The role of platelets in central hubs of inflammation: A literature review.

Platelets are increasingly recognized for their multifaceted roles in inflammation beyond their traditional involvement in haemostasis. This review consolidates knowledge on platelets as critical players in inflammatory responses. This study did an extensive search of electronic databases and identified studies on platelets in inflammation, focusing on molecular mechanisms, cell interactions, and clinical implications, emphasizing recent publications. Platelets contribute to inflammation via surface receptors, release of mediators, and participation in neutrophil extracellular trap formation. They are implicated in diseases like atherosclerosis, rheumatoid arthritis, and sepsis, highlighting their interaction with immune cells as pivotal in the onset and resolution of inflammation. Platelets are central to regulating inflammation, offering new therapeutic targets for inflammatory diseases. Future research should explore specific molecular pathways of platelets in inflammation for therapeutic intervention.

Comparative analysis of the intestinal flora of BmNPV-resistant and BmNPV-sensitive silkworm varieties.

Bombyx mori nucleopolyhedrovirus (BmNPV) is a very common and infectious virus that affects silkworms and hinders silk production. To investigate the intestinal flora of BmNPV-resistant and BmNPV-sensitive silkworm varieties, 16 S rDNA high-throughput sequencing was performed. The results of the cluster analysis showed that the intestinal flora of the resistant silkworm variety was more abundant than that of the sensitive silkworm variety. This was found even when infection with BmNPV caused a sharp decline in the number of intestinal floral species in both resistant and sensitive silkworm varieties. The abundances of the intestinal flora, including Aureimonas, Ileibacterium, Peptostreptococcus, Pseudomonas, Enterococcus, and Halomonas, in the resistant variety were considerably greater after infection with BmNPV than those in the sensitive variety. After infection with BmNPV, four kinds of important intestinal bacteria, namely, f_Saccharimonadaceae, Peptostreptococcus, Aureirmonas, and f_Rhizobiaceae, were found in the resistant silkworm variety. In the sensitive silkworm variety, only Faecalibaculum was an important intestinal bacterium. The differential or important bacteria mentioned above might be involved in immunoreaction or antiviral activities, especially in the intestines of BmNPV-resistant silkworms. By conducting a functional enrichment analysis, we found that BmNPV infection did not change the abundance of important functional components of the intestinal flora in resistant or sensitive silkworm varieties. However, some functional factors, such as the biosynthesis, transport, and catabolism of secondary metabolites (e.g., terpenoids and polyketides) and lipid transport and metabolism, were more important in the resistant silkworm variety than in the sensitive variety; thus, these factors may increase the resistance of the host to BmNPV. To summarize, we found significant differences in the composition, abundance, and function of the intestinal flora between resistant and sensitive silkworm varieties, especially after infection with BmNPV, which might be closely related to the resistance of resistant silkworm varieties to BmNPV.

Selenium deficiency-induced high concentration of reactive oxygen species restricts hypertrophic growth of skeletal muscle in juvenile zebrafish by suppressing TORC1-mediated protein synthesis.

Se deficiency causes impaired growth of fish skeletal muscle due to the retarded hypertrophy of muscle fibres. However, the inner mechanisms remain unclear. According to our previous researches, we infer this phenomenon is associated with Se deficiency-induced high concentration of reactive oxygen species (ROS), which could suppress the target of rapamycin complex 1 (TORC1) pathway-mediated protein synthesis by inhibiting protein kinase B (Akt), an upstream protein of TORC1. To test this hypothesis, juvenile zebrafish (45 d post-fertilisation) were fed a basal Se-adequate diet or a basal Se-deficient diet or them supplemented with an antioxidant (DL-α-tocopherol acetate, designed as VE) or a TOR activator (MHY1485) for 30 d. Zebrafish fed Se-deficient diets exhibited a clear Se-deficient status in skeletal muscle, which was not influenced by dietary VE and MHY1485. Se deficiency significantly elevated ROS concentrations, inhibited Akt activity and TORC1 pathway, suppressed protein synthesis in skeletal muscle, and impaired hypertrophy of skeletal muscle fibres. However, these negative effects of Se deficiency were partly (except that on ROS concentration) alleviated by dietary MHY1485 and completely alleviated by dietary VE. These data strongly support our speculation that Se deficiency-induced high concentration of ROS exerts a clear inhibiting effect on TORC1 pathway-mediated protein synthesis by regulating Akt activity, thereby restricting the hypertrophy of skeletal muscle fibres in fish. Our findings provide a mechanistic explanation for Se deficiency-caused retardation of fish skeletal muscle growth, contributing to a better understanding of the nutritional necessity and regulatory mechanisms of Se in fish muscle physiology.

Hepatic transcriptome analysis reveals the metabolic strategies of largemouth bass (Micropterus salmoides) under different dissolved oxygen condition.

Dissolved oxygen (DO) affects aquatic animals at a fundamental level so that the differences in its metabolic strategies under prolonged hypoxic conditions need an urgent exploration. In this experiment, largemouth bass (Micropterus salmoides) were chronically exposed (6 weeks) to severe hypoxia (S-HYP, DO: 2.0 ± 0.4 mg/L) and mild hypoxia (M-HYP, DO: 5.1 ± 0.4 mg/L). Compared to the control group (CON, DO:8.4 ± 0.4 mg/L), 1196 and 232 differentially expressed genes (DEGs) were obtained in S-HYP and M-HPY groups via transcriptome analysis, respectively. In S-HYP, lipolysis was promoted while anabolism was blocked. Meanwhile, significantly less fat droplet area was observed in the liver histology of S-HYP. Additionally, the cell cycle also responded to hypoxia, being blocked in the G1 phase with the suspension of DNA replication process. In M-HYP, the processing of protein in the endoplasmic reticulum and the synthesis of various aminoacyl t-RNA were inhibited, and a novel balance of the urea cycle might be established in the biosynthesis of arginine. The key DEGs involved in the above metabolic pathways, such as atgl, cpt1, arg1, etc., were validated by Q-PCR yielding results consistent with transcriptome data. This study indicates that the largemouth bass is prone to increase the proportion of lipid as an energy supply to adapt to the reprogramming of energy metabolism, while reducing the rate of cell proliferation to adapt to chronic severe hypoxia. This is also an undescribed observation in fish liver metabolism that largemouth bass may transform the synthesis and processing strategies of protein when exposed to chronic mild hypoxia.

Mixed infection of an emaravirus, a crinivirus, and a begomovirus in Pueraria lobata (Willd) Ohwi.

Pueraria lobata (Willd) (Pueraria montana var. lobata (Willd.) Maesen & S. M. Almeida ex Sanjappa & Predeep) is an important herbal medicine used in many countries. In P. lobata plants showing symptoms of mosaic, yellow spots, and mottling, mixed infection of new viruses provisionally named Pueraria lobata-associated emaravirus (PloAEV, genus Emaravirus), Pueraria lobata-associated crinivirus (PloACV, genus Crinivirus), and isolate CQ of the previously reported kudzu mosaic virus (KuMV-CQ, genus Begomovirus) was confirmed through high-throughput sequencing. PloAEV has five RNA segments, encoding a putative RNA-dependent RNA polymerase, glycoprotein precursor, nucleocapsid protein, movement protein, and P5, respectively. PloACV has two RNA segments, encoding 11 putative proteins. Only PloAEV could be mechanically transmitted from mixed infected symptomatic kudzu to Nicotiana benthamiana plants. All three viruses were detected in 35 symptomatic samples collected from five different growing areas, whereas no viruses were detected in 21 non-symptomatic plants, suggesting a high association between these three viruses. Thus, this study provides new knowledge on the diversity and molecular characteristics of viruses in P. lobata plants affected by the viral disease.

Selenium Status Affects Hypertrophic Growth of Skeletal Muscle in Growing Zebrafish by Mediating Protein Turnover.

BACKGROUND: Selenium (Se) status is closely related to skeletal muscle physiological status. However, its influence on skeletal muscle growth has not been well studied. OBJECTIVES: This study aimed to analyze the impacts of overall Se status (deficient, adequate, and high) on skeletal muscle growth using a growing zebrafish model. METHODS: Zebrafish (1.5-mo-old) were fed graded levels of Se (deficient: 0.10 mg Se/kg; marginally deficient: 0.22 mg Se/kg; adequate: 0.34 mg Se/kg; high: 0.44, 0.57, and 0.69 mg Se/kg) as Se-enriched yeast for 30 d. Zebrafish growth, and Se accumulation, selenoenzyme activity, selenotranscriptome profiles, and oxidative status in the whole body, and selenotranscriptome profiles, histological characteristics, biochemicals, and gene and protein expression profiles related to muscle growth in the skeletal muscle were analyzed by model fitting and/or 1-factor ANOVA. RESULTS: Se status biomarkers within the whole body and skeletal muscle indicated that 0.34 mg Se/kg was adequate for growing zebrafish. For biomarkers related to skeletal muscle growth, compared with 0.34 mg Se/kg, 0.10 mg Se/kg decreased the white muscle cross-sectional area (WMCSA) and the mean diameter of white muscle fibers (MDWMF) by 14.4%-15.1%, inhibited protein kinase B-target of rapamycin complex 1 signaling by 63.7%-68.5%, and stimulated the autophagy-lysosome pathway by 1.07 times and the ubiquitin-proteasome pathway (UPP) by 96.0% (P < 0.05), whereas 0.22 mg Se/kg only decreased the WMCSA by 7.8% (P < 0.05); furthermore, 0.44 mg Se/kg had no clear effects on skeletal muscle biomarkers, whereas 0.57-0.69 mg Se/kg decreased the WMCSA and MDWMF by 6.3%-25.9% and 5.1%-21.3%, respectively, and stimulated the UPP by 2.23 times (P < 0.05). CONCLUSIONS: A level of 0.34 mg Se/kg is adequate for the growth of zebrafish skeletal muscle, whereas ≤0.10 and ≥0.57 mg Se/kg are too low or too high, respectively, for maintaining efficient protein accretion and normal hypertrophic growth.

Mulberry (Morus alba) is a new natural host of Citrus leaf blotch virus in China.

Mulberries (Morus spp., family Moraceae) are economically important deciduous woody plants. Their leaves are food for silkworms, and both the fruits and leaves have nutritional and medicinal values (Qin et al. 2012). The plants are widely distributed globally and have been cultivated in China for more than 5,000 years (Xie et al. 2014). In April 2019, virus-like symptoms of chlorotic leaf spots and, occasionally witches' broom were observed in trees of white mulberry (M. alba) in Shapingba district of Chongqing province. To investigate if any potential viral agent is associated with the symptoms, total RNA was extracted from leaves of one symptomatic tree using an RNAprep Pure Plant Plus Kit (TianGen, China). Ribosomal RNAs were depleted using a TruSeq RNA Sample Prep Kit (Illumina, USA), and the depleted RNA was used for construction of a cDNA library for sequencing using an Illumina HiSeq X-ten platform with pair-ended reads length layout 150 bp. Adaptors, low-quality reads and mulberry genomes-derived reads (He et al. 2013) were removed from a total of 25,433,798 reads using the CLC Genomics Workbench 11 (Qiagen, USA) and the clean reads of 936,562 were subjected to de novo assembly that generated 4,278 contigs (200-3,862 bp). These sequences were annotated by Blastx searches to local Viruses_NR and viroid datasets downloaded from GenBank. Finally, except three contigs (3,862 nt, 1,950 nt, and 1,179 nt) with 81.4-90% nucleotide sequence identities to citrus leaf blotch virus (CLBV, genus Citrivirus, family Betaflexiviridae), no other contigs were identified as viral-related. Total clean reads of 113,185 were mapped to the viral contigs with average coverage depth of 1,915, suggesting the presence of CLBV in the symptomatic tree. To recover the complete genome of CLBV, overlapping fragments were amplified by RT-PCR using virus-specific primer pairs. The 5' and 3' termini were determined by rapid amplification of cDNA ends (RACE kit, Invitrogen, USA). Five clones per amplicon were sequenced in two directions (Cao et al. 2018). The complete genome of the mulberry strain of CLBV (CLBV-ML, GenBank accession no. MT767171) is 8,776 nucleotides (nt) in length, excluding the poly (A) tail. CLBV-ML is similar to extant CLBV isolates in genome structure. BLASTn analysis showed that CLBV-ML had highest nucleotide sequence identities of 79.65-81.56% with Actinidia isolates (Liu et al. 2019) of CLBV at the whole genome. Phylogenetic analysis also placed it with the Actinidia isolates, indicating they are closely related. Thus, CLBV-ML is a highly divergent strain of CLBV. To study the occurrence of CLBV-ML, a total of 62 mulberry samples (42 with similar symptoms and 20 without symptoms) were randomly collected from Shapingba and tested by conventional RT-PCR using an isolate-specific primer pair (CLBV-F7182: ACCAATGACAATGCCACA; CLBV-R7857: TTATGAAACTCTTCCCACTT) designed in the CP gene to amplify a 676 bp fragment. The virus was detected in 37 symptomatic trees (88%) and 2 (10%) asymptomatic trees, suggesting the association of CLBV-ML with the symptoms. To the best of our knowledge, this is the first report of CLBV infection in mulberry which expands the host range of CBLV.

Identification and Characterization of Two Novel Geminiviruses Associated with Paper Mulberry (Broussonetia papyrifera) Leaf Curl Disease.

Paper mulberry (Broussonetia papyrifera) is a perennial woody plant used as source material for Cai Lun paper making, in traditional Chinese medicine, and as livestock feed. To identify the presence of viruses in paper mulberry plants affected by a disease with leaf curl symptoms, high-throughput sequencing of total RNA was performed. Analysis of transcriptome libraries allowed the reconstruction of two geminivirus-like genomes. Rolling-circle amplification and PCR with back-to-back primers confirmed the presence of two geminiviruses with monopartite genomes in these plants, with the names paper mulberry leaf curl virus 1 and 2 (PMLCV-1 and PMLCV-2) proposed. The genomes of PMLCV-1 (3,056 nt) and PMLCV-2 (3,757 to 3,763 nt) encode six proteins, with the V4 protein of PMLCV-1 and the V3 proteins of both viruses having low similarities to any known protein in databases. Alternative splicing of an intron, akin to that of mastre-, becurto-, capula-, and grabloviruses, was identified by small RNA (sRNA)-seq and RNA-seq reads mapping to PMLCV-1 and PMLCV-2 antisense transcripts. Phylogenetic analyses and pairwise comparisons showed that PMLCV-1 and PMLCV-2 are most closely related to, but distinct from, two unassigned geminiviruses, citrus chlorotic dwarf associated virus and mulberry mosaic dwarf associated virus, suggesting that they are two new members of the family Geminiviridae. Field investigation confirmed the close association of the two viruses with leaf curl symptoms in paper mulberry plants and that coinfection can aggravate the symptoms.