Ginkgo biloba extract ameliorates hyperglycaemia-induced enteric glial cell injury via regulation of the TLR2-related pathway.

BACKGROUND: Diabetic gastrointestinal dysfunction (DGD) is a common complication in diabetic patients, and enteric glial cells (EGCs) found in the gastrointestinal tract have been shown to play an essential role in gastrointestinal dysfunction. Thus, targeting EGCs may be helpful for the control of DGD. This study aimed to evaluate the protective effect of Ginkgo biloba extract (GBE) from G. biloba dropping pills against hyperglycaemic stress-induced EGCs injury and its underlying mechanism. METHODS: In vitro, the protective effect of GBE on CRL-2690 cells was evaluated by MTT assay and TUNEL assay. The expression of related markers was evaluated by RNA sequencing and validated by using western blotting. In vivo, STZ-induced C57BL/6J WT mice were used as models to evaluate the effects of GBE on blood glucose, body weight, and EGCs' activity and relevant signalling pathways were validated by immunofluorescence. RESULTS: The results showed that GBE (25 µg/ml) treatment significantly attenuated hyperglycaemic stress-induced cytotoxicity and cell apoptosis in CRL-2690 cells, which was verified in an STZ-induced (100 mg/kg, 3 days) diabetic mouse model with continuous GBE administration (25/100 mg/kg/day, 6/12 weeks). Further mechanistic study based on transcriptomic data revealed that GBE exerted its beneficial effect by regulating immune-related pathways, and TLR2/BTK/NF-κB/IL-1α/IL-10 comprised the main targets of this drug. CONCLUSIONS: This study demonstrates the protective effect of GBE against hyperglycaemic stress-induced EGCs injury using both in vitro and in vivo models and further reveals that the effect was achieved by targeting TLR2 and its downstream molecules BTK/NF-κB/IL-1α/IL-10. This study may be helpful for expanding the clinical application of GBE in treating DGD.

Ultrasound characteristics of the cervical vagus nerve in patients with type 2 diabetes and diabetic peripheral neuropathy.

INTRODUCTION: Diabetic peripheral neuropathy (DPN) and autonomic neuropathy are commonly coexistent in patients with type 2 diabetes mellitus (T2DM). Current assessment tools for diabetic neuropathy remain complicated and limited. We aimed to investigate the sonographic changes of the cervical vagus nerve in DPN patients with T2DM. MATERIAL AND METHODS: Patients with T2DM were divided into a DPN group (DPN, n = 44) and non-DPN controls (NDPN, n = 43) based on electromyogram results. Another 43 healthy controls (CON) were included. High-frequency ultrasound (HFU) of the vagus nerve was performed in all participants. RESULTS: Compared with controls, the honeycomb structure of the vagus nerve in patients with T2DM decreased, p < 0.001. The DPN group had higher cross-sectional area (CSA) of the right vagus nerve than the NDPN group (1.60 ± 0.52 vs. 2.00 ± 0.57 mm2, p =0.001). Logistic regression showed that right vagus nerve CSA was a risk factor of DPN (odds ratio [OR] = 3.924, p = 0.002). Right vagus nerve CSA was positively correlated with diabetes duration (p = 0.003), and negatively correlated with the motor conduction velocity (MCV) of the ulnar, median, and common peroneal nerves (p < 0.001 for all), as well as the sensor conduction velocity (SCV) of the ulnar and median nerve (both p < 0.005). CONCLUSION: HFU shows thickening of the cervical vagus nerve in patients with DPN, which is a potential diagnostic feature of diabetic neuropathy.

Two novel variations in LRP2 cause Donnai-Barrow syndrome in a Chinese family with severe early-onset high myopia.

Donnai-Barrow syndrome (DBS) is a rare autosomal recessive disorder caused by mutation in the low density lipoprotein receptor-related protein 2 gene (LRP2). Defects in this protein may lead to clinical multiple organ malformations by affecting the development of organs such as the nervous system, eyes, ears, and kidneys. Although some variations on LRP2 have been found to be associated with DBS, early diagnosis and prevention of patients with atypical DBS remains a challenge for many physicians because of their clinical heterogeneity. The objective of this study is to explore the association between the clinical presentation and the genotype of a DBS patient who was initially diagnosed with early-onset high myopia (eoHM) from a healthy Chinese family. To this end, we tested the patient of this family via whole exome sequencing and further verified the results among other family members by Sanger sequencing. Comprehensive ophthalmic tests as well as other systemic examinations were also performed on participants with various genotypes. Genetic assessment revealed that two novel variations in LRP2, a de novo missense variation (c.9032G>A; p.Arg3011Lys) and a novel splicing variation (c.2909-2A>T) inherited from the father, were both carried by the proband in this family, and they are strongly associated with the typical clinical features of DBS patients. Therefore, in this paper we are the first to report two novel compound heterozygous variations in LPR2 causing DBS. Our study extends the genotypic spectrums for LPR2-DBS and better assists physicians in predicting, diagnosing, and conducting gene therapy for DBS.

New pathogenic variants of ALMS1 gene in two Chinese families with Alström Syndrome.

PURPOSE: Alström Syndrome (AS) is an autosomal recessive hereditary disease with the characteristics of multiorgan dysfunction. Due to the heterogeneity of clinical manifestations of AS, genetic testing is crucial for the diagnosis of AS. Herein, we used whole-exome sequencing (WES) to determine the genetic causes and characterize the clinical features of three affected patients in two Chinese families with Alström Syndrome. MATERIALS AND METHODS: Three affected patients (initially diagnosed as achromatopsia). and five asymptomatic members were recruited for both genetic and clinical tests. The complete ophthalmic examinations and systemic examinations were performed on all participants. Whole exome sequencing (WES) was performed for mutation detection. The silico analysis was also applied to predict the pathogenesis of identified pathogenic variants. RESULTS: In family 1, the proband showed low vision, hyperopia, photophobia, nystagmus, and total color blindness. DNA analysis revealed that she carried a compound heterozygote with two novel pathogenic variants in the ALMS1 gene NM_015120.4:c.10379del (NP_055935.4:p.(Asp2252Tyr)) and NM_015120.4:c.11641_11642del (NP_055935.4:p.(Val3881ThrfsTer11)). Further systemic examinations showed short stature, acanthosis nigricans, and sensorineural hearing loss. In family 2, two affected siblings presented the low vision, hyperopia, photophobia, nystagmus, and total color blindness. DNA analysis revealed that they carried a same compound heterozygote with two novel pathogenic variants in the ALMS1 gene NM_015120.4:c.10379del (NP_055935.4:p.(Asn3460IlefsTer49)), NM_015120.4:c.10819C > T (NP_055935.4:p.(Arg3607Trp)). Further systemic examinations showed obesity and mild abnormalities of lipid metabolism. According to the genetic testing results and further systemic analysis, the three affected patients were finally diagnosed as Alström Syndrome (AS). CONCLUSIONS: We found two new compound heterozygous pathogenic variants of the ALMS1 gene and determined the diagnosis as Alström Syndrome in three patients of two Chinese families. Our study extends the genotypic and phenotypic spectrums for ALMS1 -AS and emphasizes the importance of gene testing in assisting the clinical diagnosis for cases with phenotypic diversities, which would help the AS patients with early diagnosis and treatment to reduce future systemic damage.

Evaluating the association between MPDZ-NF1B rs1324183 and keratoconus in an independent northwestern Chinese population.

BACKGROUND: Keratoconus (KC) is a complex, non-inflammatory corneal degenerative disease. Although numerous studies have analyzed the correlation of SNP rs1324183, which located in MPDZ-NF1B gene, and KC in different populations, only few findings were repeated. In this study, to evaluate the association between rs1324183 and KC in a new independent Chinese population, we performed a replication study of the significantly associated rs1324183. METHODS: In total of 114 unrelated KC patients and 88 unrelated controls were recruited from Ningxia, China. We detected the genotypes and alleles of rs1324183 using PCR technology and Sanger sequencing and also analyzed the association between this locus and KC, its clinical parameters by statistical methods. RESULTS: The frequency of genotype AA (11, 9.6%) and genotypes containing allele A (47, 41.2%) of rs1324183 in KC were both higher than those of the control group. And genotype AA of rs1324183 conferred a higher risk of KC (OR > 1). Moreover, corneal parameter Belin/Ambrósio enhanced ectasia display final D value (BAD-D) had significant correlation (p = 0.002) with AA genotype of rs1324183 in KC. CONCLUSIONS: Our replication study indicates that the results of rs1324183 associated with KC in our population is robust and further better illustrates the significance of BAD-D as a diagnostic indicator for KC. rs1324183 should be considered as the first genetic mark of KC risk in its future diagnosis.

Identification of a novel FOXL2 mutation in a fourth-generation Chinese family with blepharophimosis-ptosis-epicanthus inversus syndrome.

AIM: To characterize the genetic causes and clinical features in a four-generation Chinese family with blepharophimosis-ptosis-epicanthus inversus syndrome (BPES). METHODS: Thirteen patients with BPES and eight healthy family members were included in this study. All participants received routine ophthalmic examinations. The target next-generation sequencing (NGS) was performed to determine the causative mutation for this family. The silico analysis was also applied to predict the pathogenesis of identified mutations. RESULTS: All patients had severe ptosis, normal intelligence, female patients have normal fertility. Genetic assessments revealed a heterozygous insertion variation in FOXL2 gene, c.672_701insGCGGCTGCCGC CGCAGCTGCTG CAGGCGCT (p.Ala234_Gly235linsAAAAAAAAGA), carried by 13 patient but absent in all unaffected members. In silico analysis supported the pathogenic nature of this highly conserved variant. This mutation resulted in the insertion of 10 amino acids into the encoded polyala nine chain, which increased the number of original polyalanine chains from 14 to 24, resulting in an extended protein. CONCLUSION: A novel FOXL2 mutation c.672_701ins GCGGCTGCCGCCGCAGCTGCTGC AGGCGCT (p.Ala234_Gly235linsAAAAAAAAGA) was identified in a large Chinese family with BPES. This study amplified the genotypic spectrum of FOXL2-BPES and better illustrates its genotype-phenotype correlations, which provided a basis for elucidating the pathogenesis of BPES and genetic counseling.

Myopia with X-linked retinitis pigmentosa results from a novel gross deletion of RPGR gene.

AIM: To identify mutations with whole exome sequencing (WES) in a Chinese X-linked retinitis pigmentosa (XLRP) family. METHODS: Patients received the comprehensive ophthalmic evaluation. Genomic DNA was extracted from peripheral blood and subjected to SureSelect Human All Exon 6+ UTR exon capture kit. The exons were sequenced as 100 base paired reads on Illumina HiSeq2500 system. Only mutations that resulted in a change in amino acid sequence were selected. A pattern of inheritance of the RP family was aligned to identified causal mutation. RESULTS: We analysed the data of WES information from XLRP family. The analysis revealed a hemizygous large genomic deletion of RPGR c.29_113del was responsible for this XLRP. The gross deletion lead to a frame-shift mutation and generate stop codon at 7 animo acid behind Asp (D10Afs*7), which would serious truncate RPGR protein. The novel frame-shift mutation was found to segregate with retinitis pigmentosa (RP) phenotype in this family. Bilateral myopia was present on the male patients, but carrier female showed unilateral myopia without RP. CONCLUSION: Our study identifies a novel frame-shift mutation of RPGR in a Chinese family, which would expand the spectrum of RPGR mutations. The geno-phenotypic analysis reveals a correlation between RP and myopia. Although exact mechanism of RP related myopia is still unknown, but the novel frame-shift mutation will give our hit on studying the molecular pathogenesis of RP and myopia.

Two novel PDE6C gene mutations in Chinese family with achromatopsia.

Background: Achromatopsia (ACHM) is an inherited retinal disease affecting the cone cell function. To date, six pathogenic genes of ACHM have been identified. However, the diagnostic and therapeutic methods of this disorder remain limited. Herein, to characterize the clinical features and genetic causes of three affected siblings in a Chinese family with ACHM, we used target next-generation sequencing (NGS) and found new pathogenic factors associated with ACHM in this family. Materials and methods: Three patients with ACHM and three healthy family members were included in this study. All participants received comprehensive ophthalmic tests. NGS approach was performed on the patients to determine the causative mutation for this family. The silico analysis was also applied to predict the pathogenesis of identified mutations. Results: Genetic assessments revealed compound heterozygous mutations of the PDE6C gene (c.1413 + 1 G > C, c.305 G > A), carried by all three patients. Both mutations were novel and predicted to be deleterious by six types of online predictive software. The heterozygous PDE6C missense mutation (c.305 G > A) was found from the mother and the heterozygous PDE6C splice site mutation (c.1413 + 1 G > C) was found in the father and all the children. All patients in the family showed typical signs and symptoms of ACHM. Conclusions: We report novel compound heterozygous PDE6C mutations in causing ACHM and further confirm the clinical diagnosis. Our study extends the genotypic spectrums for PDE6C-ACHM and better illustrates its genotype-phenotype correlations, which would help the ACHM patients with better genetic diagnosis, prognosis, and gene treatment.

Novel mutations in malonyl-CoA-acyl carrier protein transacylase provoke autosomal recessive optic neuropathy.

Inherited optic neuropathies are rare eye diseases of optic nerve dysfunction that present in various genetic forms. Previously, mutation in three genes encoding mitochondrial proteins has been implicated in autosomal recessive forms of optic atrophy that involve progressive degeneration of optic nerve and retinal ganglion cells (RGC). Using whole exome analysis, a novel double homozygous mutation p.L81R and pR212W in malonyl CoA-acyl carrier protein transacylase (MCAT), a mitochondrial protein involved in fatty acid biosynthesis, has now been identified as responsible for an autosomal recessive optic neuropathy from a Chinese consanguineous family. MCAT is expressed in RGC that are rich in mitochondria. The disease variants lead to structurally unstable MCAT protein with significantly reduced intracellular expression. RGC-specific knockdown of Mcat in mice, lead to an attenuated retinal neurofiber layer, that resembles the phenotype of optic neuropathy. These results indicated that MCAT plays an essential role in mitochondrial function and maintenance of RGC axons, while novel MCAT p.L81R and p.R212W mutations can lead to optic neuropathy.

Distinct mutations with different inheritance mode caused similar retinal dystrophies in one family: a demonstration of the importance of genetic annotations in complicated pedigrees.

BACKGROUND: Retinitis pigmentosa (RP) is the most common form of inherited retinal dystrophy presenting remarkable genetic heterogeneity. Genetic annotations would help with better clinical assessments and benefit gene therapy, and therefore should be recommended for RP patients. This report reveals the disease causing mutations in two RP pedigrees with confusing inheritance patterns using whole exome sequencing (WES). METHODS: Twenty-five participants including eight patients from two families were recruited and received comprehensive ophthalmic evaluations. WES was applied for mutation identification. Bioinformatics annotations, intrafamilial co-segregation tests, and in silico analyses were subsequently conducted for mutation verification. RESULTS: All patients were clinically diagnosed with RP. The first family included two siblings born to parents with consanguineous marriage; however, no potential pathogenic variant was found shared by both patients. Further analysis revealed that the female patient carried a recurrent homozygous C8ORF37 p.W185*, while the male patient had hemizygous OFD1 p.T120A. The second family was found to segregate mutations in two genes, TULP1 and RP1. Two patients born to consanguineous marriage carried homozygous TULP1 p.R419W, while a recurrent heterozygous RP1 p.L762Yfs*17 was found in another four patients presenting an autosomal dominant inheritance pattern. Crystal structural analysis further indicated that the substitution from arginine to tryptophan at the highly conserved residue 419 of TULP1 could lead to the elimination of two hydrogen bonds between residue 419 and residues V488 and S534. All four genes, including C8ORF37, OFD1, TULP1 and RP1, have been previously implicated in RP etiology. CONCLUSIONS: Our study demonstrates the coexistence of diverse inheritance modes and mutations affecting distinct disease causing genes in two RP families with consanguineous marriage. Our data provide novel insights into assessments of complicated pedigrees, reinforce the genetic complexity of RP, and highlight the need for extensive molecular evaluations in such challenging families with diverse inheritance modes and mutations.

N-Terminal Polypeptide of Annexin A2 Decreases Infection of Mycoplasma hyorhinis to Gastric Cancer Cells.

Mycoplasma infection in human and its contamination in cell cultures are worldwide problems. The drugs currently available for preventing or treating mycoplasma infection suffer from low sensitivity, strong resistance and high toxicity. Our previous work showed that Mycoplasma hyorhinis (M. hyorhinis) infection was mediated by the interaction between p37 of M. hyorhinis and Annexin A2 (ANXA2) of host cells, however the translational value of this mechanism was unknown. Herein, we synthesized the N-terminal of ANXA2 polypeptide (A2PP) and found that A2PP could decrease the infection of M. hyorhinis to gastric cancer cells and block M. hyorhinis infection-induced cell migration. Furthermore, we found that A2PP could reduce M. hyorhinis contamination of passage cells. Moreover, compared with the commercial antibiotics commonly used in cell culture to prevent M. hyorhinis infection, A2PP demonstrated a more effectiveness but a low toxicity on cell growth. Thus, our study for the first time revealed A2PP's potential for the treatment and prevention of M. hyorhinis infection.