Peptide Drug Design Using Alchemical Free Energy Calculation: An Application and Validation on Agonists of Ghrelin Receptor.

With recent large-scale applications and validations, the relative binding free energy (RBFE) calculated using alchemical free energy methods has been proven to be an accurate measure to probe the binding of small-molecule drug candidates. On the other hand, given the flexibility of peptides, it is of great interest to find out whether sufficient sampling could be achieved within the typical time scale of such calculation, and a similar level of accuracy could be reached for peptide drugs. However, the systematic evaluation of such calculations on protein-peptide systems has been less reported. Most reported studies of peptides were restricted to a limited number of data points or lacking experimental support. To demonstrate the applicability of the alchemical free energy method for protein-peptide systems in a typical real-world drug discovery project, we report an application of the thermodynamic integration (TI) method to the RBFE calculation of ghrelin receptor and its peptide agonists. Along with the calculation, the synthesis and in vitro EC50 activity of relamorelin and 17 new peptide derivatives were also reported. A cost-effective criterion to determine the data collection time was proposed for peptides in the TI simulation. The average of three TI repeats yielded a mean absolute error of 0.98 kcal/mol and Pearson's correlation coefficient (R) of 0.77 against the experimental free energy derived from the in vitro EC50 activity, showing good repeatability of the proposed method and a slightly better agreement than the results obtained from the arbitrary time frames up to 20 ns. Although it is limited by having one target and a deduced binding pose, we hope that this study can add some insights into alchemical free energy calculation of protein-peptide systems, providing theoretical assistance to the development of peptide drugs.

Multifaceted roles of lymphatic and blood endothelial cells in the tumor microenvironment of hepatocellular carcinoma: A comprehensive review.

The tumor microenvironment is a complex network of cells, extracellular matrix, and signaling molecules that plays a critical role in tumor progression and metastasis. Lymphatic and blood vessels are major routes for solid tumor metastasis and essential parts of tumor drainage conduits. However, recent studies have shown that lymphatic endothelial cells (LECs) and blood endothelial cells (BECs) also play multifaceted roles in the tumor microenvironment beyond their structural functions, particularly in hepatocellular carcinoma (HCC). This comprehensive review summarizes the diverse roles played by LECs and BECs in HCC, including their involvement in angiogenesis, immune modulation, lymphangiogenesis, and metastasis. By providing a detailed account of the complex interplay between LECs, BECs, and tumor cells, this review aims to shed light on future research directions regarding the immune regulatory function of LECs and potential therapeutic targets for HCC.

Changes in sleep score and leisure-time physical activity, their combination, and all-cause mortality in middle-aged and older Chinese adults: The Dongfeng-Tongji cohort study.

OBJECTIVES: To prospectively investigate the associations of longitudinal changes in sleep score and LTPA and their combination with all-cause mortality. METHODS: Among 12,543 participants (mean age: 66.1 years) from the Dongfeng-Tongji cohort, we calculated sleep score (range, 0-4, integrating bedtime, sleep duration, sleep quality, and midday napping, higher score indicating healthier sleep) and LTPA at baseline (2008-2010) and the first follow-up (2013) surveys and their 5-year changes (defining stable sleep score as no change and stable LTPA as change within 150 min/week). We prospectively documented deaths from the first follow-up survey (2013) through December 31, 2018. RESULTS: During a mean 5.5-year follow-up, 792 deaths occurred. The 5-year changes in sleep score and LTPA were inversely associated with all-cause mortality risk, regardless of their initial values. When assessing 5-year changes in sleep score and LTPA jointly, compared with the stable sleep score-stable LTPA group, the decreased sleep score-decreased LTPA group had a 40 % (5-85 %) higher all-cause mortality risk, whereas the increased sleep score-increased LTPA group had a 34 % (9-52 %) lower risk. The direction of the joint association was mainly driven by sleep score change. Participants maintaining sleep scores ≥ 3 and LTPA ≥ 150 min/week over 5 years had a 44 % (28-56 %) lower all-cause mortality risk. CONCLUSIONS: Promoting sleep hygiene and LTPA together may benefit efforts in reducing mortality risk, with particular attention to monitoring long-term sleep health.

Comparison of the use of a spiral nasojejunal tube and transendoscopic enteral tubing in washed microbiota transplantation via the mid-gut route.

Background: Methods for washed microbiota transplantation (WMT) through the mid-gut include transendoscopic enteral tubing (TET) and manual spiral nasojejunal tube (SNT) placement have not been studied. Methods: This prospective interventional study was performed at a single centre. Patients were divided into the SNT and mid-gut TET groups based on their conditions and wishes. In the SNT group, an SNT was passively inserted into the stomach, and abdominal X-rays were taken within 24 h to confirm tube placement in the small intestine. In the mid-gut TET group, mid-gut TET was placed in the small intestine for gastroscopy. Data on the clinical efficacy of WMT, intubation time, cost, overall comfort score, adverse reactions, etc., were collected from the two groups. Results: Sixty-three patients were included in the study (SNT group (n = 40) and mid-gut TET group (n = 23)). The clinical efficacy of WMT in the SNT and mid-gut TET groups was 90 % and 95.7 %, respectively (P = 0.644). Compared with the mid-gut TET group, the SNT group showed a shorter operation time (120 s vs. 258 s, P = 0.001) and a lower average cost (641.7 yuan vs. 1702.1 yuan, P = 0.001). There was no significant difference in the overall comfort score or the incidence of common discomfort symptoms between the two groups. Conclusion: The different implantation methods have different advantages; compared with mid-gut TET placement, manual SNT placement provides some benefits.

Identification of novel variations in three cases with rare inherited neuromuscular disorder.

Inherited neuromuscular disorder (IND) is a broad-spectrum, clinically diverse group of diseases that are caused due to defects in the neurosystem, muscles and related tissue. Since IND may originate from mutations in hundreds of different genes, the resulting heterogeneity of IND is a great challenge for accurate diagnosis and subsequent management. Three pediatric cases with IND were enrolled in the present study and subjected to a thorough clinical examination. Next, a genetic investigation was conducted using whole-exome sequencing (WES). The suspected variants were validated through Sanger sequencing or quantitative fluorescence PCR assay. A new missense variant of the Spastin (SPAST) gene was found and analyzed at the structural level using molecular dynamics (MD) simulations. All three cases presented with respective specific clinical manifestations, which reflected the diversity of IND. WES detected the diagnostic variants in all 3 cases: A compound variation comprising collagen type VI α3 chain (COL6A3) (NM_004369; exon19):c.6322G>T(p.E1208*) and a one-copy loss of COL6A3:exon19 in Case 1, which are being reported for the first time; a de novo SPAST (NM_014946; exon8):c.1166C>A(p.T389K) variant in Case 2; and a de novo Duchenne muscular dystrophy (NM_004006; exon11):c.1150-17_1160delACTTCCTTCTTTGTCAGGGGTACATGATinsC variant in Case 3. The structural and MD analyses revealed that the detected novel SPAST: c.1166C>A(p.T389K) variant mainly altered the intramolecular hydrogen bonding status and the protein segment's secondary structure. In conclusion, the present study expanded the IND mutation spectrum. The study not only detailed the precise diagnoses of these cases but also furnished substantial grounds for informed consultations. The approach involving the genetic evaluation strategy using WES for variation screening followed by validation using appropriate methods is beneficial due to the considerable heterogeneity of IND.

Umpolung-Enabled Divergent Dearomative Carbonylations.

Although dearomative functionalizations enable the direct conversion of flat aromatics into precious three-dimensional architectures, the case for simple arenes remains largely underdeveloped due to the high aromatic stabilization energy. We herein report a dearomative sequential addition of two nucleophiles to arene π-bonds via umpolung of chromium-arene complexes. This mode enables divergent dearomative carbonylations of benzene derivatives by tolerating various nucleophiles in combination with alcohols or amines under CO-gas-free conditions, thus providing modular access to functionalized esters or amides. The tunable synthesis of 1,3- or 1,4-cyclohexadienes as well as the construction of all-carbon quaternary centers further highlight the versatility of this dearomatization. Diverse late-stage modifications and derivatizations towards synthetically challenging and bioactive molecules reveal the synthetic utility. A possible mechanism was proposed based on control experiments and intermediate tracking.

Stabilizing High-Voltage Performance of Nickel-Rich Cathodes via Facile Solvothermally Synthesized Niobium-Doped Strontium Titanate.

Ni-rich layered ternary cathodes are promising candidates thanks to their low toxic Co-content and high energy density (∼800 Wh/kg). However, a critical challenge in developing Ni-rich cathodes is to improve cyclic stability, especially under high voltage (>4.3 V), which directly affects the performance and lifespan of the battery. In this study, niobium-doped strontium titanate (Nb-STO) is successfully synthesized via a facile solvothermal method and used as a surface modification layer onto the LiNi0.8Co0.1Mn0.1O2 (NCM811) cathode. The results exhibited that the Nb-STO modification significantly improved the cycling stability of the cathode material even under high-voltage (4.5 V) operational conditions. In particular, the best sample in our work could provide a high discharge capacity of ∼190 mAh/g after 100 cycles under 1 C with capacity retention over 84% in the voltage range of 3.0-4.5 V, superior to the pristine NCM811 (∼61%) and pure STO modified STO-811-600 (∼76%) samples under the same conditions. The improved electrochemical performance and stability of NCM811 under high voltage should be attributed to not only preventing the dissolution of the transition metals, further reducing the electrolyte's degradation by the end of charge, but also alleviating the internal resistance growth from uncontrollable cathode-electrolyte interface (CEI) evolution. These findings suggest that the as-synthesized STO with an optimized Nb-doping ratio could be a promising candidate for stabilizing Ni-rich cathode materials to facilitate the widespread commercialization of Ni-rich cathodes in modern LIBs.

Combination of androgen and estrogen improves asthma by mediating Runx3 expression.

Objective: Asthma is a chronic heterogeneous airway disease, and imbalanced T-helper type 1 (Th1) and Th2 cell-mediated inflammation contribute to its pathogenesis. Although it has been suggested that androgen and estrogen were involved in development of asthma, the underlying mechanisms remained largely unclear. Studies have demonstrated that Runx3 could promote naive CD4+ T cells to differentiate into Th1 cells. Hence, our study aimed to explore the potential regulatory mechanism of androgen and estrogen on asthma via modulating Runx3. Methods: First, clinical assessments and pulmonary function tests were conducted on 35 asthma patients and 24 healthy controls. The concentrations of androgen, estrogen, and androgen estrogen ratios were assessed in peripheral blood samples of asthma patients and healthy controls. Then, a murine asthma model was established to explore the effects of estrogen and androgen (alone or in combination) on asthma. Third, an in vitro assay was used to explore the mechanism of combination of androgen and estrogen in asthma. Results: We observed decreased androgen and increased estrogen levels in asthma patients compared with healthy controls. In mice with experimental asthma, there were increased serum concentrations of estrogen and decreased serum concentrations of androgen, intervention with combination of androgen and estrogen alleviated airway inflammations, increased Runx3 expressions and elevated Th1 differentiation. In CD4+ T cells co-cultured with bronchial epithelial cells (BECs), treatment with androgen plus estrogen combination promoted Th1 differentiation, which was mitigated by Runx3 knockdown in BECs and enhanced by Runx3 overexpression. Conclusion: These findings suggest that androgen estrogen combination modulate the Th1/Th2 balance via regulating the expression of Runx3 in BECs, thereby providing experimental evidence supporting androgen and estrogen combination as a novel therapy for asthma.

S100a8/9 (S100 Calcium Binding Protein a8/9) Promotes Cardiac Hypertrophy Via Upregulation of FGF23 (Fibroblast Growth Factor 23) in Mice.

BACKGROUND: S100a8/9 (S100 calcium binding protein a8/9) belongs to the S100 family and has gained a lot of interest as a critical regulator of inflammatory response. Our previous study found that S100a8/9 homolog promoted aortic valve sclerosis in mice with chronic kidney disease. However, the role of S100a8/9 in pressure overload-induced cardiac hypertrophy remains unclear. The present study was to explore the role of S100a8/9 in cardiac hypertrophy. METHODS AND RESULTS: Cardiomyocyte-specific S100a9 loss or gain of function was achieved using an adeno-associated virus system, and the model of cardiac hypertrophy was established by aortic banding-induced pressure overload. The results indicate that S100a8/9 expression was increased in response to pressure overload. S100a9 deficiency alleviated pressure overload-induced hypertrophic response, whereas S100a9 overexpression accelerated cardiac hypertrophy. S100a9-overexpressed mice showed increased FGF23 (fibroblast growth factor 23) expression in the hearts after exposure to pressure overload, which activated calcineurin/NFAT (nuclear factor of activated T cells) signaling in cardiac myocytes and thus promoted hypertrophic response. A specific antibody that blocks FGFR4 (FGF receptor 4) largely abolished the prohypertrophic response of S100a9 in mice. CONCLUSIONS: In conclusion, S100a8/9 promoted the development of cardiac hypertrophy in mice. Targeting S100a8/9 may be a promising therapeutic approach to treat cardiac hypertrophy.

Genome editing: An insight into disease resistance, production efficiency, and biomedical applications in livestock.

One of the primary concerns for the survival of the human species is the growing demand for food brought on by an increasing global population. New developments in genome-editing technology present promising opportunities for the growth of wholesome and prolific farm animals. Genome editing in large animals is used for a variety of purposes, including biotechnology to improve food production, animal health, and pest management, as well as the development of animal models for fundamental research and biomedicine. Genome editing entails modifying genetic material by removing, adding, or manipulating particular DNA sequences from a particular locus in a way that does not happen naturally. The three primary genome editors are CRISPR/Cas 9, TALENs, and ZFNs. Each of these enzymes is capable of precisely severing nuclear DNA at a predetermined location. One of the most effective inventions is base editing, which enables single base conversions without the requirement for a DNA double-strand break (DSB). As reliable methods for precise genome editing in studies involving animals, cytosine and adenine base editing are now well-established. Effective zygote editing with both cytosine and adenine base editors (ABE) has resulted in the production of animal models. Both base editors produced comparable outcomes for the precise editing of point mutations in somatic cells, advancing the field of gene therapy. This review focused on the principles, methods, recent developments, outstanding applications, the advantages and disadvantages of ZFNs, TALENs, and CRISPR/Cas9 base editors, and prime editing in diverse lab and farm animals. Additionally, we address the methodologies that can be used for gene regulation, base editing, and epigenetic alterations, as well as the significance of genome editing in animal models to better reflect real disease. We also look at methods designed to increase the effectiveness and precision of gene editing tools. Genome editing in large animals is used for a variety of purposes, including biotechnology to improve food production, animal health, and pest management, as well as the development of animal models for fundamental research and biomedicine. This review is an overview of the existing knowledge of the principles, methods, recent developments, outstanding applications, the advantages and disadvantages of zinc finger nucleases (ZFNs), transcription-activator-like endonucleases (TALENs), and clustered regularly interspaced short palindromic repeats associated protein 9 (CRISPR/Cas 9), base editors and prime editing in diverse lab and farm animals, which will offer better and healthier products for the entire human race.

Dichotomous roles of ADAR1 in liver hepatocellular carcinoma and kidney renal cell carcinoma: Unraveling the complex tumor microenvironment and prognostic significance.

BACKGROUND: Adenosine deaminase acting on RNA 1 (ADAR1) is an RNA-editing enzyme that significantly impacts cancer progression and various biological processes. The expression of ADAR1 mRNA has been examined in multiple cancer types using The Cancer Genome Atlas (TCGA) dataset, revealing distinct patterns in kidney chromophobe (KICH), kidney renal clear cell carcinoma (KIRC), kidney renal papillary cell carcinoma (KIRP), and liver hepatocellular carcinoma (LIHC) compared to normal controls. However, the reasons for these differential expressions remain unclear. METHODS: In this study, we performed RT-PCR and western blotting (WB) to validate ADAR1 expression patterns in clinical tissue samples. Survival analysis and immune microenvironment analysis (including immune score and stromal score) were conducted using TCGA data to determine the specific cell types associated with ADAR1, as well as the key genes in those cell types. The relationship between ADAR1 and specific cell types' key genes was verified by immunohistochemistry (IHC), using clinical liver and kidney cancer samples. RESULTS: Our validation analysis revealed that ADAR1 expression was downregulated in KICH, KIRC, and KIRP, while upregulated in LIHC compared to normal tissues. Notably, a significant correlation was found between ADAR1 mRNA expression and patient prognosis, particularly in KIRC, KIRP, and LIHC. Interestingly, we observed a positive correlation between ADAR1 expression and stromal scores in KIRC, whereas a negative correlation was observed in LIHC. Cell type analysis highlighted distinct relationships between ADAR1 expression and the two stromal cell types, blood endothelial cells (BECs) and lymphatic endothelial cells (LECs), and further determined the signature gene claudin-5 (CLDN5), in KIRC and LIHC. Moreover, ADAR1 was inversely related with CLDN5 in KIRC (n = 26) and LIHC (n = 30) samples, verified via IHC. CONCLUSIONS: ADAR1 plays contrasting roles in LIHC and KIRC, associated with the enrichment of BECs and LECs within tumors. This study sheds light on the significant roles of stromal cells within the complex tumor microenvironment (TME) and provides new insights for future research in tumor immunotherapy and precision medicine.

[Ginsenoside Rg_1 ameliorates OGD/R-induced PC12 cell injury by inhibiting autography via IRE1-JNK-CHOP pathway].

This study investigated the protective effect of ginsenoside Rg_1(GRg_1) on oxygen and glucose deprivation/reoxygenation(OGD/R)-injured rat adrenal pheochromocytoma(PC12) cells and whether the underlying mechanism was related to the regulation of inositol-requiring enzyme 1(IRE1)-c-Jun N-terminal kinase(JNK)-C/EBP homologous protein(CHOP) signaling pathway. An OGD/R model was established in PC12 cells, and PC12 cells were randomly classified into control, model, OGD/R+GRg_1(0.1, 1, 10 µmol·L~(-1)), OGD/R+GRg_1+rapamycin(autophagy agonist), OGD/R+GRg_1+3-methyladenine(3-MA,autophagy inhibitor), OGD/R+GRg_1+tunicamycin(endoplasmic reticulum stress agonist), OGD/R+GRg_1+4-phenylbutyric acid(4-PBA, endoplasmic reticulum stress inhibitor), and OGD/R+GRg_1+3,5-dibromosalicylaldehyde(DBSA, IRE1 inhibitor) groups. Except the control group, the other groups were subjected to OGD/R treatment, i.e., oxygen and glucose deprivation for 6 h followed by reoxygenation for 6 h. Cell viability was detected by the 3-(4,5-dimethyl-2-thiazolyl)-2,5-diphenyl tetrazolium bromide(MTT) assay. Apoptosis was detected by Hoechst 33342 staining, and the fluorescence intensity of autophagosomes by the monodansylcadaverine(MDC) assay. Western blot was employed to determine the expression of autophagy-related proteins(Beclin1, LC3-Ⅱ, and p62) and the pathway-related proteins [IRE1, p-IRE1, JNK, p-JNK, glucose-regulated protein 78(GRP78), and CHOP]. The results showed that GRg_1 dose-dependently increased the viability of PC12 cells and down-regulated the expression of Beclin1, LC3-Ⅱ, p-IRE1, p-JNK, GRP78, and CHOP, compared with the model group. Furthermore, GRg_1 decreased the apoptosis rate and MDC fluorescence intensity and up-regulated the expression of p62 protein. Compared with the OGD/R+GRg_1(10 µmol·L~(-1)) group, OGD/R+GRg_1+rapamycin and OGD/R+GRg_1+tunicamycin groups showed increased apoptosis rate and MDC fluorescence intensity, up-regulated protein levels of Beclin1, LC3-Ⅱ, p-IRE1, p-JNK, GRP78, and CHOP, decreased relative cell survival rate, and down-regulated protein level of p62. The 3-MA, 4-PBA, and DBSA groups exerted the opposite effects. Taken together, GRg_1 may ameliorate OGD/R-induced PC12 cell injury by inhibiting autophagy via the IRE1-JNK-CHOP pathway.

Identification of differentially expressed mRNAs as novel predictive biomarkers for gastric cancer diagnosis and prognosis.

BACKGROUND: Gastric cancer (GC) has a high mortality rate worldwide. Despite significant progress in GC diagnosis and treatment, the prognosis for affected patients still remains unfavorable. AIM: To identify important candidate genes related to the development of GC and identify potential pathogenic mechanisms through comprehensive bioinformatics analysis. METHODS: The Gene Expression Omnibus database was used to obtain the GSE183136 dataset, which includes a total of 135 GC samples. The limma package in R software was employed to identify differentially expressed genes (DEGs). Thereafter, enrichment analyses of Gene Ontology (GO) terms and Kyoto Encyclopedia of Genes and Genomes (KEGG) pathways were performed for the gene modules using the clusterProfile package in R software. The protein-protein interaction (PPI) networks of target genes were constructed using STRING and visualized by Cytoscape software. The common hub genes that emerged in the cohort of DEGs that was retrieved from the GEPIA database were then screened using a Venn Diagram. The expression levels of these overlapping genes in stomach adenocarcinoma samples and non-tumor samples and their association with prognosis in GC patients were also obtained from the GEPIA database and Kaplan-Meier curves. Moreover, real-time quantitative polymerase chain reaction (RT-qPCR) and western blotting were performed to determine the mRNA and protein levels of glutamic-pyruvic transaminase (GPT) in GC and normal immortalized cell lines. In addition, cell viability, cell cycle distribution, migration and invasion were evaluated by cell counting kit-8, flow cytometry and transwell assays. Furthermore, we also conducted a retrospective analysis on 70 GC patients diagnosed and surgically treated in Wenzhou Central Hospital, Dingli Clinical College of Wenzhou Medical University, The Second Affiliated Hospital of Shanghai University between January 2017 to December 2020. The tumor and adjacent normal samples were collected from the patients to determine the potential association between the expression level of GPT and the clinical as well as pathological features of GC patients. RESULTS: We selected 19214 genes from the GSE183136 dataset, among which there were 250 downregulated genes and 401 upregulated genes in the tumor samples of stage III-IV in comparison to those in tumor samples of stage I-II with a P-value < 0.05. In addition, GO and KEGG results revealed that the various upregulated DEGs were mainly enriched in plasma membrane and neuroactive ligand-receptor interaction, whereas the downregulated DEGs were primarily enriched in cytosol and pancreatic secretion, vascular smooth muscle contraction and biosynthesis of the different cofactors. Furthermore, PPI networks were constructed based on the various upregulated and downregulated genes, and there were a total 15 upregulated and 10 downregulated hub genes. After a comprehensive analysis, several hub genes, including runt-related transcription factor 2 (RUNX2), salmonella pathogenicity island 1 (SPI1), lysyl oxidase (LOX), fibrillin 1 (FBN1) and GPT, displayed prognostic values. Interestingly, it was observed that GPT was downregulated in GC cells and its upregulation could suppress the malignant phenotypes of GC cells. Furthermore, the expression level of GPT was found to be associated with age, lymph node metastasis, pathological staging and distant metastasis (P < 0.05). CONCLUSION: RUNX2, SPI1, LOX, FBN1 and GPT were identified key hub genes in GC by bioinformatics analysis. GPT was significantly associated with the prognosis of GC, and its upregulation can effectively inhibit the proliferative, migrative and invasive capabilities of GC cells.

Optimizing anthocyanin Oral delivery: Effects of food biomacromolecule types on Nanocarrier performance for enhanced bioavailability.

Wall material types influence the efficacy of nanocarriers in oral delivery systems. We utilized three food biomacromolecules (whey protein isolate, oxidized starch, lipids) to prepare three types of nanocarriers. Our aim was to investigate their performance in digestion, cellular absorption, mucus penetration, intestinal retention, and bioavailability of the encapsulated anthocyanins (Ant). The release rate of protein nanocarriers (Pro-NCs) was twice that of starch nanocarriers (Sta-NCs) and four times that of lipid nanocarriers (Lip-NCs) in simulated gastrointestinal fluid. Additionally, Pro-NCs demonstrated superior transmembrane transport capacity and over three times cellular internalization efficiency than Sta-NCs and Lip-NCs. Sta-NCs exhibited the highest mucus-penetrating capacity, while Pro-NCs displayed the strongest mucoadhesion, resulting in extended gastrointestinal retention time for Pro-NCs. Sta-NCs significantly enhanced the in vivo bioavailability of Ant, nearly twice that of free Ant. Our results demonstrate the critical role of wall material types in optimizing nanocarriers for the specific delivery of bioactive compounds.

Changes in Sleep Patterns, Genetic Susceptibility, and Incident Cardiovascular Disease in China.

Importance: The associations of changes in sleep patterns with incident cardiovascular disease (CVD) are not fully elucidated, and whether these associations are modified by genetic susceptibility remains unknown. Objectives: To investigate the associations of 5-year changes in sleep patterns with incident CVD and whether genetic susceptibility modifies these associations. Design, Setting, and Participants: This prospective cohort study of the Dongfeng-Tongji cohort was conducted from 2008 to 2018 in China. Eligible participants included those with complete sleep information at baseline survey (2008-2010) and the first follow-up survey (2013); participants who had no CVD or cancer in 2013 were prospectively assessed until 2018. Statistical analysis was performed in November 2023. Exposures: Five-year changes in sleep patterns (determined by bedtime, sleep duration, sleep quality, and midday napping) between 2008 and 2013, and polygenic risk scores (PRS) for coronary heart disease (CHD) and stroke. Main Outcomes and Measures: Incident CVD, CHD, and stroke were identified from 2013 to 2018. Cox proportional hazards regression models were applied to estimate hazard ratios (HRs) and 95% CIs. Results: Among 15 306 individuals (mean [SD] age, 65.8 [7.4] years; 8858 [57.9%] female and 6448 male [42.1%]), 5474 (35.78%) had persistent unfavorable sleep patterns and 3946 (25.8%) had persistent favorable sleep patterns. A total of 3669 incident CVD cases were documented, including 2986 CHD cases and 683 stroke cases, over a mean (SD) follow-up of 4.9 (1.5) years. Compared with those with persistent unfavorable sleep patterns, individuals with persistent favorable sleep patterns over 5 years had lower risks of incident CVD (HR, 0.80; 95% CI, 0.73-0.87), CHD (HR, 0.84; 95% CI, 0.76-0.92), and stroke (HR, 0.66; 95% CI, 0.54-0.82) in the subsequent 5-year period. No significant effect modification by PRS was observed for sleep pattern change and CHD or stroke risk. However, sleep pattern changes and PRS were jointly associated with the CHD and stroke risk in a dose-dependent manner, with the lowest risk being among those with persistent favorable sleep patterns combined with low PRS (HR for CHD, 0.65; 95% CI, 0.52-0.82 and HR for stroke, 0.48; 95% CI, 0.29-0.79). Conclusions and Relevance: In this cohort study of middle-aged and older Chinese adults, individuals with persistent favorable sleep patterns had a lower CVD risk, even among those with higher genetic risk. These findings highlight the importance of maintaining favorable sleep patterns for CVD prevention.

Endothelial progenitor cells control remodeling of uterine spiral arteries for the establishment of utero-placental circulation.

Placental ischemia, resulting from inadequate remodeling of uterine spiral arteries, is a factor in the development of preeclampsia. However, the effect of endothelial progenitor cells that play a role in the vascular injury-repair program is largely unexplored during remodeling. Here, we observe that preeclampsia-afflicted uterine spiral arteries transition to a synthetic phenotype in vascular smooth muscle cells and characterize the regulatory axis in endothelial progenitor cells during remodeling in human decidua basalis. Excessive sEng, secreted by AMP-activated protein kinase (AMPK)-deficient endothelial progenitor cells through the inhibition of HO-1, damages residual endothelium and leads to the accumulation of extracellular matrix produced by vascular smooth muscle cells during remodeling, which is further confirmed by animal models. Collectively, our findings suggest that the impaired functionality of endothelial progenitor cells contributes to the narrowing of remodeled uterine spiral arteries, leading to reduced utero-placental perfusion. This mechanism holds promise in elucidating the pathogenesis of preeclampsia.

A combined pre- and intra-operative nomogram in evaluation of degrees of liver cirrhosis predicts post-hepatectomy liver failure: a multicenter prospective study.

Background: Adequate evaluation of degrees of liver cirrhosis is essential in surgical treatment of hepatocellular carcinoma (HCC) patients. The impact of the degrees of cirrhosis on prediction of post-hepatectomy liver failure (PHLF) remains poorly defined. This study aimed to construct and validate a combined pre- and intra-operative nomogram based on the degrees of cirrhosis in predicting PHLF in HCC patients using prospective multi-center's data. Methods: Consecutive HCC patients who underwent hepatectomy between May 18, 2019 and Dec 19, 2020 were enrolled at five tertiary hospitals. Preoperative cirrhotic severity scoring (CSS) and intra-operative direct liver stiffness measurement (DSM) were performed to correlate with the Laennec histopathological grading system. The performances of the pre-operative nomogram and combined pre- and intra-operative nomogram in predicting PHLF were compared with conventional predictive models of PHLF. Results: For 327 patients in this study, histopathological studies showed the rates of HCC patients with no, mild, moderate, and severe cirrhosis were 41.9%, 29.1%, 22.9%, and 6.1%, respectively. Either CSS or DSM was closely correlated with histopathological stages of cirrhosis. Thirty-three (10.1%) patients developed PHLF. The 30- and 90-day mortality rates were 0.9%. Multivariate regression analysis showed four pre-operative variables [HBV-DNA level, ICG-R15, prothrombin time (PT), and CSS], and one intra-operative variable (DSM) to be independent risk factors of PHLF. The pre-operative nomogram was constructed based on these four pre-operative variables together with total bilirubin. The combined pre- and intra-operative nomogram was constructed by adding the intra-operative DSM. The pre-operative nomogram was better than the conventional models in predicting PHLF. The prediction was further improved with the combined pre- and intra-operative nomogram. Conclusions: The combined pre- and intra-operative nomogram further improved prediction of PHLF when compared with the pre-operative nomogram. Trial Registration: Clinicaltrials.gov Identifier: NCT04076631.