ABSTRACT
Purpose: Oxycodone is a potent µ- and κ-opioid receptor agonist that can relieve both somatic and visceral pain. We assessed oxycodone- vs sufentanil-based multimodal analgesia on postoperative pain following major laparoscopic gastrointestinal surgery. Methods: In this randomised double-blind controlled trial, 40 adult patients were randomised (1:1, stratified by type of surgery) to receive oxycodone- or sufentanil-based multimodal analgesia, comprising bilateral transverse abdominis plane blocks, intraoperative dexmedetomidine infusion, flurbiprofen axetil, and oxycodone- or sufentanil-based patient-controlled analgesia. The co-primary outcomes were time-weighted average (TWA) of visceral pain (defined as intra-abdominal deep and dull pain) at rest and on coughing during 0-24 h postoperatively, assessed using the numerical rating scale (0-10) with a minimal clinically important difference of 1. Results: All patients completed the study (median age, 64 years; 65% male) and had adequate postoperative pain control. The mean (SD) 24-h TWA of visceral pain at rest was 1.40 (0.77) in the oxycodone group vs 2.00 (0.98) in the sufentanil group (mean difference=-0.60, 95% CI, -1.16 to -0.03; P=0.039). Patients in the oxycodone group had a significantly lower 24-h TWA of visceral pain on coughing (2.00 [0.83] vs 2.98 [1.26]; mean difference=-0.98, 95% CI, -1.66 to -0.30; P=0.006). In the subgroup analyses, the treatment effect of oxycodone vs sufentanil on the co-primary outcomes did not differ in terms of age (18-65 years or >65 years), sex (female or male), or type of surgery (colorectal or gastric). Secondary outcomes (24-h TWA of incisional and shoulder pain, postoperative analgesic usage, rescue analgesia, adverse events, and patient satisfaction) were comparable between groups. Conclusion: For patients undergoing major laparoscopic gastrointestinal surgery, oxycodone-based multimodal analgesia reduced postoperative visceral pain in a statistically significant but not clinically important manner. Trial Registration: Chinese Clinical Trial Registry (ChiCTR2100052085).
Subject(s)
Analgesics, Opioid , Laparoscopy , Oxycodone , Pain, Postoperative , Visceral Pain , Humans , Oxycodone/administration & dosage , Oxycodone/therapeutic use , Double-Blind Method , Middle Aged , Male , Female , Laparoscopy/adverse effects , Pain, Postoperative/drug therapy , Visceral Pain/drug therapy , Aged , Analgesics, Opioid/administration & dosage , Analgesics, Opioid/therapeutic use , Adult , Digestive System Surgical Procedures/adverse effects , Dexmedetomidine/administration & dosage , Dexmedetomidine/pharmacology , Sufentanil/administration & dosage , Analgesia, Patient-Controlled , Flurbiprofen/analogs & derivativesABSTRACT
BACKGROUND: Changing the course duration or timing of subjects in learning pathways would influence medical students' learning outcomes. Curriculum designers need to consider the strategy of reducing cognitive load and evaluate it continuously. Our institution underwent gradual curricular changes characterized by reducing cognitive load since 2000. Therefore, we wanted to explore the impact of this strategy on our previous cohorts. METHODS: This cohort study explored learning pathways across academic years of more than a decade since 2000. Eight hundred eighty-two medical students between 2006 to 2012 were included eventually. Learning outcomes included an average and individual scores of subjects in different stages. Core subjects were identified as those where changes in duration or timing would influence learning outcomes and constitute different learning pathways. We examined whether the promising learning pathway defined as the pathway with the most features of reducing cognitive load has higher learning outcomes than other learning pathways in the exploring dataset. The relationship between features and learning outcomes was validated by learning pathways selected in the remaining dataset. RESULTS: We found nine core subjects, constituting four different learning pathways. Two features of extended course duration and increased proximity between core subjects of basic science and clinical medicine were identified in the promising learning pathway 2012, which also had the highest learning outcomes. Other pathways had some of the features, and pathway 2006 without such features had the lowest learning outcomes. The relationship between higher learning outcomes and cognitive load-reducing features was validated by comparing learning outcomes in two pathways with and without similar features of the promising learning pathway. CONCLUSION: An approach to finding a promising learning pathway facilitating students' learning outcomes was validated. Curricular designers may implement similar design to explore the promising learning pathway while considering potential confounding factors, including students, medical educators, and learning design of the course.
ABSTRACT
BACKGROUND: There is currently insufficient evidence on potential predictors of a child's behaviour with nitrous oxide (N2O) sedation. AIM: To examine the association between a child's temperament and behavioural outcomes during dental treatment with N2O sedation, and the child's perception to N2O sedation. DESIGN: At the first visit (dental treatment visit), temperament was assessed using the Child Behaviour Questionnaire-Short Form and behaviour was assessed by an independent rater using the Venham Behaviour Rating Scale. At the second visit, the child's experience with N2O sedation was elicited. RESULTS: Seventy-two healthy children aged between 36 and 95 months were recruited. Planned dental treatment was completed in 84.7% of the subjects. Venham behaviour success <3 and Venham behaviour success <1 were achieved in 73.6% and 33.3%, respectively. The temperament domain of effortful control was associated with Venham behaviour score (ρ = -0.266, p = .024) and Venham behaviour success <1 (OR = 3.506, 95% CI = 1.328-9.259, p = .011). Baseline Frankl behaviour score was significantly associated with all behavioural outcomes. Venham behaviour success <3 was significantly associated with a child reporting to have enjoyed the dental treatment visit (p = .026). CONCLUSION: Effortful control and baseline behaviour were associated with behavioural outcomes of N2O sedation and can be used to predict a child's behaviour.
ABSTRACT
Introduction: The utilization of artificial intelligence (AI) augments intraoperative safety and surgical training. The recognition of parathyroid glands (PGs) is difficult for inexperienced surgeons. The aim of this study was to find out whether deep learning could be used to auxiliary identification of PGs on intraoperative videos in patients undergoing thyroid surgery. Methods: In this retrospective study, 50 patients undergoing thyroid surgery between 2021 and 2023 were randomly assigned (7:3 ratio) to a training cohort (n = 35) and a validation cohort (n = 15). The combined datasets included 98 videos with 9,944 annotated frames. An independent test cohort included 15 videos (1,500 frames) from an additional 15 patients. We developed a deep-learning model Video-Trans-U-HRNet to segment parathyroid glands in surgical videos, comparing it with three advanced medical AI methods on the internal validation cohort. Additionally, we assessed its performance against four surgeons (2 senior surgeons and 2 junior surgeons) on the independent test cohort, calculating precision and recall metrics for the model. Results: Our model demonstrated superior performance compared to other AI models on the internal validation cohort. The DICE and accuracy achieved by our model were 0.760 and 74.7% respectively, surpassing Video-TransUnet (0.710, 70.1%), Video-SwinUnet (0.754, 73.6%), and TransUnet (0.705, 69.4%). For the external test, our method got 89.5% precision 77.3% recall and 70.8% accuracy. In the statistical analysis, our model demonstrated results comparable to those of senior surgeons (senior surgeon 1: χ2 = 0.989, p = 0.320; senior surgeon 2: χ2 = 1.373, p = 0.241) and outperformed 2 junior surgeons (junior surgeon 1: χ2 = 3.889, p = 0.048; junior surgeon 2: χ2 = 4.763, p = 0.029). Discussion: We introduce an innovative intraoperative video method for identifying PGs, highlighting the potential advancements of AI in the surgical domain. The segmentation method employed for parathyroid glands in intraoperative videos offer surgeons supplementary guidance in locating real PGs. The method developed may have utility in facilitating training and decreasing the learning curve associated with the use of this technology.
ABSTRACT
Background: Recurrent pregnancy loss (RPL) is a severe traumatic event for women of childbearing age. However, the association between RPL and female sexual dysfunction was unknown. Aim: The study sought to investigate the association between RPL and sexual dysfunction, and to explore the risk factors of sexual dysfunction for RPL patients. Methods: A multicenter cross-sectional study involving both RPL patients and healthy women was performed in 3 different hospitals in West China from May 2021 to January 2023. Baseline information including sociodemographic data and disease histories were collected. The Female Sexual Function Index (FSFI) was used to assess the sexual function of participants. Outcomes: The main outcome was the proportion of women at increased risk of sexual dysfunction (total FSFI scores <26.55), and the secondary outcome was risk factors of sexual dysfunction in RPL patients. Results: A total of 233 RPL patients and 185 healthy women were included in this study. RPL patients had significantly lower total FSFI scores (median 31.7 [interquartile range, 26.6-33.5] vs 33.0 [interquartile range, 31.2-34.1]; P < .001) and a significantly higher risk of sexual dysfunction than healthy women (24.9% vs 8.6%; P < .001). Body mass index >24 kg/m2 (adjusted odds ratio [OR], 4.132; 95% confidence interval [CI], 1.902-8.976, P < .001), working >8 h/d (adjusted OR, 2.111; 95% CI, 1.020-4.369, P = .044), and unexplained RPL (adjusted OR, 3.785; 95% CI, 1.967-7.280, P < .001) were independent risk factors of sexual dysfunction for RPL patients. Clinical Implications: RPL patients, especially those patients with the previously mentioned risk factors, should be focused on the risk of sexual dysfunction, and appropriate preventions could be applied. Strength and Limitations: We explored the association between RPL and sexual dysfunction and explored the risk factors of sexual dysfunction among RPL patients for the first time, and the multicenter data increased the generalizability of results. However, the cross-sectional design did not provide an exact causal relationship between RPL and sexual dysfunction, and potential risk factors related to mental health were not investigated. Conclusion: RPL patients were at an increased risk of sexual dysfunction. Overweight, fatigue caused by work, and unexplained RPL were risk factors of sexual dysfunction for RPL patients.
ABSTRACT
OBJECTIVES: The aim of this study was to present key findings from the 2019 national adult oral health survey in Singapore (NAOHS). METHODS: A multi-stage stratified sampling method was used to recruit participants for a representative national adult oral health survey. A total of 12 212 households were randomly selected from the National Database on Dwellings in Singapore. Within each household eligible persons aged ≥65 years were automatically invited to participate while a Kish selection method was used to invite those between 21 and 64 years old. The survey comprised a face-to-face interview questionnaire and a clinical examination which recorded details of tooth loss, DMFT, DMFS and prevalence of periodontal disease according to the CPITN and the US CDC-AAP classifications. Weighted analysis was performed to adjust for oversampling, non-response and post-stratification. Multivariate regression with backward stepwise selection was carried out to identify predictors of chronic periodontal disease and untreated dental caries. RESULTS: Six hundred and sixty-three participants completed both the questionnaires and the clinical examination. The prevalence of edentulousness was 2.7%. Of participants, 34.8% presented with untreated dental caries with a higher proportion found in those who were aged ≥60 years, of Malay ethnicity, living in 1-2-room public housing and who only visited the dentist when there was a problem. Mean DMFS and DMFT indices were 24.7 and 7.9 respectively. Based on the CDC-AAP classification, the prevalence of moderate-severe chronic periodontitis was 56.9% and increased with age, with a higher proportion in males. Participants with untreated dental caries were more likely to have moderate or severe periodontal disease. CONCLUSIONS: Survey findings showed high prevalence of dental caries and periodontal disease, at 34.8% and 77.6% respectively. A clear socio-economic gradient in the distribution of tooth loss, untreated dental caries and moderate-to-severe periodontitis was observed.
Subject(s)
Dental Caries , Dental Health Surveys , Humans , Singapore/epidemiology , Male , Female , Middle Aged , Aged , Prevalence , Dental Caries/epidemiology , Adult , Periodontal Diseases/epidemiology , Young Adult , DMF Index , Tooth Loss/epidemiology , Oral Health/statistics & numerical dataABSTRACT
Inherited neuromuscular disorder (IND) is a broad-spectrum, clinically diverse group of diseases that are caused due to defects in the neurosystem, muscles and related tissue. Since IND may originate from mutations in hundreds of different genes, the resulting heterogeneity of IND is a great challenge for accurate diagnosis and subsequent management. Three pediatric cases with IND were enrolled in the present study and subjected to a thorough clinical examination. Next, a genetic investigation was conducted using whole-exome sequencing (WES). The suspected variants were validated through Sanger sequencing or quantitative fluorescence PCR assay. A new missense variant of the Spastin (SPAST) gene was found and analyzed at the structural level using molecular dynamics (MD) simulations. All three cases presented with respective specific clinical manifestations, which reflected the diversity of IND. WES detected the diagnostic variants in all 3 cases: A compound variation comprising collagen type VI α3 chain (COL6A3) (NM_004369; exon19):c.6322G>T(p.E1208*) and a one-copy loss of COL6A3:exon19 in Case 1, which are being reported for the first time; a de novo SPAST (NM_014946; exon8):c.1166C>A(p.T389K) variant in Case 2; and a de novo Duchenne muscular dystrophy (NM_004006; exon11):c.1150-17_1160delACTTCCTTCTTTGTCAGGGGTACATGATinsC variant in Case 3. The structural and MD analyses revealed that the detected novel SPAST: c.1166C>A(p.T389K) variant mainly altered the intramolecular hydrogen bonding status and the protein segment's secondary structure. In conclusion, the present study expanded the IND mutation spectrum. The study not only detailed the precise diagnoses of these cases but also furnished substantial grounds for informed consultations. The approach involving the genetic evaluation strategy using WES for variation screening followed by validation using appropriate methods is beneficial due to the considerable heterogeneity of IND.
ABSTRACT
OBJECTIVE: To analyze the hip joint biomechanics of the acetabular anatomical reconstruction and nonanatomical reconstruction in total hip arthroplasty (THA) for Crowe type â ¢ developmental dysplasia of the hip (DDH) by finite element method, which provided theoretical foundation and experimental basis for the anatomical acetabular reconstruction during THA in clinical practice. METHODS: One patient with left end-stage hip arthritis secondary to Crowe type â ¢ DDH was selected in this study, who underwent total hip arthroplasty in the orthopedic department of the First Affiliated Hospital of Bengbu Medical College in April 2020. This patient was female, 57 years old. The preoperative and postoperative three dimentional CT scan of the patient's pelvis were performed. Fourteen acetabular cup models with different anteversion, inclination and rotation center height were established in Mimics and 3-Matic software. The boundary and load conditions were set in Abaqus software. The Von Mises and stress distribution of the hip joint were calculated and observed. RESULTS: In the Crowe type â ¢ DDH THA, if the hip rotation center was restored anatomically and the acetabular cup's inclination was set as 40°, the cup's anteversion varied from 5° to 25°, the lowest Von Mises value of acetabular cup and polyethylene liner occured in 20°anteversioin;if the hip rotation center was restored anatomically and the acetabular cup's anteversion was set as 15°, the cup's inclination varied from 35° to 55°, the lowest Von Mises value of acetabular cup and polyethylene liner occured in 35° inclination;if the acetabular cup's anteversion and inclination were set as 15°and 40°respectively, the up migration of hip rotaion center varied from 0 mm to 20 mm, the lowest Von Mises value of acetabular cup and polyethylene liner occured in 10 mm up migration. In all fourteen models, the Von Mises value of the acetabulum, acetabulum cup and polyethylene liner were lowest when the acetabular cup's anteversion and inlcination were 15°, 35° respectively, as well as the rotation center was restored anatomically. CONCLUSION: In total hip arthroplasty for Crowe type â ¢ DDH, the anatomical restoration of hip rotation center with 15° anteversion and 35° inclination of the acetabular cup are suggested, bone graft above the acetabular cup and additional screws are recommended simultaneously to further reduce the Von Mises of hip joint.
Subject(s)
Acetabulum , Arthroplasty, Replacement, Hip , Developmental Dysplasia of the Hip , Finite Element Analysis , Humans , Arthroplasty, Replacement, Hip/methods , Female , Middle Aged , Biomechanical Phenomena , Acetabulum/surgery , Developmental Dysplasia of the Hip/surgery , Hip Joint/surgery , Hip Joint/physiopathology , Plastic Surgery Procedures/methodsABSTRACT
BACKGROUND: The aim of this study was to exploit integrated PET/MRI to simultaneously evaluate the morphological, component, and metabolic features of advanced atherosclerotic plaques and explore their incremental value. METHODS: In this observational prospective cohort study, patients with advanced plaque in the carotid artery underwent 18F-FDG PET/MRI. Plaque morphological features were measured, and plaque component features were determined via MRI according to AHA lesion-types. Maximum standardized uptake values (SUVmax) and tissue to background ratio (TBR) on PET were calculated. Area under the receiver-operating characteristic curve (AUC) and net reclassification improvement (NRI) were used to compare the incremental contribution of FDG uptake when added to AHA lesion-types for symptomatic plaque classification. RESULTS: A total of 280 patients with advanced plaque in the carotid artery were recruited. A total of 402 plaques were confirmed, and 87 of 402 (21.6%) were symptomatic plaques. 18F-FDG PET/MRI was performed a mean of 38 days (range 1-90) after the symptom. Increased stenosis degree (61.5% vs. 50.0%, p < 0.001) and TBR (2.96 vs. 2.32, p < 0.001) were observed in symptomatic plaques compared with asymptomatic plaques. The performance of the combined model (AHA lesion type VI + stenosis degree + TBR) for predicting symptomatic plaques was the best among all models (AUC = 0.789). The improvement of the combined model (AHA lesion type VII + stenosis degree + TBR) over AHA lesion type VII model for predicting symptomatic plaques was the highest (AUC = 0.757/0.454, combined model/AHA lesion type VII model), and the NRI was 50.7%. CONCLUSIONS: Integrated PET/MRI could simultaneously evaluate the morphological component and inflammation features of advanced atherosclerotic plaques and provide supplementary optimization information over AHA lesion-types for identifying vulnerable plaques in atherosclerosis subjects to achieve further stratification of stroke risk.
ABSTRACT
Sepsis is an infection-triggered, rapidly progressive systemic inflammatory syndrome with a high mortality rate. Currently, there are no promising therapeutic strategies for managing this disease in the clinic. Heparanase plays a crucial role in the pathology of sepsis, and its inhibition can significantly relieve related symptoms. Here, a novel heparanase inhibitor CV122 is rationally designed and synthesized, and its therapeutic potential for sepsis with Lipopolysaccharide (LPS) and Cecal Ligation and Puncture (CLP)-induced sepsis mouse models are evaluated. It is found that CV122 potently inhibits heparanase activity in vitro, protects cell surface glycocalyx structure, and reduces the expression of adhesion molecules. In vivo, CV122 significantly reduces the systemic levels of proinflammatory cytokines, prevents organ damage, improves vitality, and efficiently protects mice from sepsis-induced death. Mechanistically, CV122 inhibits the activity of heparanase, reduces its expression in the lungs, and protects glycocalyx structure of lung tissue. It is also found that CV122 provides effective protection from organ damage and death caused by Crimean-Congo hemorrhagic fever virus (CCHFV) infection. These results suggest that CV122 is a potential drug candidate for sepsis therapy targeting heparanase by inhibiting cytokine storm.
ABSTRACT
Accurately assessing carotid artery wall thickening and identifying risky plaque components are critical for early diagnosis and risk management of carotid atherosclerosis. In this paper, we present a 3D framework for automated segmentation of the carotid artery vessel wall and identification of the compositions of carotid plaque in multi-sequence magnetic resonance (MR) images under the challenge of imperfect manual labeling. Manual labeling is commonly done in 2D slices of these multi-sequence MR images and often lacks perfect alignment across 2D slices and the multiple MR sequences, leading to labeling inaccuracies. To address such challenges, our framework is split into two parts: a segmentation subnetwork and a plaque component identification subnetwork. Initially, a 2D localization network pinpoints the carotid artery's position, extracting the region of interest (ROI) from the input images. Following that, a signed-distance-map-enabled 3D U-net (Çiçek etal, 2016)an adaptation of the nnU-net (Ronneberger and Fischer, 2015) segments the carotid artery vessel wall. This method allows for the concurrent segmentation of the vessel wall area using the signed distance map (SDM) loss (Xue et al., 2020) which regularizes the segmentation surfaces in 3D and reduces erroneous segmentation caused by imperfect manual labels. Subsequently, the ROI of the input images and the obtained vessel wall masks are extracted and combined to obtain the identification results of plaque components in the identification subnetwork. Tailored data augmentation operations are introduced into the framework to reduce the false positive rate of calcification and hemorrhage identification. We trained and tested our proposed method on a dataset consisting of 115 patients, and it achieves an accurate segmentation result of carotid artery wall (0.8459 Dice), which is superior to the best result in published studies (0.7885 Dice). Our approach yielded accuracies of 0.82, 0.73 and 0.88 for the identification of calcification, lipid-rich core and hemorrhage components. Our proposed framework can be potentially used in clinical and research settings to help radiologists perform cumbersome reading tasks and evaluate the risk of carotid plaques.
ABSTRACT
A lipidated polysaccharide, HDPS-2II, was isolated from the dried larva of Holotrichia diomphalia, which is used in traditional Chinese medicine. The molecular weight of HDPS-2II was 5.9 kDa, which contained a polysaccharide backbone of â4)-ß-Manp-(1 â 4,6)-ß-Manp-(1 â [6)-α-Glcp-(1]n â 6)-α-Glcpâ with the side chain α-Glcp-(6 â 1)-α-Glcp-(6 â linked to the C-4 of ß-1,4,6-Manp and four types of lipid chains including 4-(4-methyl-2-(methylamino)pentanamido)pentanoic acid, 5-(3-(tert-butyl)phenoxy)hexan-2-ol, N-(3-methyl-5-oxopentan-2-yl)palmitamide, and N-(5-amino-3-methyl-5-oxopentan-2-yl)stearamide. The lipid chains were linked to C-1 of terminal α-1,6-Glcp in carbohydrate chain through diacyl-glycerol. HDPS-2II exhibited DNA protective effects and antioxidative activity on H2O2- or adriamycin (ADM)-induced Chinese hamster lung cells. Furthermore, HDPS-2II significantly ameliorated chromosome aberrations and the accumulation of reactive oxygen species (ROS), reduced γ-H2AX signaling and the expressions of NADPH oxidase (NOX)2, NOX4, P22phox, and P47phox in ADM-induced cardiomyocytes. Mechanistically, HDPS-2II suppressed ADM-induced up-regulation of NOX2 and NOX4 in cardiomyocytes, but not in NOX2 or NOX4 knocked-down cardiomyocytes, indicating that HDPS-2II could relieve intracellular DNA damage by regulating NOX2/NOX4 signaling. These findings demonstrate that HDPS-2II is a new potential DNA protective agent.
ABSTRACT
During 2010 to 2020, Northeast Pacific (NEP) sea surface temperature (SST) experienced the warmest decade ever recorded, manifested in several extreme marine heatwaves, referred to as "warm blob" events, which severely affect marine ecosystems and extreme weather along the west coast of North America. While year-to-year internal climate variability has been suggested as a cause of individual events, the causes of the continuous dramatic NEP SST warming remain elusive. Here, we show that other than the greenhouse gas (GHG) forcing, rapid aerosol abatement in China over the period likely plays an important role. Anomalous tropospheric warming induced by declining aerosols in China generated atmospheric teleconnections from East Asia to the NEP, featuring an intensified and southward-shifted Aleutian Low. The associated atmospheric circulation anomaly weakens the climatological westerlies in the NEP and warms the SST there by suppressing the evaporative cooling. The aerosol-induced mean warming of the NEP SST, along with internal climate variability and the GHG-induced warming, made the warm blob events more frequent and intense during 2010 to 2020. As anthropogenic aerosol emissions continue to decrease, there is likely to be an increase in NEP warm blob events, disproportionately large beyond the direct radiative effects.
ABSTRACT
Studies have suggested that endoplasmic reticulum stress (ERS) is involved in neurological dysfunction and that electroacupuncture (EA) attenuates neuropathic pain (NP) via undefined pathways. However, the role of ERS in the anterior cingulate cortex (ACC) in NP and the effect of EA on ERS in the ACC have not yet been investigated. In this study, an NP model was established by chronic constriction injury (CCI) of the left sciatic nerve in rats, and mechanical and cold tests were used to evaluate behavioral hyperalgesia. The protein expression and distribution were evaluated using western blotting and immunofluorescence. The results showed that glucose-regulated protein 78 (BIP) and inositol-requiring enzyme 1α (IRE-1α) were co-localized in neurons in the ACC. After CCI, BIP, IRE-1α, and phosphorylation of IRE-1α were upregulated in the ACC. Intra-ACC administration of 4-PBA and Kira-6 attenuated pain hypersensitivity and downregulated phosphorylation of IRE-1α, while intraperitoneal injection of 4-PBA attenuated hyperalgesia and inhibited the activation of P38 and JNK in ACC. In contrast, ERS activation by intraperitoneal injection of tunicamycin induced behavioral hyperalgesia in naive rats. Furthermore, EA attenuated pain hypersensitivity and inhibited the CCI-induced overexpression of BIP and pIRE-1α. Taken together, these results demonstrate that EA attenuates NP by suppressing BIP- and IRE-1α-mediated ERS in the ACC. Our study presents novel evidence that ERS in the ACC is implicated in the development of NP and provides insights into the molecular mechanisms involved in the analgesic effect of EA.
Subject(s)
Disease Models, Animal , Electroacupuncture , Endoplasmic Reticulum Stress , Gyrus Cinguli , Neuralgia , Rats, Sprague-Dawley , Animals , Electroacupuncture/methods , Gyrus Cinguli/metabolism , Neuralgia/therapy , Male , Endoplasmic Reticulum Stress/physiology , Rats , Blotting, Western , Heat-Shock Proteins/metabolism , Protein Serine-Threonine Kinases/metabolism , Hyperalgesia/therapy , Endoplasmic Reticulum Chaperone BiPABSTRACT
Platelet-rich plasma (PRP) holds promise as a therapeutic modality for wound healing; however, immediate utilization encounters challenges related to volume, concentration, and consistency. Cryopreservation emerges as a viable solution, preserving PRP's bioactive components and extending its shelf life. This study explores the practicality and efficacy of cryopreserved platelet-rich plasma (cPRP) in wound healing, scrutinizing both cellular mechanisms and clinical implications. Fresh PRP and cPRP post freeze-thaw underwent assessment in macrophage, fibroblast, and endothelial cell cultures. The impact of cPRP on active component release and cell behavior pertinent to wound healing was evaluated. Varied concentrations of cPRP (1%, 5%, 10%) were examined for their influence on cell polarization, migration, and proliferation. The results showed minimal changes in cPRP's IL-1ß levels, a slight decrease in PDGF-BB, and superior effects on macrophage M2 polarization and fibroblast migration, while no statistical significance was observed in endothelial cell angiogenesis and proliferation. Remarkably, 5% PRP exhibited the most significant stimulation among all cPRP concentrations, notably impacting cell proliferation, angiogenesis, and migration. The discussion underscores that cPRP maintains platelet phenotype and function over extended periods, with 5% cPRP offering the most favorable outcomes, providing a pragmatic approach for cold storage to extend post-thaw viability and amplify therapeutic effects.
What is the context? Platelet-rich plasma (PRP) is a potential bioactive material for wound healing, but using it immediately faces issues like volume, concentration, and consistency.Low-temperature freezing is a method employed to preserve PRP. However, the current understanding of the effects of the freezing-thawing process on the components of PRP and its impact on cells relevant to wound healing remains unclear.What is new? This study explores the feasibility and effectiveness of using cryopreserved PRP at −80°C for promoting wound healing. This research stands out for its focus on cellular responses and practical implications in therapeutic contexts.To understand their distinct impact on different cell types relevant to wound healing, the study meticulously examined various final concentrations of cPRP (1%, 5%, 10%).The study identified the superior effects of 5% cPRP on crucial cellular activities, notably in cell polarization, proliferation, angiogenesis, and migration.What is the impact? Low-temperature freezing can be considered an effective method for PRP preservation.Some bioactive components in cPRP exhibit subtle changes; however, these changes result in better effects on certain cell types related to healing.The study illustrates that all concentrations of cPRP effectively enhance cell proliferation, migration, and differentiation, emphasizing the comparable efficacy of cryopreserved PRP to non-cryopreserved PRP.
Subject(s)
Cryopreservation , Platelet-Rich Plasma , Wound Healing , Platelet-Rich Plasma/metabolism , Humans , Cryopreservation/methods , Cell Proliferation , Cell Movement , Fibroblasts/metabolismABSTRACT
With increasingly used assisted reproductive technology (ART), the acquisition of high-quality oocytes and early embryos has become the focus of much attention. Studies in mice have found that the transition of chromatin conformation from non-surrounded nucleolus (NSN) to surrounded nucleolus (SN) is essential for oocyte maturation and early embryo development, and similar chromatin transition also exists in human oocytes. In this study, we collected human NSN and SN oocytes and investigated their transcriptome. The analysis of differentially expressed genes showed that epigenetic functions, cyclin-dependent kinases and transposable elements may play important roles in chromatin transition during human oocyte maturation. Our findings provide new insights into the molecular mechanism of NSN-to-SN transition of human oocyte and obtained new clues for improvement of oocyte in vitro maturation technique.
Subject(s)
Chromatin , Oocytes , Transcriptome , Humans , Oocytes/metabolism , Chromatin/metabolism , Chromatin/genetics , Female , Gene Expression Profiling , Cell Nucleolus/metabolism , Cell Nucleolus/geneticsABSTRACT
OBJECTIVES: This study investigated the potential effects of perfluoroalkyl substance (PFAS) in serum on MAFLD, NAFLD, and liver fibrosis. METHODS: Our sample included 696 participants (≥ 18 years) from the 2017-2018 NHANES study with available serum PFASs, covariates, and outcomes. Using the first quartile of PFAS as the reference group, we used weighted binary logistic regression and multiple ordered logistic regression used to analyze the relationship between PFAS and MAFLD, NAFLD, and liver fibrosis and multiple ordinal logistic regression to investigate the relationship between PFAS and MAFLD, NAFLD, and liver fibrosis and calculated the odds ratio (OR) and 95% confidence interval for each chemical. Finally, stratified analysis and sensitivity analysis were performed according to gender, age, BMI, and serum cotinine concentration. RESULTS: A total of 696 study subjects were included, including 212 NAFLD patients (weighted 27.03%) and 253 MAFLD patients (weighted 32.65%). The quartile 2 of serum PFOA was positively correlated with MAFLD and NAFLD (MAFLD, OR 2.29, 95% CI 1.05-4.98; NAFLD, OR 2.37, 95% CI 1.03-5.47). PFAS were not significantly associated with liver fibrosis after adjusting for potential confounders in MAFLD and NAFLD. Stratified analysis showed that PFOA was strongly associated with MAFLD, NAFLD, and liver fibrosis in males and obese subjects. In women over 60 years old, PFHxS was also correlated with MAFLD, NAFLD, and liver fibrosis. CONCLUSION: The serum PFOA was positively associated with MAFLD and NAFLD in US adults. After stratified analysis, the serum PFHxS was correlated with MFALD, NAFLD, and liver fibrosis.
ABSTRACT
Fusarium head blight (FHB) and the presence of mycotoxin deoxynivalenol (DON) pose serious threats to wheat production and food safety worldwide. DON, as a virulence factor, is crucial for the spread of FHB pathogens on plants. However, germplasm resources that are naturally resistant to DON and DON-producing FHB pathogens are inadequate in plants. Here, detoxifying bacteria genes responsible for DON epimerization were used to enhance the resistance of wheat to mycotoxin DON and FHB pathogens. We characterized the complete pathway and molecular basis leading to the thorough detoxification of DON via epimerization through two sequential reactions in the detoxifying bacterium Devosia sp. D6-9. Epimerization efficiently eliminates the phytotoxicity of DON and neutralizes the effects of DON as a virulence factor. Notably, co-expressing of the genes encoding quinoprotein dehydrogenase (QDDH) for DON oxidation in the first reaction step, and aldo-keto reductase AKR13B2 for 3-keto-DON reduction in the second reaction step significantly reduced the accumulation of DON as virulence factor in wheat after the infection of pathogenic Fusarium, and accordingly conferred increased disease resistance to FHB by restricting the spread of pathogenic Fusarium in the transgenic plants. Stable and improved resistance was observed in greenhouse and field conditions over multiple generations. This successful approach presents a promising avenue for enhancing FHB resistance in crops and reducing mycotoxin contents in grains through detoxification of the virulence factor DON by exogenous resistance genes from microbes.
ABSTRACT
Sugarcane is a vital crop with significant economic and industrial value. However, the cultivated sugarcane's ultra-complex genome still needs to be resolved due to its high ploidy and extensive recombination between the two subgenomes. Here, we generate a chromosomal-scale, haplotype-resolved genome assembly for a hybrid sugarcane cultivar ZZ1. This assembly contains 10.4 Gb genomic sequences and 68,509 annotated genes with defined alleles in two sub-genomes distributed in 99 original and 15 recombined chromosomes. RNA-seq data analysis shows that sugar accumulation-associated gene families have been primarily expanded from the ZZSO subgenome. However, genes responding to pokkah boeng disease susceptibility have been derived dominantly from the ZZSS subgenome. The region harboring the possible smut resistance genes has expanded significantly. Among them, the expansion of WAK and FLS2 families is proposed to have occurred during the breeding of ZZ1. Our findings provide insights into the complex genome of hybrid sugarcane cultivars and pave the way for future genomics and molecular breeding studies in sugarcane.
Subject(s)
Saccharum , Saccharum/genetics , Plant Breeding , Genomics , Haplotypes/genetics , ChromosomesABSTRACT
BACKGROUND AND AIM: The REgistry of Selective Internal radiation therapy in AsiaNs (RESIN) was a multicenter, single-arm, prospective, observational study of 90Y resin microspheres in patients with hepatocellular carcinoma (HCC) or metastatic colorectal cancer (mCRC) from Taiwan. RESIN is the first real-life clinical study of this therapy in an Asian cohort. Study objectives were to evaluate the safety and efficacy of 90Y resin microspheres. METHODS: Adults with HCC or mCRC scheduled to receive SIRT with 90Y resin microspheres were included. Primary endpoints were best overall response rate (ORR), adverse events, and changes from baseline in liver function. Secondary efficacy endpoints included overall survival (OS). RESULTS: Of 107 enrolled patients, 83 had HCC, and 24 had mCRC. ORR was 55.41% (HCC) and 33.33% (mCRC). Of 58 HCC patients with 6-month post-SIRT data, 13.79% (n = 8) had resection, transplantation, transarterial chemoembolization, or radiofrequency ablation as the result of down-staging or down-sizing of their lesions. One hundred and ten treatment emergent adverse events (TEAEs) were reported in 51 patients, and five serious adverse events (SAEs) were reported in five patients. The most frequent TEAEs were abdominal pain, nausea and decreased appetite (HCC), and abdominal pain, decreased appetite, fatigue, and vomiting (mCRC). Two deaths due to SAEs (probably related to SIRT) were reported, both in patients with extensive HCC, active hepatitis infection, and other comorbidities. Median OS was 24.07 (HCC) and 12.66 (mCRC) months. CONCLUSIONS: Safety and efficacy outcomes with the routine use of SIRT with 90Y resin microspheres in Taiwan are consistent with published data.