Defense signaling pathways in resistance to plant viruses: Crosstalk and finger pointing.

Resistance to infection by plant viruses involves proteins encoded by plant resistance (R) genes, viz., nucleotide-binding leucine-rich repeats (NLRs), immune receptors. These sensor NLRs are activated either directly or indirectly by viral protein effectors, in effector-triggered immunity, leading to induction of defense signaling pathways, resulting in the synthesis of numerous downstream plant effector molecules that inhibit different stages of the infection cycle, as well as the induction of cell death responses mediated by helper NLRs. Early events in this process involve recognition of the activation of the R gene response by various chaperones and the transport of these complexes to the sites of subsequent events. These events include activation of several kinase cascade pathways, and the syntheses of two master transcriptional regulators, EDS1 and NPR1, as well as the phytohormones salicylic acid, jasmonic acid, and ethylene. The phytohormones, which transit from a primed, resting states to active states, regulate the remainder of the defense signaling pathways, both directly and by crosstalk with each other. This regulation results in the turnover of various suppressors of downstream events and the synthesis of various transcription factors that cooperate and/or compete to induce or suppress transcription of either other regulatory proteins, or plant effector molecules. This network of interactions results in the production of defense effectors acting alone or together with cell death in the infected region, with or without the further activation of non-specific, long-distance resistance. Here, we review the current state of knowledge regarding these processes and the components of the local responses, their interactions, regulation, and crosstalk.

Outbreak of Rice Panicle Blast in Jeonbuk Province of Korea in 2021.

Rice panicle blast is one of the most serious diseases threatening stable rice production by causing severe damage to rice yields and quality. The disease is easy to occur under low air temperature and frequent heavy rainfall during the heading season of rice. In 2021, a rice panicle blast severely occurred in the Jeonbuk province of Korea. The incidence area of panicle blast accounted for 27.7% of the rice cultivation area of Jeonbuk province in 2021, which was 13.7-times higher than in 2019 and 2.6-times higher than in 2020. This study evaluated the incidence areas of rice panicle blast in each region of Jeonbuk province in 2021. The weather conditions during the heading season of rice, mainly cultivated rice cultivars, and the race diversity of the Jeonbuk isolates were also investigated. It will provide important information for the effective control of the rice panicle blast.

Inhibitory Effects of Pepper Mild Mottle Virus Infection by Supernatants of Five Bacterial Cultures in Capsicum annuum L.

Pepper mild mottle virus (PMMoV), one of the most prevalent viruses in chili pepper (Capsicum annuum L.) is a non-enveloped, rod-shaped, single-stranded positive-sense RNA virus classified in the genus Tobamovirus. The supernatants of five bacterial cultures (Pseudomonas putida [PP], Bacillus licheniformis [BLI], P. fluorescens [PF], Serratia marcescens [SER], and B. amyloliquifaciens [BA]) were analyzed to find novel antiviral agents to PMMoV in chili pepper. Foliar spraying with supernatants (1:1, v/v) obtained from Luria-Bertani broth cultures of PP, BLI, PF, SER, and BA inhibited PMMoV infection of chili pepper if applied before the PMMoV inoculation. Double-antibody sandwich enzyme-linked immunosorbent assay showed that treatments of five supernatants resulted in 51-66% reductions in PMMoV accumulation in the treated chili pepper. To identify key compounds in supernatants of PP, BLI, PF, SER, and BA, the supernatants were subjected to gas chromatography-mass spectrometry. The 24 different types of compounds were identified from the supernatants of PP, BLI, PF, SER, and BA. The compounds vary from supernatants of one bacterial culture to another which includes simple compounds-alkanes, ketones, alcohols, and an aromatic ring containing compounds. The compounds triggered the inhibitory effect on PMMoV propagation in chili pepper plants. In conclusion, the cultures could be used to further conduct tissue culture and field trial experiments as potential bio-control agents.

Application of Rapid and Reliable Detection of Cymbidium Mosaic Virus by Reverse Transcription Recombinase Polymerase Amplification Combined with Lateral Flow Immunoassay.

Cymbidium mosaic virus (CymMV) is one of economically important viruses that cause significant losses of orchids in the world. In the present study, a reverse transcription recombinase polymerase amplification (RT-RPA) assay combined with a lateral flow immunostrip (LFI) assay was developed for the detection of CymMV in orchid plants. A pair of primers containing fluorescent probes at each terminus that amplifies highly specifically a part of the coat protein gene of CymMV was determined for RT-RPA assay. The RT-RPA assay involved incubation at an isothermal temperature (39°C) and could be performed rapidly within 30 min. In addition, no cross-reactivity was observed to occur with odontoglossum ringspot virus and cymbidium chlorotic mosaic virus. The RT-RPA with LFI assay (RT-RPA-LFI) for CymMV showed 100 times more sensitivity than conventional reverse transcription polymerase chain reaction (RT-PCR). Furthermore, the RT-PCR-LFI assay demonstrated the simplicity and the rapidity of CymMV detection since the assay did not require any equipment, by comparing results with those of conventional RT-PCR. On-site application of the RT-RPA-LFI assay was validated for the detection of CymMV in field-collected orchids, indicating a simple, rapid, sensitive, and reliable method for detecting CymMV in orchids.

The Secret Life of the Inhibitor of Virus Replication.

The inhibitor of virus replication (IVR) is an inducible protein that is not virus-target-specific and can be induced by several viruses. The GenBank was interrogated for sequences closely related to the tobacco IVR. Various RNA fragments from tobacco, tomato, and potato and their genomic DNA contained IVR-like sequences. However, IVRs were part of larger proteins encoded by these genomic DNA sequences, which were identified in Arabidopsis as being related to the cyclosome protein designated anaphase-promoting complex 7 (APC7). Sequence analysis of the putative APC7s of nine plant species showed proteins of 558-561 amino acids highly conserved in sequence containing at least six protein-binding elements of 34 amino acids called tetratricopeptide repeats (TPRs), which form helix-turn-helix structures. The structures of Arabidopsis APC7 and the tobacco IVR proteins were modeled using the AlphaFold program and superimposed, showing that IVR had the same structure as the C-terminal 34% of APC7, indicating that IVR was a product of the APC7 gene. Based on the presence of various transcription factor binding sites in the APC7 sequences upstream of the IVR coding sequences, we propose that IVR could be expressed by these APC7 gene sequences involving the transcription factor SHE1.

First report of perilla mosaic emaravirus infecting Perilla frutescens in South Korea.

Perilla mosaic virus (PerMV; the genus Emaravirus in the family Fimoviridae) has a multiple, negative-sense, single-stranded RNA genome (ICTV, 2018). PerMV has been reported in Japan, where it was transmitted by an eriophyid mite species (Acari: Eriophyidae) to Perilla frutescens (L.) Britton var. crispa (Kubota et al., 2020). In September 2021, typical symptoms of the virus including yellow flecks, mosaic symptoms, and malformation were observed in leaves of P. frutescens in a cultivated field in Iseo-myeon, Wanju, South Korea (Suppl. Fig. 1). Visual estimates indicated that symptom incidence reached 70%, and the top leaves of perilla plants exhibited more severe symptoms and leaf distortion. To identify the virus species accurately, total RNA was extracted from five symptomatic perilla leaves collected using the RNeasy Plant Mini Kit (Qiagen, Hilden, Germany) then cDNAs were amplified by reverse-transcription polymerase chain reaction (RT-PCR) using two pairs of primers to PerMV specific primer set designed to amplify 412- and 491-bp cDNAs of the nucleocapsid protein gene RNA 3 and movement protein gene RNA 4, respectively (Suppl. Table). Single-infection of PerMV in symptomatic Korean perilla plants was confirmed by high-throughput sequence (HTS) analysis and de novo transcriptome assembly using the Illumina HiSeq 4000 platform (Macrogen Inc., Seoul, Korea). The assembled sequences were aligned with viral reference genomes through searches performed using the BLASTn tool. Seven contigs (597-7,213 bp) revealed 92.09-97.37% nucleotide homology with RNAs of the isolate PerMV_Kochi_Nankoku_2011 (accession numbers LC496090 to LC496099) in the GenBank database. Other viruses including turnip mosaic virus and cucumber green mottle mosaic virus were not identified by HTS analysis (Cho et al., 2021; Park et al., 2020; Song et al., 2022). Seven RNA genomes of PerMV were confirmed by RT-PCR using specific primer sets designed to amplify part of each genome (Suppl. Table 1 and Fig. 2). The complete nucleotide sequences of PerMV (named IS isolate) RNA 1-7 were determined to be 7,177, 2,089, 1,094, 1,302, 1,079, 1,098, and 995 bp in length, respectively; these were deposited in GenBank (LC721296-LC721303). Sap from a symptomatic leaf sample confirmed for single infection was inoculated mechanically onto the leaves of 10 healthy P. frutescens seedlings, which developed the same PerMV symptoms within 3 weeks. These results indicate that PerMV is the causal agent of viral disease in Korean perilla plants cultivated in South Korea. To our knowledge, this is the first report of a perilla mosaic emaravirus infecting to Korean perilla, P. frutescens in South Korea.

First report of pepino mosaic virus infecting tomato in South Korea.

Pepino mosaic virus (PepMV), a member of the genus Potexvirus in the family Alphaflexiviridae, has been responsible for economic losses in tomato across Africa, Asia, Europe, and the Americas over the last two decades, but has not previously been reported in South Korea. In December 2020, virus-like symptoms (foliar interveinal chlorosis and unevenly discolored fruits) were observed on ~5% of tomato (Solanum lycopersicum) plants growing in a greenhouse in Jeolla province, South Korea. To identify the causal virus, total RNA from a leaf sample of the symptomatic tomato was extracted using an RNeasy Plant Mini Kit (Qiagen, Germany) and analyzed by high-throughput sequencing. Ribosomal RNA was removed and a cDNA library was prepared using an Illumina TruSeq Stranded Total RNA LT Sample Prep Kit (Plants) and sequenced on an Illumina NovaSeq 6000 system (Macrogen, Korea), yielding 151 nt paired end reads. De novo assembly of the 74,417,192 reads was performed using Trinity software (r20140717) while the 308,940 initially assembled contigs were screened against the NCBI viral genome database using BLASTN. Two contigs of 6,419 and 6,391 bp (GenBank LC656469, JKT1; and LC656470, JKT2) shared 94.81% and 98.34% nucleotide (nt) identities with isolates of the CH2 group (MK133092 and MF422613) and US1 group (FJ940225), respectively. No contigs representing other plant viruses were identified. A phylogenetic tree of the genomes of 44 isolates encompassing different PepMV strains (Abrahamian et al., 2020) also placed JKT1 in the CH2 clade, and JKT2 in the US1 clade. Leaf samples from 24 randomly selected plants from the same greenhouse were tested by reverse transcription-polymerase chain reaction (RT-PCR) with PepMV-specific primers, Pep3/Pep4 and PepCP-D/PepCP-R (Souiri et al., 2019), yielding products of the expected sizes (625 bp for Pep3/Pep4 and 848 bp for PepCP-D/PepCP-R) from all samples. Amplicons were cloned into the pGEM-T Easy Vector (Promega, USA); two clones for each amplicon were bidirectionally sequenced (BIONEER, Korea) and deposited in GenBank. The 848 bp amplicon (accession no. LC637517) showed 99.65% nt identity to the JKT1 genome (LC656469) and 94.69% identity to a CH2 isolate (JN835466); the 625 bp amplicon (LC637518) had 99.36% nt identity to the JKT2 genome (LC656470) and 97.28% identity to a US1 isolate (FJ940225). Primers specific to the coat protein gene of each isolate (JKT1-F/JKT1-R, CGCTTGCTGGTGCTGTTCAAG/ACGTCTAGACAAAGCAGGGTT, 934 bp; JKT2-F/JKT2-R, CACTAAATGCAGCAGTTTCTG/AGTTTCATTAGCAGCCAGTC, 830 bp) also yielded the expected amplicons from all 24 samples, indicating mixed infections of PepMV strains CH2 and US1. The PCR products from three randomly-selected samples shared 79.93-80.17% nt identity between (JKT1/JKT2) two JKT1-derived sequences (LC683791 and LC683792) and two JKT2-derived sequences (LC683793 and LC683794), further supporting the presence of mixed infections in the samples. To our knowledge, this is the first report of PepMV infecting tomato in South Korea. The virus is carried on tomato seeds (Córdoba-Sellés et al., 2007; Hanssen et al., 2010), and efficiently transmitted by mechanical means leading to rapid spread in tomato crops, and the severe strain CH2 may be a serious threat to tomato production in South Korea. It is important to concentrate on the phytosanitary control for both importation and exportation to manage and prevent further spread of contaminated seeds or infected transplants.

The Virus-Induced Transcription Factor SHE1 Interacts with and Regulates Expression of the Inhibitor of Virus Replication (IVR) in N Gene Tobacco.

The transcription factor SHE1 was induced by tobacco mosaic virus (TMV) infection in tobacco cv. Samsun NN (SNN) and SHE1 inhibited TMV accumulation when expressed constitutively. To better understand the role of SHE1 in virus infection, transgenic SNN tobacco plants generated to over-express SHE1 (OEx-SHE1) or silence expression of SHE1 (si-SHE1) were infected with TMV. OEx-SHE1 affected the local lesion resistance response to TMV, whereas si-SHE1 did not. However, si-SHE1 allowed a slow systemic infection to occur in SNN tobacco. An inhibitor of virus replication (IVR) was known to reduce the accumulation of TMV in SNN tobacco. Analysis of SHE1 and IVR mRNA levels in OEx-SHE1 plants showed constitutive expression of both mRNAs, whereas both mRNAs were less expressed in si-SHE1 plants, even after TMV infection, indicating that SHE1 and IVR were associated with a common signaling pathway. SHE1 and IVR interacted with each other in four different assay systems. The yeast two-hybrid assay also delimited sequences required for the interaction of these two proteins to the SHE1 central 58-79% region and the IVR C-terminal 50% of the protein sequences. This suggests that SHE is a transcription factor involved in the induction of IVR and that IVR binds to SHE1 to regulate its own synthesis.

Inhibitory Effect of Chitosan and Phosphate Cross-linked Chitosan against Cucumber Mosaic Virus and Pepper Mild Mottle Virus.

Cucumber mosaic virus (CMV) and Pepper mild mottle virus (PMMoV) causes severe economic loss in crop productivity of both agriculture and horticulture crops in Korea. The previous surveys showed that naturally available biopolymer material - chitosan (CS), which is from shrimp cells, reduced CMV accumulation on pepper. To improve the antiviral activity of CS, it was synthesized to form phosphate cross-linked chitosan (PCS) and compared with the original CS. Initially, the activity of CS and PCS (0.01%, 0.05%, and 0.1% concentration) compound against PMMoV infection and replication was tested using a half-leaf assay on Nicotiana glutinosa leaves. The total number of local lesions represented on a leaf of N. glutinosa were counted and analyzed with phosphate buffer treated leaves as a negative control. The leaves treated with a 0.1% concentration of CS or PCS compounds exhibited an inhibition effect by 40-75% compared with the control leaves. The same treatment significantly reduced about 40% CMV accumulation measured by double antibody sandwich enzyme-linked immunosorbent assay and increased the relative expression levels of the NPR1, PR-1, cysteine protease inhibitor gene, LOX, PAL, SRC2, CRF3 and ERF4 genes analyzed by quantitative reverse transcriptase-polymerase chain reaction, in chili pepper plants.

Cucumber Mosaic Virus 1a Protein Interacts with the Tobacco SHE1 Transcription Factor and Partitions between the Nucleus and the Tonoplast Membrane.

The transcription factor SHE1 was identified as an interacting partner with the cucumber mosaic virus (CMV) 1a protein in the yeast two-hybrid system, by a pull-down assay, and via bimolecular fluorescent complementation. Using fluorescent-tagged proteins and confocal microscopy, the CMV 1a protein itself was found distributed predominantly between the nucleus and the tonoplast membrane, although it was also found in speckles in the cytoplasm. The SHE1 protein was localized in the nucleus, but in the presence of the CMV 1a protein was partitioned between the nucleus and the tonoplast membrane. SHE1 expression was induced by infection of tobacco with four tested viruses: CMV, tobacco mosaic virus, potato virus X and potato virus Y. Transgenic tobacco expressing the CMV 1a protein showed constitutive expression of SHE1, indicating that the CMV 1a protein may be responsible for its induction. However, previously, such plants also were shown to have less resistance to local and systemic movement of tobacco mosaic virus (TMV) expressing the green fluorescent protein, suggesting that the CMV 1a protein may act to prevent the function of the SHE1 protein. SHE1 is a member of the AP2/ERF class of transcription factors and is conserved in sequence in several Nicotiana species, although two clades of SHE1 could be discerned, including both different Nicotiana species and cultivars of tobacco, varying by the presence of particular insertions or deletions.

First report of Cucurbit chlorotic yellows virus infecting Cucumis melo (muskmelon and oriental melon) in Korea.

In December 2018, virus-like symptoms (yellowing, vein clearing) were observed on 2% of muskmelon (Cucumis melo L.) plants in plastic houses on a farm in Gyeongsang province, Korea Total RNA from two symptomatic and two asymptomatic plants was extracted using RNeasy Plant Mini Kit (Qiagen, Germany) for high throughput sequencing (HTS). After pre-processing and Ribo-Zero rRNA removal, a cDNA library was prepared (Illumina TruSeq Stranded Total RNA kit) and sequenced (Illumina NovaSeq 6000 system: Macrogen Inc. Korea). De novo assembly of 88,222,684 HTS reads with Trinity software (r20140717) yielded 146,269 contigs of 201-28,442 bp, which were screened against the NCBI viral genome database by BLASTn. Contigs from cucumber mosaic virus (CMV), melon necrotic spot virus (MNSV), tobacco mosaic virus (TMV) and watermelon mosaic virus (WMV) were identified, all previously reported in Korea. Two contigs (8,539 and 8,040 bp) with 99.9% sequence identity to distinct cucurbit chlorotic yellows virus (CCYV) isolates (JN641883, RNA1, Taiwan; MH819191, RNA2, China) were also identified. The ten sequences most closely related to each RNA of the Korean isolate (≥99% coverage, ≥99.6% nt identity) were from Japan, China, Taiwan, or Israel. CCYV presence was confirmed by reverse transcription-PCR (RT-PCR) using newly designed specific primers, RdRp-F/RdRp-R (5'-ACCGAACACTTGGCTATCCAA-3'/5'-CTTAATGCCGCGTATGAACTCA-3') span style="font-family:'Times New Roman'; letter-spacing:-0.5pt">and HSP-F/HSP-R (5'-TGAACGACACTGAGTTCATTCCTA-3'/5'-CGCCAAGATCGTACATGAGGAA-3'), against RNA dependent RNA polymerase (RdRp; RNA1) and the heat shock protein 70 homolog (HSP70h; RNA2). Symptomatic samples yielded products of expected sizes (RdRp,450 bp; HSP70h, 510 bp) while asymptomatic samples did not. The amplicons were cloned, and two clones of each were sequenced (BIONEER, Korea; GenBank acc. nos. LC592226 and LC592227) showing 100% and 99.2% nt identity with RdRp and HSP70h genes of Chinese CCYV isolate SD (MH819190 and MH819191, respectively) and other Asian isolates. Primers specific for CMV, WMV, beet pseudo-yellows virus (BPYV) (Okuda et al., 2007), TMV (Kim et al., 2018), MNSV (F/R, 5'-ATCTCGCATTTGGCATTACTC-3'/5'-ATTTGTAGAGATGCCAACGTA-3'), cucurbit yellow stunting disorder virus (CYSDV; Zeng et al., 2011) and cucurbit aphid-borne yellows virus (CABYV; F/R, 5'-CGGTCTATTGTCTGCAGTACCA-3'/5'- GTAGAGGATCTTGAATTGGTCCTCA-3') were also used. None of these viruses were detected in the symptomatic samples, but both asymptomatic plants were positive for CMV and WMV, and one also for MNSV. In June and September 2020, muskmelon and oriental melon (Cucumis melo L. var. makuwa) plants with yellowing disease (incidence 80-90%) and whiteflies were observed in all investigated plastic houses of one muskmelon and one oriental melon farm in Gyeonggi and Jeolla provinces. Symptomatic samples (14 muskmelon; 6 oriental melon) were collected and RT-PCR tested as above; 19/20 samples were positive for CCYV, but none for the other viruses. The oriental melon sequence (LC592895, LC592230) showed 99.7% and 100% nt identity with the RdRp and HSP70h genes of Chinese isolate SD, respectively. CCYV was first reported in Japan (Okuda et al., 2010), Taiwan, and China (Huang et al., 2010; Gu et al., 2011); to our knowledge, this is the first report of CCYV infecting muskmelon and oriental melon in Korea. Whitefly-transmitted CCYV could present a serious threat of yield losses to cucurbit crops in Korea, requiring control of vector populations to prevent spread of CCYV.

First report of a resistance-breaking strain of Tomato spotted wilt orthotospovirus infecting Capsicum annuum carrying the Tsw resistance gene in South Korea.

Tomato spotted wilt orthotospovirus (TSWV) was first reported in 2004 from paprika in South Korea (Kim et al., 2004), where it is currently widespread. TSWV infections were reported in chili pepper, tomato, weeds, and ornamental plant species in South Korea (Choi et al., 2014; Choi and Choi, 2015; Yoon et al., 2016; Yoon et al., 2018; Yoon et al., 2019). One of the best strategies for TSWV management is planting resistant cultivars containing the Tsw gene. In 2019 virus-like symptoms were observed in chili pepper (Capsicum annuum) plants bearing the Tsw gene in Anseong-si, South Korea. The infected chili peppers showed mosaic and wilting followed by necrosis on leaves and fruits in the field. To identify the causal virus, symptomatic leaf samples were analyzed using ImmunoStrip kits (Agdia, USA); we detected three pepper-infecting viruses: Pepper mild mottle virus, Cucumber mosaic virus, and TSWV. TSWV was only detected from 40 naturally infected chili pepper plants exhibiting virus-like symptoms. To further confirm the presence of TSWV (named TSWV-P1), we amplified reverse-transcription polymerase chain reaction (RT-PCR) products for L, M, and S RNA segments using tospovirus-specific and TSWV-specific primers (Batuman et al., 2014). Expected fragments of 445, 868, and 777 bp in length were amplified and sequenced. The complete genome sequences of TSWV-P1 from a symptomatic chili pepper plant were also determined using TSWV-specific primers (Choi et al., 2014; Lian et al., 2013). The complete genome sequences of TSWV-P1 were deposited to GenBank (LC549179, LC549180, and LC549181). The sequences of each fragment were identical to a consensus sequence, showing 99.1%, 98.5%, and 98.6% identity with TSWV-L, M, and S RNA (KP008132, AY744492, and KP008134), respectively. These results clearly showed only a single TSWV infection among the naturally infected chili pepper plants, without reassortment between TSWV and another tospovirus. To confirm whether TSWV-P1 is a resistance-breaking (RB) strain, Nicotiana rustica was mechanically inoculated with sap from leaves of the infected pepper samples to propagate TSWV-P1. A non-RB TSWV isolate (TSWV-Kor-lisianthus) from lisianthus was used as a control (Yoon et al., 2017). Two resistant (with Tsw) and two susceptible chili pepper cultivars (20 plants per cultivar) were mechanically inoculated with sap from leaves of the TSWV-infected N. rustica. The incidence rates of disease caused by TSWV-P1 were 90-100% for resistant and 95-100% for susceptible cultivars. In contrast, TSWV-Kor-lisianthus caused symptoms only in the susceptible pepper cultivars (90-100% incidence). TSWV infection in representative plants was confirmed using the TSWV- ImmunoStrip kit and RT-PCR. The NSs gene of TSWV-P1 consists of 1,404 nucleotides (468 amino acids); sequence analysis of the TSWV-P1 NSs gene showed high nucleotide (99.7%) and amino acid identities (99.8%) with the NSs sequences of two TSWV isolates (FR693035, CBX24121). Protein sequence analysis of TSWV-P1 NSs revealed that no amino acid mutation was associated with those of a representative TSWV RB strain, as previously described (Almási et al., 2017), suggesting that TSWV-P1 is a RB strain. Because this TSWV-P1 can overcome resistance conferred by the Tsw gene in commercially grown chili pepper cultivars, it represents a potential threat to pepper production in South Korea.

First report of Passiflora latent virus(Passiflora latent virus;PLV) infecting persimmon in Korea.

Passiflora latent virus (PLV), a member of the genus Carlavirus in the family Betaflexiviridae has been reported in Passiflora species in Australia, Germany, Israel, the United States, and New Zealand (Tang et al., 2008). In September 2019, leaves showing a virus-like disease with mosaic, curling and necrosis were collected from ten persimmon (Diospyros kaki Thunb.) orchards in Gyeongsang province, Korea. Total RNA from a pooled sample of leaves from 21 trees was extracted using RNeasy Plant Mini Kit (Qiagen, Germany) and subjected to high throughput sequencing. After pre-processing and Ribo-Zero rRNA Removal, a cDNA library was prepared using an Illumina TruSeq Stranded Total RNA Kit and sequenced on an Illumina NovaSeq 6000 system (Macrogen Inc. Korea). De novo assembly of the 74,862,810 reads was performed using Trinity software (r20140717); the initially assembled 213,476 contigs were screened against the NCBI viral genome database using BLASTN. By these means, 12 contigs derived from PLV were identified. Contigs with lengths of 209 to 802 nt shared nt identities of 90.70 to 94.82% with PLV isolates, covering a total of 5,169 nt (~61.6% of the full PLV genome). Two additional viruses were also detected from the pooled sample: persimmon cryptic virus (PeCV) and persimmon virus A (PeVA). To confirm PLV infection, reverse transcription-polymerase chain reaction (RT-PCR) was performed using virus-specific primers, PLV-F (5'-ACACAAAACTGCGTGTTGGA-3') and PLV-R (5'-CAAGACCCACCTACCTCAGTGTG-3'), designed based on a 633 nt contig sequence in the polymerase gene. RT-PCR products of the expected 571 bp were obtained from two of 21 individual original samples; no asymptomatic plants were tested. Amplicons were cloned into the pGEM-T Easy Vector, and two clones per sample Sanger sequenced bidirectionally (BIONEER, Korea). The identical Sequence (GenBank LC556232) showed 99.65% nt identity to the contig, and 93.87% identity with the corresponding polymerase sequence of PLV-Rehovot isolate from passion fruit in Israel (MH379331). The two PLV positive samples showing leaf necrosis were also co-infected with PeVA, identified by RT-PCR using previously reported primers PeVAfor/ PeVArev (Morell et al., 2014), but not with PeCV (mixed with PeVA in only 1/21 plants; PeVA was found in 19/21 plants). None of the tested viruses were detected in two trees, displaying mosaic, and leaf curling, respectively. The foliar symptoms of PLV infection on passionfruit have been reported to vary throughout the year (Spiegel et al., 2007). No such observations in persimmon was possible, as the infected persimmon trees were removed and destroyed because they might pose a threat to the cultivation of passion fruits in Korea. To our knowledge, this is the first report of persimmon as a host of PLV anywhere in the world, and the first report of PLV in Korea in any host. A further survey is needed to determine possible presence of PLV on persimmon and Passiflora species.

Epidemiology of tomato spotted wilt virus in Chrysanthemum morifolium in South Korea and its management using a soil-dwelling predatory mite (Stratiolaelaps scimitus) and essential oils.

Tomato spotted wilt virus (TSWV) is one of most destructive viruses in vegetable and ornamental crop production worldwide. A greenhouse survey to determine the incidence of TSWV in Chrysanthemummorifolium Ramat. was conducted during the 2018 and 2019 growing seasons in South Korea. TSWV was detected using a double antibody sandwich-enzyme-linked immunosorbent assay, and positive results were confirmed using reverse transcription-polymerase chain reaction (RT-PCR). A total of 1569 chrysanthemum plants (70.77 %) tested positive for TSWV among 2217 symptomatic chrysanthemum plants collected from 16 greenhouses. In addition, 116 thrips (72.96 %; Frankliniella occidentalis Pergande) that contained TSWV were identified using RT-PCR from a total of 159 thrips collected from the greenhouses during the survey. A high incidence of viruliferous thrips may have played a role in TSWV occurrence in the chrysanthemum greenhouse. To develop a novel approach for thrips management, the effectiveness of a soil-dwelling predatory mite (Stratiolaelaps scimitus Berlese) and 45 essential oils (as bio-insecticides applied via foliar treatment) was assayed. Four essential oils (cinnamon oil, cinnamon bark oil, oregano oil, and thyme oil) were shown to be significantly toxic to eggs, larvae, and adults of F. occidentalis. For the combined treatment, individuals of S. scimitus (60/m2) were placed on the soil in the chrysanthemum greenhouses. Then, a mixture of the four essential oils was applied as foliar treatment at 4-day intervals. A very low incidence of thrips emerged as adults from the soil (1.2-8.5 %) in the combined treatment in the chrysanthemum greenhouses when surveyed twice per month, compared with the non-treated control or when conventional insecticide sprays were applied. The incidence of TSWV (0.93 %) in chrysanthemum treated with S. scimitus in conjunction with the mixture of four essential oils decreased significantly compared with that treated with chemical insecticides (32.05 %) and in the non-treated controls (84.85 %). Our findings contribute to the development of novel strategies to control TSWV disease in chrysanthemum plants; notably, the control of F. occidentalis using eco-friendly insecticides appears promising.

R gene mediated defense against viruses.

The relationship of Resistance (R) gene-mediated defense to other forms of resistance in plants is considered, and the natures of the products of dominant and recessive R genes are reviewed. Various factors involved in expressing R gene-mediated resistance are described. These include phytohormones and plant effector molecules: the former regulating different pathways for disease resistance and the latter having direct effects on viral genomes or encoded proteins. Finally, the status of our knowledge concerning the cell-death hypersensitive response and its relationship to the actual resistance response involved in inhibiting virus infection is examined.

Plant defense signals: Players and pawns in plant-virus-vector interactions.

Plant viruses face an array of host defenses. Well-studied responses that protect against viruses include effector-triggered immunity, induced resistance (such as systemic acquired resistance mediated by salicylic acid), and RNA silencing. Recent work shows that viruses are also affected by non-host resistance mechanisms; previously thought to affect only bacteria, oomycetes and fungi. However, an enduring puzzle is how viruses are inhibited by several inducible host resistance mechanisms. Many viruses have been shown to encode factors that inhibit antiviral silencing. A number of these, including the cucumoviral 2b protein, the poytviral P1/HC-Pro and, respectively, geminivirus or satellite DNA-encoded proteins such as the C2 or ßC1, also inhibit defensive signaling mediated by salicylic acid and jasmonic acid. This helps to explain how viruses can, in some cases, overcome host resistance. Additionally, interference with defensive signaling provides a means for viruses to manipulate plant-insect interactions. This is important because insects, particularly aphids and whiteflies, transmit many viruses. Indeed, there is now substantial evidence that viruses can enhance their own transmission through their effects on hosts. Even more surprisingly, it appears that viruses may be able to manipulate plant interactions with beneficial insects by, for example, 'paying back' their hosts by attracting pollinators.

Viral Manipulation of Plant Stress Responses and Host Interactions With Insects.

Do the alterations in plant defensive signaling and metabolism that occur in susceptible hosts following virus infection serve any purpose beyond directly aiding viruses to replicate and spread? Or indeed, are these modifications to host phenotype purely incidental consequences of virus infection? A growing body of data, in particular from studies of viruses vectored by whiteflies and aphids, indicates that viruses influence the efficiency of their own transmission by insect vectors and facilitate mutualistic relationships between viruses and their insect vectors. Furthermore, it appears that viruses may be able to increase the opportunity for transmission in the long term by providing reward to the host plants that they infect. This may be conditional, for example, by aiding host survival under conditions of drought or cold or, more surprisingly, by helping plants attract beneficial insects such as pollinators. In this chapter, we cover three main areas. First, we describe the molecular-level interactions governing viral manipulation of host plant biology. Second, we review evidence that virus-induced changes in plant phenotype enhance virus transmission. Finally, we discuss how direct and indirect manipulation of insects and plants might impact on the evolution of viruses and their hosts.