[Meta-analysis of the clinical efficacy of live bifidobacterium bacteria preparation combined with entecavir in the treatment of hepatitis B virus-related cirrhosis].

Objective: To systematically evaluate the efficacy of live Bifidobacterium preparations combined with entecavir in the treatment of hepatitis B virus-related cirrhosis. Methods: PubMed, Web of Science, CNKI, Wanfang, VIP, and other databases were searched electronically until October 2020. Randomized controlled clinical trials in the treatment of hepatitis B virus-related cirrhosis with live Bifidobacterium preparations combined with entecavir were included for statistical analysis. The relative risk (RR) was used as the effect size for the count data. Measurement data were expressed as mean difference (MD) or standardized mean difference (SMD) to represent the effect size. 95% confidence intervals (95% CI) were calculated for each effect size. The I2 statistic and P-values were used to evaluate the heterogeneity of the included literature. The fixed effect model was used for analysis if I (2)≤50%, P > 0.1; otherwise, the random effect model was used for meta-analysis. Results: A total of 865 patients from nine studies were included. Among them, 434 cases were in the live Bifidobacterium preparation combined with the entecavir treatment group and 431 cases in the entecavir group. The results showed that compared with the entecavir group, the live bifidobacterium preparation combined with the entecavir treatment group had significantly reduced the four indicators of liver fibrosis: serum hyaluronic acid (HA) (SMD = -1.87 ng/ml, 95%CI: -2.32 ~ 1.41, P < 0.01), laminin (LN) (SMD = -1.62 ng/ml, 95%CI: -2.04 ~ 1.19, P < 0.01), type III procollagen peptide (PC-III) (SMD = -0.98, 95%CI: -1.26 ~ 0.7, P < 0.01), type IIIcollagen (III-C) (SMD = -1.14 ng/ml, 95%CI: -1.73 ~ 0.55, P < 0.01), portal vein diameter (SMD = -0.91 mm, 95% CI: -1.27 ~ 0.55, P < 0.01) and spleen thickness (MD = -3.26mm, 95%CI: -3.95 ~ 2.58, P < 0.01). However, there was no statistically significant difference in the negative conversion rate of hepatitis B virus DNA (HBV DNA) between the two groups of patients. Conclusion: Compared to the entecavir treatment group, the live Bifidobacterium preparation combined with entecavir showed apparent severity improvement and enhanced clinical efficacy in patients with hepatitis B virus-related cirrhosis.

Molecular and Morphological Characterization of The Root -lesion Nematode, Pratylenchus Neglectus, on Corn from Henan Province of China.

Root-lesion nematodes, Pratylenchus spp., are economically important pathogens because of their detrimental and economic impact on a wide range of crops. In August 2018, two samples of both roots and rhizosphere soil were collected from a corn field in Liangyuanqu of Shangqiu city, Henan Province, China. Root-lesion nematodes were recovered from the roots and soil samples using the modified Baermann funnel extraction method. Both the morphological characters and molecular analysis of the internal transcribed spacer (ITS) and D2-D3 expansion region of 28S ribosomal RNA sequences confirmed that the root-lesion nematode population collected from corn in this study was P. neglectus. Phylogenetic analyses showed that this isolate formed a highly supported clade with other P. neglectus isolates. To the best of our knowledge, this is the first report of P. neglectus on corn in Henan Province of China. This study reports the first partial sequences of 28S D2-D3 region of P. neglectus on corn in China. Due to the great harmfulness of root-lesion nematodes to corn, care should be taken to prevent the spread of P. neglectus to other regions in China. At the same time, further study on the biological characteristics of P. neglectus is needed, which will be helpful to develop corresponding management and control strategies.

[Mechanism of androgen in improving erectile dysfunction in castrated rats by regulating androgen receptor/vascular endothelial growth factor].

Objective: To explore the mechanism of androgen in improving erectile dysfunction in castrated rats. Methods: Forty 8-week-old male Sprague-Dawley (SD) rats were randomly divided into 4 groups:normal control group (Group A); castration group (Group B, in which rats were castrated); intervention groups (group C and D), in which rats were treated with different concentrations of testosterone undecanoate orally every day at 10 mg/kg (low dose) and 20 mg/kg (high dose), respectively after being castrated. Animals in group A and B were given 0.9% NS instead. After 8-week treatment, the level of serum testosterone, intra cavernous pressure (ICP) and mean arterial pressure (MAP) were detected, and the expression of androgen receptor (AR)and vascular endothelial growth factor (VEGF) were detected in the penis by Immunohistochemistry and Western blot. Results: The level of serum testosterone was significantly lower in group B [(1.3±0.6) nmol/L] than in group A [(17.1±1.5) nmol/L] (P<0.05).After testosterone supplementation, serum testosterone levels in group C [(8.7±1.2) nmol/L] and group D [(15.5±1.6) nmol/L] were higher than that in group B (all P<0.05). Max ICP/MAP of group C and D were higher than that in group B (all P<0.05). Immunohistochemistry and Western blot showed that the expression levels of AR and VEGF in group B were significantly lower than those in group A, C and D, and group D > group C (all P<0.05). Conclusion: Androgen replacement therapy with testosterone undecanoate can improve the erectile function of castrated rats by protecting the integrity of endothelial cells through AR/VEGF pathway.

[Clinical investigation of ultrasound-guided percutaneous nephrolithotomy accessed by SVOF-principle and two-step puncture techniques].

Objective: To evaluate the safety and effectiveness of ultrasound-guided percutaneous nephrolithotomy (PCNL) accessed by SVOF-principle and two-step puncture techniques. Methods: A total of 838 cases with upper urinary stones underwent percutaneous nephrolithotomy successfully accessed by ultrasound-guided between June 2007 and December 2015 at Department of Urology, Tongji Hospital, Tongji Medical College, Huazhong University of Science and Technology. Of all cases were divided in two groups: hydronephrosis calyces puncture group include 425 cases and SVOF-principle puncture group include 413 cases. The access establishment time, operation time, stone free rate (SFR), postoperative complications, and postoperative hospitalization time between the two groups we compared by t test or χ2 test. Results: Statistically significant differences were observed between hydronephrosis calyces puncture group and SVOF-principle puncturegroup in the first access establishment time ((16.5±8.4) minutes vs. (11.2±5.9) minutes, t=3.931, P=0.013), one-stage SFR (74.3% vs. 85.7%, χ2=16.868, P=0.000), postoperative hospitalization time ((6.4±2.1) days vs. (4.8±1.8)days, t=4.574, P=0.000), transfusion rate (7.1% vs. 2.9%, χ2=8.027, P=0.006), and embolization rate (3.3% vs. 1.0%, χ2=5.390, P=0.020). There were no statistically significant differences in operation time, total SFR, postoperative fever and sever infection between these two groups (all P>0.05). In both two groups, no serious complications such as peripheral organ injury and death occurred. Conclusions: PCNL accessed guided by ultrasound with SVOF-principle and two-step puncture techniques has advantages of quick puncture location, high stone free rate, fewer complications and fast recovery. This technique is an effective and safe treatment option for upper urinary stones and deserved promotion and application in clinic.

KDM2B/FBXL10 targets c-Fos for ubiquitylation and degradation in response to mitogenic stimulation.

KDM2B (also known as FBXL10) controls stem cell self-renewal, somatic cell reprogramming and senescence, and tumorigenesis. KDM2B contains multiple functional domains, including a JmjC domain that catalyzes H3K36 demethylation and a CxxC zinc-finger that recognizes CpG islands and recruits the polycomb repressive complex 1. Here, we report that KDM2B, via its F-box domain, functions as a subunit of the CUL1-RING ubiquitin ligase (CRL1/SCF(KDM2B)) complex. KDM2B targets c-Fos for polyubiquitylation and regulates c-Fos protein levels. Unlike the phosphorylation of other SCF (SKP1-CUL1-F-box)/CRL1 substrates that promotes substrates binding to F-box, epidermal growth factor (EGF)-induced c-Fos S374 phosphorylation dissociates c-Fos from KDM2B and stabilizes c-Fos protein. Non-phosphorylatable and phosphomimetic mutations at S374 result in c-Fos protein which cannot be induced by EGF or accumulates constitutively and lead to decreased or increased cell proliferation, respectively. Multiple tumor-derived KDM2B mutations impaired the function of KDM2B to target c-Fos degradation and to suppress cell proliferation. These results reveal a novel function of KDM2B in the negative regulation of cell proliferation by assembling an E3 ligase to targeting c-Fos protein degradation that is antagonized by mitogenic stimulations.

Association between variants of IL-8 and IL-10 genes, and efficacy of transcatheter arterial chemoembolization and subsequent prognosis in patients with liver cancer.

OBJECTIVE: Our objective was to examine the association between single nucleotide polymorphisms of interleukin (IL)-8 (rs4073 and rs2227306) and IL-10 (rs1800871 and rs1800872) genes, and clinical effects of transcatheter arterial chemoembolization (TACE) and subsequent prognosis in patients with liver cancer. PATIENTS AND METHODS: 115 patients with liver cancer underwent TACE. Venous blood specimens were collected for genomic DNA extraction. The restriction fragment length polymorphism-polymerase chain reaction (RFLP-PCR) analysis was used to detect the above variants of IL-8 and IL-10 genes. In addition, blood levels of alpha fetal protein (AFP) were quantified by radioimmunoassay. Patients were followed up to uncover the association of the above genotypes with treatment efficacy and survival. RESULTS: Patients with the homozygous genotype AA or homozygous genotype TT (respectively, -251 and +781 sites) of IL-8 gene, and wild-type genotype TT or homozygous genotype AA (respectively, -819 and -592 sites) of IL-10 gene showed the best effectiveness of TACE. Furthermore, these patients also exhibited the lowest AFP levels and the longest survival after the treatment. CONCLUSIONS: Clinical efficacy of TACE and patient survival in liver cancer are associated with specific variants of IL-8 and IL-10 genes.

First Report of Fusarium pseudograminearum Causing Crown Rot of Wheat in Henan, China.

Fusarium pseudograminearum (O'Donnell & Aoki), a residue-borne pathogen, is responsible for crown rot of wheat (Triticum aestivum L.). Since its first detection in Queensland, Australia in 1951, it has been reported in many other countries, but not China (2). In May 2011, a crown rot disease was observed in wheat cv. Aikang 58 in a wheat-maize rotation, irrigable and loam field in Henan Province, China. Diseased wheat plants showed honey brown discoloration in the stem bases and whitehead in some plants, which are symptoms of crown rot with about 70% incidence in a surveyed field (2). The pathogen was isolated from diseased stem base on potato dextrose agar (PDA) after being surface-disinfested with 5% NaClO solution for 2 min. Pure cultures were established on carnation leaf agar (CLA) through a single spore technique and identified by morphological and molecular methods according to protocols described previously (1,3,4). Macroconidia of F. pseudograminearum were formed in abundant sporodochia on CLA cultures grown under the BLB light. Macroconidia were usually five septate (about three to seven) and 27 to 91 × 2.7 to 5.5 µm. Colonies grown on PDA from a single conidium in the dark at 25°C had average radial growth rates of ~4.7 to 9.9 mm per day. Colony pigment on PDA grown under light varied from rose to burgundy, while mycelium ranged from rose to yellow white. Two isolates (WZ-8A and WZ-2B) were selected for molecular identification. The translation elongation factor 1-α gene and rDNA ITS gene were amplified by PCR using the specific primers described previously (4). PCR products were sequenced (GenBank Accession Nos. JN862232 to JN862235). Phylogenic analysis of the sequence indicated that the isolates were identified as F. pseudograminearum. The identification was further confirmed by the F. pseudograminearum species-specific PCR primers (Fp1-1: CGGGGTAGTTTCACATTTCCG and Fp1-2: GAGAATGTGATGACGACAATA) (1). The expected PCR products of 520 bp were produced only in F. pseudograminearum. Isolates WZ-2B and WZ-8A were deposited in the Agriculture Culture Collection of China as ACCC38067 and ACCC 38068, respectively. Pathogenicity tests were conducted by inoculating winter wheat cultivar Wenmai 19 with isolates WZ-8A and WZ-2B through soil inoculation. Inoculum was prepared by growing cultures on sterilized wheat bran and chopped wheat-straw (4:1, v/v) after incubation at 25°C for 2 weeks. This inoculum was added to sterilized soil at 1% by volume and no inoculum was added in control treatment. Five seeds were planted in a 15 cm wide pot in a 20 to 25°C greenhouse, with six replications. Seedling death and crown browning occurred in the inoculated wheat plants after 4 weeks with over 90% incidence, while no symptoms developed in the control plants. The fungus was reisolated from inoculated plants, fulfilling Koch's postulates. To our knowledge, this is the first report of F. pseudograminearum causing crown rot of wheat in China. Considering Henan is the largest wheat production province in China with over 5 million hectares planting area, and the soil and climate conditions are suitable for this disease, it will be a important pathogen of wheat in Henan in the future. References: (1) T. Aoki et al. Mycologia 91:597, 1999. (2) L. W. Burgess. Page 271 in: Crown Rot of Wheat: Fusarium. B. A. Summerell et al., eds. APS Press, St. Paul, MN, 2001. (3) R. G. Francis et al. Trans. Brit. Mycol. Soc. 68:421, 1977. (4) J. B. Scott et al. Mycol. Res. 110:1413, 2006.

First Record of the Cereal Cyst Nematode Heterodera filipjevi in China.

Cereal cyst nematode (CCN) is now recognized as a widespread and often damaging parasite of wheat in China. Only Heterodera avenae has been reported in China (4). However, molecular analysis of four samples from Beijing and one from Shanxi Province indicated genetic differences from H. avenae and other named species (3). Here we report the detection of H. filipjevi at a site in Henan Province that was not included in any previous study or report. The infested crop was rainfed winter wheat (Triticum aestivum) cv. Wenmai 19 in a field near Banpopu Village in Xuchang County (34.0447°N, 113.7415°E) with a long-established maize-wheat semiannual crop rotation. During the winter growing season, the crop was patchy with uneven growth and cyst nematode females were observed on the roots. In June 2009, soil was collected and mature cysts were extracted for morphological and molecular identification. Cysts were also kept at 4°C for 2 months and then incubated in shallow water at 15°C for a month to obtain second-stage juveniles (J2). Measurements (range; mean ± sd) of 10 cysts were body length including neck (569 to 786 µm; 699 ± 56), body width (403 to 600 µm; 523 ± 55), length:width ratio (1.3 to 1.5; 1.3 ± 0.1), neck length (61 to 125 µm; 106 ± 19) and width (49 to 83 µm; 69 ± 13), fenestra length (52 to 59 µm; 57 ± 2.9) and width (24.5 to 34.4; 27.9 ± 3.5), underbridge (64 to 101 µm; 85 ± 10), and vulval slit (7.4 to 10.0 µm; 9.6 ± 1.0). Lemon-shaped cysts were brown with a surface zigzag pattern. The vulval cone was bifenestrate with horseshoe-shaped semifenestra, with heavy underbridge and many bullae. The J2 (n = 22) measurements were body length (496 to 590 µm; 552 ± 24), body width (20.0 to 23.8; 21.5 ± 0.9), stylet (22.8 to 25.3; 24.0 ± 1.0) with anchor-shaped basal knobs, tail (47 to 64; 61.6 ± 4.4), and hyaline tail terminus (32 to 43; 40.2 ± 3.0). The J2 had up to four lateral lines, but the inner two were often the only lines clearly visible, and the shape of the stylet knobs, tail, and tail terminus were consistent with H. filipjevi. All morphological data and characters were consistent with H. filipjevi (1). Specimens have been lodged with the Australian National Insect Collection. DNA from single cysts was extracted to amplify the internal transcribed spacer region of rDNA by PCR with forward primer TW81 (5'-GTTTCCGTAGGTGAACCTGC-3') and reverse primer AB28 (5'-ATATGCTTAAGTTCAGCGGGT-3') (2). The PCR product was sequenced (Genbank Accession No. HM027892) and digested by restriction enzymes (AluI, CfoI, HaeI, HinfI, PstI, RsaI, TaqI, and Tru9I) to obtain restriction fragment length polymorphism profiles (2). Profiles for the Xuchang population consistently matched those published for H. filipjevi and were distinct from those of H. avenae and other species (3). Phylogenic analysis of the sequence further indicated conspecificity with H. filipjevi. These morphological and molecular data confirmed that the specimens from Xuchang were H. filipjevi, which represents the first detection of H. filipjevi in China, and extends the known distribution of the species from Europe, North America, South Asia, and West Asia to East Asia. This finding adds complexity to the management of CCN in China, especially for control by host resistance, which now must consider both species and pathotype diversity. References: (1) Z. A. Handoo. J. Nematol. 34:250, 2002. (2) S. A. Subbotin et al. Nematology 2:153, 2000. (3) S. A. Subbotin et al. Nematology 5:515, 2003. (4) H. X. Yuan et al. Australas. Plant Pathol. 39:107, 2010.

Baseline concentrations and spatial distribution of trace metals in surface soils of Guangdong province, China.

A total of 260 surface soil samples were collected to investigate the spatial distribution of trace metals in Guangdong province, one of the fast developing regions in China. The results show that the upper baseline concentrations of Cu, Pb, Zn, Cd, Ni, Cr, and Hg were 28.7, 57.6, 77.8, 0.13, 23.5, 87.0, and 0.15 mg kg(-1), respectively. Regional parent materials and pedogenesis are the primary factors influencing the concentrations of trace metals, and various anthropogenic activities are the second most important factors. The spatial distribution of trace metals is correlated to the geological characters with high concentrations of trace metals always located in regional fault areas, basins, and the Pearl River Delta alluvial plain and to the low concentrations associated with the other areas in Guangdong province.

Spatial distributions and potential risk analysis of total soil selenium in Guangdong Province, China.

A total of 260 soil profiles were examined to investigate the spatial distribution of total soil selenium (Se) in Guangdong province, China. In the investigated area, the soil Se concentrations follow an approximately lognormal distribution. The soil Se geometric mean concentration of 0.23 mg kg(-1) is higher than that of Chinese soils; however, Se concentration varies over the study area. The baseline concentration of 0.13 to 0.41 mg kg(-1) indicates that the soil Se concentration is mostly in the range of deficiency to medium level for surface soils in Guangdong province. In A-, B-, and C-horizon, soil Se spatial distribution is correlated with the nature of the parent material, with high Se concentration mainly located in limestone and sandshale areas and low Se concentration associated with purple shale and granite areas. The spatial distribution pattern of soil Se concentrations suggests that potential Se deficiency may be an issue for human health in this province. Moreover, due to soil degradation and erosion, calculated soil Se exported into surrounding waters could reach approximately 23,000 kg yr(-1) in the study area.

Spatial distribution and vertical variation of arsenic in Guangdong soil profiles, China.

Total of 260 soil profiles were reported to investigate the arsenic spatial distribution and vertical variation in Guangdong province. The arsenic concentration followed an approximately lognormal distribution. The arsenic geometric mean concentration of 10.4 mg/kg is higher than that of China. An upper baseline concentration of 23.4 mg/kg was estimated for surface soils. The influence of soil properties on arsenic concentration was not important. Arsenic spatial distributions presented similar patterns that high arsenic concentration mainly located in limestone, and sandshale areas, indicating that soil arsenic distribution was dependent on bedrock properties than anthropogenic inputs. Moreover, from A- to C-horizon arsenic geometric mean concentrations had an increasing tendency of 10.4, 10.7 to 11.3 mg/kg. This vertical variation may be related to the lower soil organic matter and soil degradation and erosion. Consequently, the soil arsenic export into surface and groundwaters would reach 1040 t year-1 in the study area.

In situ and in vitro study of colocalization and segregation of alpha-synuclein, ubiquitin, and lipids in Lewy bodies.

alpha-Synuclein and ubiquitin are two Lewy body protein components that may play antagonistic roles in the pathogenesis of Lewy bodies. We examined the relationship between alpha-synuclein, ubiquitin, and lipids in Lewy bodies of fixed brain sections or isolated from cortical tissues of dementia with Lewy bodies. Lewy bodies exhibited a range of labeling patterns for alpha-synuclein and ubiquitin, from a homogeneous pattern in which alpha-synuclein and ubiquitin were evenly distributed and overlapped across the inclusion body to a concentric pattern in which alpha-synuclein and ubiquitin were partially segregated, with alpha-synuclein labeling concentrated in the peripheral domain and ubiquitin in the central domain of the Lewy body. Lipids represented a significant component in both homogeneous and concentric Lewy bodies. These results suggest that Lewy bodies are heterogeneous in their subregional composition. The segregation of alpha-synuclein to Lewy body peripheral domain is consistent with the hypothesis that alpha-synuclein is continually deposited onto Lewy bodies.