[The Role of Cysteine Residues in the Interaction of Nicking Endonuclease BspD6I with DNA].

Nicking endonucleases (NEs) are a small, poorly studied family of restriction endonucleases. The enzymes recognize a target sequence in DNA, but catalyze the hydrolysis of only one strand. The mechanism of their action is important to study because NEs with new specificities are necessary to design to solve the practical tasks of biotechnology. One of the modern approaches for investigation of protein-nucleic acid interactions is fluorescence spectroscopy, which involves the introduction of fluorophores into proteins, mainly through Cys residues due to the high reactivity of their thiol group. To implement this approach, it is necessary to clarify the role of Cys residues in the functioning of the native protein and the possible consequences of their modification. Crosslinking was used to study whether Cys residues are close to DNA in the complex with NE BspD6I. Reactions were carried out using the wild-type enzyme, its mutant form NE BspD6I(C11S/C160S), and modified DNA duplexes containing the 2-pyridyldisulfide group at the C2' atom of the sugar-phosphate moiety in different positions of the oligonucleotide strand. The Cys residues of NE BspD6I were for the first time shown to be in close proximity to DNA during the binding process, including the step of a nonspecific complex formation. The substitutions C11S and C160S in the N-terminal domain of the enzyme slightly decreased the efficiency of substrate hydrolysis. Construction of a cysteine-free NE BspD6I variant and examination of its properties will provide additional information about the functional significance of the Cys residues for this unique enzyme.

Nicking endonucleases.

Nicking endonucleases are a new type of enzymes. Like restriction endonucleases, they recognize short specific DNA sequence and cleave DNA at a fixed position relatively to the recognition sequence. However, unlike restriction endonucleases, nicking endonucleases cleave only one predetermined DNA strand. Until recently, nicking endonucleases were suggested to be naturally mutated restriction endonucleases which had lost their ability to dimerize and as a result the ability to cleave the second strand. We have shown that nicking endonucleases are one of the subunits of heterodimeric restriction endonucleases. Mechanisms used by various restriction endonucleases for double-stranded cleavage, designing of artificial nicking endonucleases on the basis of restriction endonucleases, and application of nicking endonucleases in molecular biology are reviewed.

Nickase and a protein encoded by an open reading frame downstream from the nickase BspD6I gene form a restriction endonuclease complex.

We are the first to have isolated a protein (186 amino acid residues) encoded by the open reading frame adjacent to the end of the BspD6I nickase (N.BspD6I) gene. Cleavage of both DNA strands near the sequence recognized by nickase (5 -GAGTC/5 -GACTC) occurs when this protein is added to the reaction mixture containing N.BspD6I. The protein encoded by the open reading frame and the nickase are suggested to be subunits of heterodimeric restriction endonuclease R.BspD6I.

Regulatory C protein of the EcoRV modification-restriction system.

The C gene product of the modification-restriction system PvuII binds to its own promoter (C box) and stimulates transcription of both the C gene and the endonuclease gene. According to our data the same regulatory mechanism is realized in the EcoRV system. It was found that upstream of the EcoRV endonuclease gene two ATG codons give rise to two open reading frames (ORF1 and ORF2) ending at the same point inside the endonuclease gene. Two DNA fragments corresponding to ORF1 and ORF2 were cloned, and the homogenous products of proteins encoded by them were found to be DNA-binding proteins. A specific DNA sequence (C box) recognized by the proteins was determined with DNAse I footprinting. The C box CCCATTTTGGGTTATCCCATTTTGGG is located inside ORF1 and, similar to the PvuII C box consisting of tandem repeats of 11 nucleotides, is divided by four nucleotides. In its turn each of the repeats contains inverted repeats of four terminal nucleotides. The EcoRV C box sequence differs both from the PvuII C box sequence and from the proposed consensus sequence of C boxes in other modification-restriction systems.