Revealing the Synergistic Effect of Cation and Anion Vacancies on Enhanced Fenton-Like Reaction: The Electron Density Modulation of O 2p-Co 3d Bands.

Defect engineering is considered as a flexible and effective mean to improve the performance of Fenton-like reactions. Herein, a simple method is employed to synthesize Co3O4 catalysts with Co-O vacancy pairs (VP) for peroxymonosulfate (PMS) activation. Multi-scaled characterization, experimental, and simulation results jointly revealed that the cation vacancies-VCo contributed to enhanced conductivity and anion vacancies-VO provided a new active center for the 1O2 generation. Co3O4-VP can optimize the O 2p and Co 3d bands with the strong assistance of synergistic double vacancies to reduce the reaction energy barrier of the "PMS → Co(IV) = O → 1O2" pathway, ultimately triggering the stable transition of mechanism. Co3O4-VP catalysts with radical-nonradical collaborative mechanism achieve the synchronous improvement of activity and stability, and have good environmental robustness to favor water decontamination applications. This result highlights the possibility of utilizing anion and cation vacancy engineering strategies to rational design Co3O4-based materials widely used in catalytic reactions.

Assessing the efficacy of aluminum metal clusters Al13 and Al15 in mitigating NO2 and SO2 pollutants: a DFT investigation.

The present investigation delves into the adverse environmental impact of atmospheric pollutant gases, specifically nitrogen dioxide (NO2) and sulfur dioxide (SO2), which necessitates the identification and implementation of effective control measures. The central objective of this study is to explore the eradication of these pollutants through the utilization of aluminum Al13 and Al15 metal clusters, distinguished by their unique properties. The comprehensive evaluation of gas/cluster interactions is undertaken employing density functional theory (DFT). Geometric optimization calculations for all structures are executed using the ωB97XD functional and the Def2-svp basis set. To probe various interaction modalities, gas molecule distribution around the metal clusters is sampled using the bee colony algorithm. Frequency calculations employing identical model chemistry validate the precision of the optimization calculations. The quantum theory of atoms in molecules (QTAIM) and natural bond orbital (NBO) methodologies are applied for the analysis of intermolecular interactions. This research establishes the robust formation of van der Waals attractions between the investigated gas molecules, affirming aluminum metal clusters as viable candidates for the removal and control of these gases.

Insight into the fate of nitrogen during char thermal conversion and the influence mechanism of potassium: A theoretical research.

Nitrogen oxides (NOₓ) are primary pollutants produced during biomass combustion. During the devolatilization stage, char nitrogen (char(N)) is formed. In the subsequent char combustion stage, char(N) can decompose directly into NOx precursors or engage in heterogeneous reactions with O2 or NO to form NO and N2. Nonetheless, a comprehensive understanding of the reaction mechanisms and competitiveness of char(N) migration, especially the influence of the alkali metal potassium (K) present in biomass, remains incomplete. Building on the Zigzag char(N) models, the present study delves into the migration reactions of char(N), assessing their competitive dynamics through the integration of density functional theory, electronic structure analysis, and conventional transition state theory. Furthermore, it examines the impact of K on char(N) conversion. The competitiveness of the heterogeneous reactions follows the sequence: heterogeneous reduction of NO to N2 > heterogeneous oxidation of char(N) to NO > decomposition of char(N) to NOx precursors. Moreover, the formation of HCN is more favorable than NH3 production. The successive conversion from char(N) to NO and then to N2 is the predominant migration route for char(N), with NO generation as the pivotal step. The less preferred char(N) migration route involves decomposition to NH3/HCN, followed by oxidation to NOx within the main combustion zone, which cannot be mitigated by char. K can accelerate NO generation and sustain the primacy of the heterogeneous NO reduction, consequently enhancing the oxidation-reduction process of char(N). As a result, K plays a constructive role in managing NOx emissions during the thermal conversion of char.

Different effects of vaccine on VST in critical and non-critical COVID-19 patients: A retrospective study of 363 cases.

Aim: To explore the risk factors of prolonged viral shedding time (VST) in critical/non-critical COVID-19 patients during hospitalization. Methods: In this retrospective study, we enrolled 363 patients with SARS-CoV-2 infection admitted in a designated hospital during the COVID-19 outbreak in Nanjing Lukou International Airport. Patients were divided into critical (n = 54) and non-critical (n = 309) groups. We analyzed the relationship between the VST and demographics, clinical characteristics, medications, and vaccination histories, respectively. Results: The median duration of VST was 24 d (IQR, 20-29) of all patients. The VST of critical cases was longer than non-critical cases (27 d, IQR, 22.0-30.0 vs. 23 d, IQR 20-28, P < 0.05). Cox proportional hazards model showed that ALT (HR = 1.610, 95%CI 1.186-2.184, P = 0.002) and EO% (HR = 1.276, 95%CI 1.042-1.563, P = 0.018) were independent factors of prolonged VST in total cases; HGB (HR = 0.343, 95%CI 0.162-0.728, P = 0.005) and ALP (HR = 0.358, 95%CI 0.133-0.968, P = 0.043) were independent factors of prolonged VST in critical cases, while EO% (HR = 1.251, 95%CI 1.015-1.541, P = 0.036) was the independent factor of prolonged VST in non-critical cases. Vaccinated critical cases showed higher levels of SARS-CoV-2-IgG (1.725 S/CO, IQR 0.3975-28.7925 vs 0.07 S/CO, IQR 0.05-0.16, P < 0.001) and longer VSTs (32.5 d, IQR 20.0-35.25 vs 23 d, IQR 18.0-30.0, P = 0.011) compared with unvaccinated critical patients. Fully vaccinated non-critical cases, however, presented higher levels of SARS-CoV-2-IgG (8.09 S/CO, IQR 1.6975-55.7825 vs 0.13 S/CO IQR 0.06-0.41, P < 0.001) and shorter VSTs (21 d, IQR 19.0-28.0 vs 24 d, IQR 21.0-28.5, P = 0.013) compared with unvaccinated non-critical patients. Conclusions: Our results suggested that risk factors of prolonged VST were different between critical and non-critical COVID-19 patients. Increased level of SARS-CoV-2-IgG and vaccination did not shorten the VST and hospital stay in critical COVID-19 patients.

Advances in Modeling of Multiple Myeloma in Mice / 中国医学科学院学报

Multiple myeloma(MM)is a systemic malignancy of plasma cells.Nowadays,the basic research on MM is flourishing with the continuous optimization and innovation of mouse models of MM.Heterologous mouse models of MM established with human-derived cells and immunodeficient mice have been applied in assessing drug efficacy,exploring drug resistance mechanisms,and observing tumor-bone marrow microenvironment interactions.In the last decades,the homologous mouse models of MM established with murine-derived cells or gene-editing technologies have been widely used in the research on the pathogenesis and drug development.Additionally,the stable modeling of targeted organ injury will be a key problem to be tackled in this field.This review summarizes the characteristics and application progress of mouse models of MM.

Efficacy and safefy of Polymyxin B treatment for neutropenic patients suffering from refractory Gram-negative bacterial bloodstream infection / 中华血液学杂志

Objective: To assess the efficacy and safety of polymyxin B in neutropenic patients with hematologic disorders who had refractory gram-negative bacterial bloodstream infection. Methods: From August 2021 to July 2022, we retrospectively analyzed neutropenic patients with refractory gram-negative bacterial bloodstream infection who were treated with polymyxin B in the Department of Hematology of the First Affiliated Hospital of the Soochow University between August 2021 to July 2022. The cumulative response rate was then computed. Results: The study included 27 neutropenic patients with refractory gram-negative bacterial bloodstream infections. Polymyxin B therapy was effective in 22 of 27 patients. The median time between the onset of fever and the delivery of polymyxin B was 3 days [interquartile range (IQR) : 2-5]. The median duration of polymyxin B treatment was 7 days (IQR: 5-11). Polymyxin B therapy had a median antipyretic time of 37 h (IQR: 32-70). The incidence of acute renal dysfunction was 14.8% (four out of 27 cases), all classified as "injury" according to RIFLE criteria. The incidence of hyperpigmentation was 59.3%. Conclusion: Polymyxin B is a viable treatment option for granulocytopenia patients with refractory gram-negative bacterial bloodstream infections.

A combined regimen based on bortezomib and glucocorticoids for 6 patients with recurrent/refractory immune thrombotic thrombocytopenic purpura / 中华血液学杂志

Objective: To observe the efficacy and adverse reactions of a combination therapy regimen based on bortezomib and glucocorticoids in recurrent/refractory immune thrombocytopenic purpura (iTTP) . Methods: Six patients with recurrent/refractory TTP were included and treated with a glucocorticoid and two courses of bortezomib-based regimen. The clinical remission status of patients, changes in ADAMTS13 activity/ADAMTS13 inhibitor, and the occurrence of treatment-related adverse reactions were observed. Results: Of the 6 patients, 2 were males and 4 were females, with a median age of 21.5 (18-68) years. Refractory TTP was found in 1 case and recurrent TTP in 5 cases. Glucocorticoids were administered with reference to prednisone at 1 mg·kg(-1)·d(-1), and gradually reduced in dosage after achieving clinical remission. Bortezomib is subcutaneously administered at 1.3 mg/m(2) on days 1, 4, 8, and 11 with a 28-day treatment course consisting of 2 courses. Six patients achieved clinical remission after receiving bortezomib as the main treatment. ADMATS13 activity returned to normal in all patients with TTP after treatment, and the ADAMTS13 inhibitor turned negative. Thrombocytopenia is the most common adverse reaction after treatment, with other adverse reactions, including peripheral neuritis and abdominal pain, but ultimately all patients returned to normal. In a median follow-up of 26 (9-41) months, 5 patients maintained sustained remission, and 1 patient relapsed after 16 months of bortezomib treatment. Conclusion: Combination therapy of bortezomib and glucocorticoids has a satisfactory therapeutic effect and controllable adverse reactions for recurrent/refractory iTTP.

Clinical characteristics and analysis of risk factors for disease progression of patients with SARS-CoV-2 Omicron variant infection: A retrospective study of 25207 cases in a Fangcang hospital.

Objectives: To summarize the clinical characteristics of patients infected by SARS-CoV-2 omicron variant and explore the risk factors affecting the progression in a Fangcang hospital, Shanghai, China. Methods: A total of 25,207 patients were retrospectively enrolled. We described the clinical characteristics and performed univariate and multivariate logistic regression analysis to identify the risk factors for non-severe to severe COVID-19 or death. Results: According to the outcomes, there were 39 severe patients (including 1 death) and 25,168 non-severe patients enrolled in this study. Among the 25,207 cases, the median age was 45 years (IQR 33-54), and 65% patients were male. Cough (44.5%) and expectoration (38.4%) were the most two common symptoms. Hypertension (10.4%) and diabetes (3.5%) were most two common comorbidities. Most patients (81.1%) were fully vaccinated. The unvaccinated and partially vaccinated patients were 15.1% and 3.9%, respectively. The length of viral shedding time was six days (IQR 4-9) in non-severe patients. Multivariate logistic regression analysis suggested that age (OR=1.062, 95%CI 1.034-1.090, p<0.001), fever (OR=2.603, 95%CI 1.061-6.384, p=0.037), cough (OR=0.276, 95%CI 0.119-0.637, p=0.003), fatigue (OR=4.677, 95%CI 1.976-11.068, p<0.001), taste disorders (OR=14.917, 95%CI 1.884-118.095, p=0.010), and comorbidity (OR=2.134, 95%CI 1.059-4.302, p=0.034) were predictive factors for deterioration of SARS-CoV-2 omicron variant infection. Conclusions: Non-critical patients have different clinical characteristics from critical patients. Age, fever, cough, fatigue, taste disorders, and comorbidity are predictors for the deterioration of SARS-CoV-2 omicron variant infection.

Absolute bioavailability,dose proportionality,and tissue distribution of rotundic acid in rats based on validated LC-QqQ-MS/MS method / 药物分析学报

Rotundic acid(RA),an ursane-type pentacyclic triterpene acid isolated from the dried barks of Ilex rotunda Thunb.(Aquifoliaceae),possesses diverse bioactivities.To further study its pharmacokinetics,a simple and sensitive liquid chromatography with triple quadrupole mass spectrometry(LC-QqQ-MS/MS)method was developed and validated to quantify RA concentration in rat plasma and tissue using etofesalamide as an internal standard(IS).Plasma and tissue samples were subjected to one-step protein precipitation.Chromatographic separation was achieved on a ZORBAX Eclipse XDB-C18 col-umn(4.6 mm×50 mm,5 μm)under gradient conditions with eluents of methanol:acetonitrile(1∶1,V/V)and 5mM ammonium formate:methanol(9∶1,V/V)at 0.5mL/min.Multiple reaction monitoring transitions were performed at m/z 487.30 → 437.30 for RA and m/z 256.10 → 227.10 for IS in the negative mode.The developed LC-QqQ-MS/MS method exhibited good linearity(2-500 ng/mL)and was fully validated in accordance with U.S.Food and Drug Administration bioanalytical guidelines.Dose proportionality and bioavailability in rats were determined by comparing pharmacokinetic data after single oral(10,20,and 40 mg/kg)and intravenous(10 mg/kg)administration of RA.Tissue distribution was studied following oral administration at 20 mg/kg.The results showed that the absolute bioavailability of RA after administration at different doses ranged from 16.1％to 19.4％.RA showed good dose proportionality over a dose range of 10-40 mg/kg.RA was rapidly absorbed in a dose-dependent manner and highly distributed in the liver.In conclusion,this study is the first to systematically elucidate the absorption and distribution characteristics of RA in rats,which can provide additional information for further development and evaluation of RA in drug metabolism and pharmacokinetic studies.

Exploration of the Hsa-miR-1587-Protein Interaction and the Inhibition to CASK.

Hsa-miR-1587 has been found to be capable of forming G-quadruplex structures and is overexpressed in multiple cancer cell lines. Here, we explored the interactions between miR-1587 and proteins. HuProt™ human proteome microarray was utilized to screen the binding proteins, and it was discovered that CASK could bind to miR-1587 on the base of the G-quadruplex structure. Moreover, reelin and p21, which are downstream of CASK, were downregulated both transcriptionally and translationally by miR-1587, uncovered by q-RT-PCR and Western blot assays. Bioinformatic analysis was performed on STRING and Panther platforms, leading to the discovery that miR-1587 may be involved in intracellular metabolic and transcriptional physiological processes. This study explores the interaction of hsa-miR-1587 with proteins and provides a new strategy for the regulation of G-rich microRNA's function.

Novel roles of an intragenic G-quadruplex in controlling microRNA expression and cardiac function.

Simultaneous dysregulation of multiple microRNAs (miRs) affects various pathological pathways related to cardiac failure. In addition to being potential cardiac disease-specific markers, miR-23b/27b/24-1 were reported to be responsible for conferring cardiac pathophysiological processes. In this study, we identified a conserved guanine-rich RNA motif within the miR-23b/27b/24-1 cluster that can form an RNA G-quadruplex (rG4) in vitro and in cells. Disruption of this intragenic rG4 significantly increased the production of all three miRs. Conversely, a G4-binding ligand tetrandrine (TET) stabilized the rG4 and suppressed miRs production in human and rodent cardiomyocytes. Our further study showed that the rG4 prevented Drosha-DGCR8 binding and processing of the pri-miR, suppressing the biogenesis of all three miRs. Moreover, CRISPR/Cas9-mediated G4 deletion in the rat genome aberrantly elevated all three miRs in the heart in vivo, leading to cardiac contractile dysfunction. Importantly, loss of the G4 resulted in reduced targets for the aforementioned miRs critical for normal heart function and defects in the L-type Ca2+ channel-ryanodine receptor (LCC-RyR) coupling in cardiomyocytes. Our results reveal a novel mechanism for G4-dependent regulation of miR biogenesis, which is essential for maintaining normal heart function.

Study on the mechanism of miR-6751-3p affecting the proliferation and migration of gastric cancer cells / 国际外科学杂志

Objective:To explore the influence of microRNA (miRNA)-6751-3p expression on the proliferation and migration of gastric cancer cells and its molecular mechanism.Methods:Real-time quantitative polymerase chain reaction (qRT-PCR) was used to detect the expression level of miR-6751-3p in gastric cancer cell lines (MGC803, BGC823, SGC7901, HS-746T) and normal gastric mucosal epithelial cells (GES-1). The gastric cancer cell lines with the lowest expression level of miR-6751-3p were divided into control group and experimental group, and were transfected with miR-NC and miR-6751-3p mimics respectively. qRT-PCR detected the expression level of miR-6751-3p in the two groups of cells. CCK-8 method and scratch healing test were used to detect the proliferation and migration of miR-6751-3p overexpressing cells. The potential target genes of miR-6751-3p were predicted through Deepbase v2.0 and microRNA.org online websites, and the dual luciferase reporter gene experiment was used to verify. qRT-PCR and Western blot were used to detect the expression of target genes in miR-6751-3p overexpression cells.Results:Compared with normal gastric mucosal epithelial cells, the expression of miR-6751-3p was significantly down-regulated in gastric cancer cell lines ( P<0.05), and the cell line with the lowest expression level was MGC803 cells ( P<0.01). Compared with the control group, overexpression of miR-6751-3p can inhibit the proliferation ability ( P<0.05). The scratch healing rate of MGC803 cells in the control group and the experimental group were (65.14±5.65)% and (23.40±6.78)%, respectively. Compared with the control group, the scratch healing rate of MGC803 cells in the experimental group was significantly lower ( t=4.73, P<0.01). The online website predicts that the target gene of miR-6751-3p may be fatty acid binding protein 5 ( FABP5), and miR-6751-3p can complementally bind FABP5 messenger RNA (mRNA) ( t=4.01, P<0.01). Compared with the control group, overexpression of miR-6751-3p can inhibit the expression of FABP5 gene in MGC803 cells ( P<0.01). Conclusion:The expression of miR-6751-3p in gastric cancer cell lines is low, and the overexpression of miR-6751-3p can inhibit the proliferation and migration of gastric cancer MGC803 cells by down-regulating the FABP5 gene.

miRNA-5089-5p inhibits proliferation and migration of esophageal cancer cells by regulating the expression of cathepsin B in vitro / 肿瘤研究与临床

Objective:To investigate the effect of miRNA-5089-5p (miR-5089-5p) on proliferation and migration ability of esophageal cancer in vitro and its relationship with the expression of cathepsin B (CTSB) gene.Methods:Quantitative real-time polymerase chain reaction (qRT-PCR) was used to detect the expression levels of miR-5089-5p in 31 tissue samples from patients who underwent esophageal cancer resection and the corresponding pericarcinomatous tissues between in March 2017 and in December 2019 at Huangshi Central Hospital of Edong Healthcare Group, and TE-13, EC9706, Eca109, KYSE30 cell lines and normal esophageal mucosal epithelial HET-1A cells. The esophageal cancer cells with the lowest expression level of miR-5089-5p were divided into 2 groups: miR-5089-5p group transfected with miR-5089-5p mimics and the negative control group with negative control sequence. qRT-PCR was used to detect the expression level of miR-5089-5p after transfection for 48 h. CCK-8 method and scratch healing test were used to detect the proliferation and migration ability of cells in the two groups. The online tools microRNA.org and Deepbase v2.0 were used to predict the target genes of miR-5089-5p. The dual luciferase reporter gene assay was used to verify the target gene of miR-5089-5p. qRT-PCR and Western blot were used to detect the expression level of target genes in the two groups. The expressions of cell proliferation-related protein (PCNA and Ki-67) and migration-related protein (N-Cadherin and Twist) were detected by using Western blot.Results:The relative expression level of miR-5089-5p in esophageal cancer and pericarcinomatous tissues was 1.54±0.53 and 7.07±1.25, respectively ( t = 24.06, P < 0.01). The relative expression level of miR-5089-5p in the esophageal cancer cell lines was lower than that of normal esophageal mucosal epithelial HET-1A cells (all P < 0.05), and the cell line with the lowest relative expression was Eca109 cells (0.12±0.03). Compared with the negative control group, the proliferation ability of Eca109 cells in miR-5089-5p group was gradually reduced with the transfection time extension, and the difference was statistically significant between the two groups since 48 h (all P < 0.05), and the migration ability was also reduced [scratch healing rate: (29±5)% vs.(64±8)%, t=3.91, P < 0.01]. The online tool predicted that the target gene of miR-5089-5p might be CTSB, and the dual luciferase reporter gene assay confirmed that miR-5089-5p complemented CTSB 3'UTR. qRT-PCR results showed that compared with the negative control group, the relative expression level of CTSB mRNA in Eca109 cells of miR-5089-5p group was reduced (0.23±0.04 vs.1.01±0.09, t = 8.27, P < 0.01). Western blot results showed that the expression level of CTSB protein was reduced, and the expression levels of cell proliferation-related protein PCNA, Ki-67 and cell migration-related protein N-Cadherin, Twist were also reduced. Conclusions:The expression level of miR-5089-5p in esophageal cancer tissues and cell lines is low. miR-5089-5p can inhibit proliferation and migration of esophageal cancer Eca109 cells. The mechanism may be achieved by down-regulating CTSB gene expression.

Prevention and control of novel coronavirus pneumonia in non-government primary medical institutions / 中华全科医师杂志

Objective:To understand the coronavirus disease 2019(COVID-19)prevention and control work and the problems and difficulties faced by non-government primary medical institutions in China during the epidemic period.Methods:A survey on the coronavirus disease 2019(COVID-19)prevention and control work of non-government primary medical institutions was conducted on April 14 to 21, 2020 with the self-designed questionnaire. The questionnaire contained three parts: the first part was basic information of medical staff in non-government primary medical institutions, including position and institutional information; the second part was the status quo of non-government primary medical institutions participating in the prevention and control of COVID-19, including the specific work and difficulties faced by the responders during the epidemic period; and the third part was the prevention and control effect of COVID-19 in the responders′ institutions, including whether there were confirmed cases and infected medical staff. An online invitation was issued among the members of General Practice Branch of Chinese Non-government Medical Institution Association. The invited participants included the heads, general practitioners and other medical personnel of the non-government primary medical institutions the invited participants voluntarily scanned the online two-dimensional code to fill in.Results:A total of 761 individuals in primary health institutions from 20 provinces, municipalities and autonomous regions in China participated in the survey. There were 290 (38.1%) men and 471 (61.9%) women with age of 40(32, 48) years; 83.0% (632/761) had worked for more than 5 years; 33.8% (257/761) owned primary professional titles and 33.0% (251/761) owned intermediate titles. Among all participants 28.5% (217/761) were general practitioners, 26.9% (205/761) were institutions/department managers, 14.6% (111/761) were specialists and 40.3% (307/761) were other related personnel. A total of 549 institutions continued to operate during the epidemic period and 96.5% (530/549) participated in the work related to the prevention and control of the epidemic, including prescreening and triage, health consultation, follow-up of suspected patients, donation, quarantine of suspected cases, follow-up of close contacts/discharged patients, diagnosis and treatment of patients with new coronavirus pneumonia. 44.7% (340/761) of respondents participated in the epidemic prevention as front-line staff and directly contacted patients/suspected patients, and 63.1% (480/761) participated in the epidemic prevention work of primary medical institutions, including clinical outpatient service, prescreening triage and screening. The working sites were not limited to the institutions, but also other sites including high-speed railway station. The 97.8% (744/761) responders expressed their willingness to participate in epidemic prevention work under the unified leadership and command of the state. The 63.9% (486/761) of the responders were worried about the lack of protective equipments and measures, and 90.4% (688/761) respondents showed that they needed medical supplies (protective equipment: masks, goggles, protective gowns, etc.).Conclusion:The participation of non-government primary medical institutions and their staff in COVID-19 infection prevention and control is a key component of the epidemic prevention process.

Discrimination of common isomerides of methyl nucleosides by collision-induced dissociation tandem mass spectrometry.

The methyl-modified nucleosides (methyladenosine, methylguanosine, methylcytidine, and methyluridine) occur widely in nucleic acids and serve as biomarkers for a variety of types of diseases. Their isomers have the same parent ions in MS spectra and need further discrimination. Here, electrospray ionization mass spectrometry (ESI-MS) coupled with collision induced dissociation (CID) was used to distinguish the common isomerides of methyl-nucleosides. The various fragmentation patterns had been discussed in comparison of the different methyl modified nucleosides and were studied as a function of normalized collision energy. Then, structurally relevant fragments were obtained to efficiently identify characterization of methyl-nucleoside isomerides by collision induced dissociation. Therefore, this study provides a promising method using CID-MS for the discrimination of the isomeric methyl nucleosides, which could be useful to quantitative study of methyl nucleosides and detect of unknown methyl nucleosides.

Advantages and disadvantages of common methods of hip-conserving surgery for osteonecrosis of femoral head / 中国组织工程研究

BACKGROUND: There are many methods for the treatment of non-traumatic necrosis of the femoral head. In the clinical treatment, various stages of necrosis are the decisive factors for the choice of operation. In the past, there are many studies about the effectiveness of various techniques, but few studies concern the causes of failure or risk assessment. OBJECTIVE: To explore whether other internal and external factors affect the success rate of hip preservation besides necrosis stage. METHODS: The first author retrieved PubMed, Web of Science, Medline, CNKI and Wanfang database for related studies published from 2010 to 2019. The key words were “osteonecrosis of femoral head, core decompression, non-vascularized bone grafting, vascularized free bone grafting, porous tantalum rod implantation, osteotomy, biological agents, cytotherapy” in English, and “hip-conserving surgery, hip preservation, core decompression, bone graft without blood vessel, bone graft with blood vessel, porous tantalum rod placement, osteotomy, biologics, cell therapy” in Chinese. A total of 214 articles were retrieved, and the full text was consulted. Based on the inclusion and exclusion criteria, 70 articles were finally included for analysis and summary. RESULTS AND CONCLUSION: (1) The advantages and disadvantages of each hip-conserving surgery should be evaluated. (2) Although core decompression is simple, it should not be used alone; the lateral column should be reserved properly when the non-vascularized bone transplantation is used to clean up the dead bone, so as to deal with the mechanical weakening; the blood loss and fracture risk are higher when the vascularized bone transplantation is converted to total hip replacement; the stress concentration is easily caused by tantalum rod implantation, and the clinical application is less. (3) Osteotomy, as a kind of hip-conserving surgery with great trauma, should be planned in detail for patients’ age, body mass index, and necrotic range, besides considering the necrotic stage. (4) The risk of total hip replacement should be considered in the long run no matter which operation. (5) The combination of various surgical methods and biological agents may achieve better results.

Normal expression of KCNJ11 is maintained by the G-quadruplex.

MicroRNAs affect various pathological pathways by binding to multiple target mRNAs. Recently, it was reported that eukaryotic RNA G-quadruplexes were enriched in mRNA 3'-UTR, where microRNAs can also bind. To determine the roles of the G-quadruplex within mRNA 3'-UTR in microRNA binding sites, a bioinformatics approach was utilized to identify candidate microRNA target mRNAs with potential G-quadruplex formation. Circular dichroism spectrometry demonstrated the formation of RNA G-quadruplexes in vitro in candidate G-rich sequences. Mutated guanosines that are critical for G-quadruplex formation significantly decreased luciferase activities. Moreover, a G-quadruplex ligand TMPyP4 was used to destabilize the KCNJ11 RNA G-quadruplex in cardiomyocytes, resulting in binding of the microRNA to mRNA and subsequent suppression of KCNJ11 expression. In conclusion, our study showed that the G-quadruplex structure affects microRNA binding to its target mRNA. Thus, our study reveals a novel mechanism for G-quadruplex-dependent regulation of microRNA-mRNA interaction, which is essential to maintain normal gene expression.

Exploration of the Structure and Recognition of a G-quadruplex in the her2 Proto-oncogene Promoter and Its Transcriptional Regulation.

G-quadruplexes in oncogene promoters provide putative targets for transcriptional regulation. The structure of a putative G-quadruplex sequence (S1: GGAGAAGGAGGAGGTGGAGGAGGAGGG) in potassium solution in the her2 promoter has been resolved mainly through nuclear magnetic resonance (NMR) spectroscopy. By application of various NMR spectra, we proved the formation of a four-layer G-quadruplex composing of two G-tetrads and two G/A-mixed planes with a four-residues loop (A3-G4-A5-A6). Further evidence from a luciferase reporter assay, Q-RT-PCR and Western blotting indicates that S1 G-quadruplex formation can repress her2 promoter activity, and a selected G-quadruplex ligand cß can enhance the repression by down regulating her2 transcription and expression. These findings provide a G-quadruplex target and perspective implications in her2 transcriptional regulation.

Up- and downregulation of mature miR-1587 function by modulating its G-quadruplex structure and using small molecules.

Using bioinformatics analysis, we found some mature human miRNAs containing G-rich sequences with four G-tracts that had a high probability of forming G-quadruplex structures. Here, we chose G-rich miR-1587 as a model to characterize the function and regulation of miRNAs. Using electrospray ionization mass spectrometry, magnetic resonance imaging, circular dichroism spectrometry, we had confirmed that miR-1587 folded into a stable parallel G-quadruplex structure. By microarray, Q-RT-PCR and 3'UTR luciferase assay, TAGLN, an early marker of smooth muscle differentiation and tumor suppressor, was identified as a target gene of miR-1587, thus providing a direct target to study miR-1587 functions. We identified three aspects of miR-1587 regulation: 1) KCl induced miR-1587 G-quadruplex formation, reducing the interaction between miR-1587 and the target gene, and inhibiting miR-1587 function; 2) pseudopalmatine ligand further inhibited miR-1587 binding to TAGLN mRNA, which disrupted its function and increased the TAGLN expression; 3) the addition of TMPyP4 ligand interfered G-quadruplex formation, and significantly enhanced miR-1587 regulation of TAGLN expression. This study has revealed the possibility of using the G-quadruplex structure as a strategy to regulate miR-1587 function, showing potential for the development of up- and downregulation of mature G-rich microRNA function by modulating its G-quadruplex and using small molecules.

Summary and core technique on the origin and evolution of reinforcing-reducing manipulation achieved by lifting and thrusting the needle / 中国针灸

By analyzing the evolution of reinforcing-reducing manipulation achieved by lifting and thrusting the needle recorded in ancient literature of traditional Chinese medicine, it is found that the main contents of reinforcing-reducing manipulation by lifting and thrusting the needle include manipulating speed change, manual amplitude, insertion layer, gender, the direction to the acupuncture receiver, forenoon and afternoon and relevant quantity. Among them, gender, the direction to the acupuncture receiver, forenoon and afternoon and relevant quantity are the unnecessary parameters, while the manipulating speed change, manual amplitude and insertion layer are the indispensable parameters. The manipulating speed change is the core of the necessary parameters for the reinforcing-reducing manipulation achieved by lifting and thrusting the needle. Combined with the manual amplitude, the manipulating speed of needle determines the volume of needling stimulation. The insertion layer is decided on the base of the clinical demand. In the core technique of reinforcing-reducing manipulation by lifting and thrusting the needle, the reinforcing is achieved by thrusting the needle forcefully and quickly and then lifting the needle body slowly and evenly back to the original layer. The reducing is achieved by lifting the needle forcefully and quickly and then thrusting the needle body slowly and evenly back to the original layer. The manipulating speed and manual amplitude of needling are the parameters to quantize acupuncture manipulation. In association with the acupuncture effects in human body, these parameters contribute to the interpretation of the dose-effect relationship of acupuncture and the improvement of clinical effects.