporter and dopamine receptor and for being involved in dopamine formation, this imaging technology has been applied to all aspects of PD research. It not only contributes to clinical work but also provides an important theoretical basis for exploring the pathological mechanism of PD at a molecular level. Therefore, this review discusses the application value of PET/SPECT in PD in terms of early diagnosis, disease severity evaluation, clinical manifestations, differential diagnosis, and pathological mechanism.

A novel 55-basepair deletion of hydroxymethylbilane synthase gene found in a Chinese patient with acute intermittent porphyria and her family: A case report.

RATIONALE: Acute intermittent porphyria (AIP) is caused by hydroxymethylbilane synthase (HMBS) gene mutation. PATIENT CONCERNS: A Chinese female patient with very typical AIP symptoms of severe abdominal pain, seizures, hypertension, and tachycardia, accompanied with hyponatremia, anemia, and hyperbilirubinemia. DIAGNOSES: She was diagnosed as AIP based on positive result of urine porphobilinogen and her clinical syndrome. INTERVENTIONS: The proband was treated with intravenous glucose (at least 250 g per day) for 4 days. HMBS mutation was investigated in this family by Sanger sequencing. OUTCOMES: A heterozygous mutation of the HMBS gene was identified in the proband and 7 other family members. Genetic sequencing showed a deletion of 55 basepairs (C.1078_1132delGCCCATTAACTGGTTTGTGGGGCACAGATGCCTGGGTTGCTGCTGTCCAGTGCCT) including the stop codon position, leading to frameshift mutation. The mutation has not been documented in current gene databases. Further prediction of mutated protein structure suggests that the mutation is likely to produce prolonged peptide with structural change and less stability. LESSONS: Physicians should pay attention to AIP attack in patients with suspected symptoms and make use of genetic testing to increase identification of mutated HMBS gene carriers for further preventive strategy.