Sequence-dependent conformational changes in DNA induced by polynuclear platinum complexes.

In this work, the B-->Z transition of poly(dG-dC).poly(dG-dC) and the B-->A transition of poly(dG).poly(dC) and of calf thymus (CT) DNA fragments modified by antitumor bifunctional polynuclear platinum complexes were investigated by circular dichroism (CD). The transition from the B- to Z-form of DNA was inducible with all three compounds studied, as indicated by an inversion of the B-form spectra. The B-->A transition in poly(dG).poly(dC) was induced easily by platinum complex binding alone, while the B-->A transition in CT DNA was induced by ethanol but inhibited by coordination of all polynuclear platinum compounds used here. It was shown that the compound [¿cis-PtCl(NH3)2¿2 mu-¿H2N(CH2)6NH2¿] (NO3)2 (1,1/c,c) was most effective at inhibiting the B-->A transition in CT DNA, and [¿trans-PtCl(NH3)2¿2 mu-¿trans-Pt(NH3)2(H2N(CH2)6NH2)2¿] (NO3)4 (1,0,1/t,t,t) was least effective, while the effectiveness of [¿trans-PtCl(NH3)2¿2 mu-¿H2N(CH2)6NH2¿] (NO3)2 (1,1/t,t) fell between the two. This corresponded to the relative amounts of interstrand crosslinks in double-stranded DNA caused by each compound.

DNA modifications by antitumor trans-[PtCl2(E-iminoether)2].

Recent findings that an analogue of clinically ineffective transplatin, trans-[PtCl2(E-iminoether)2], exhibits antitumor activity has helped reevaluation of the empirical structure-antitumor activity relationship generally accepted for platinum(II) complexes. According to this relationship, only the cis geometry of leaving ligands in the bifunctional platinum(II) complexes, should be therapeutically active. Global modifications of natural DNAs in cell-free media by trans-[PtCl2(E-iminoether)2] were studied through various molecular biophysical methods and compared with modifications by cis-[PtCl2(E-iminoether)2], transplatin, cisplatin, and monofunctional chlorodiethylenetriamineplatinum(II) chloride. Thus, the results of this study have extended our recent finding, indicating that the prevalent lesion occurring in double-helical DNA on its modification by trans-[PtCl2(E-iminoether)2] is a monofunctional adduct at guanine residues. The modification by trans-[PtCl2(E-iminoether)2] has been found to induce local distortions in DNA, which have a character differing fundamentally from those induced by both clinically ineffective or antitumor platinum complexes tested in this study. The different character of alterations induced in DNA by the adducts of trans-[PtCl2(E-iminoether)2] and transplatin has been suggested to be relevant to the unexpected observation that the new complex with leaving chloride groups in trans position exhibits antitumor efficacy. In addition, the results support the idea that platinum drugs that bind to DNA in a manner fundamentally different from that of cisplatin can exhibit altered biological properties, including differing spectra and intensities of antitumor activity.

The effect of antitumor trans-[PtCl2(E-iminoether)2] on B-->Z transition in DNA.

The B-->Z transition of DNA modified by platinum(II) complexes has attracted considerable interest because of a possible relationship with the molecular mechanism of antitumor activity of these metal-based compounds. Until recently it was generally accepted that the cis geometry of leaving groups in the bifunctional platinum(II) complexes should be therapeutically active. This paradigm had to be abandoned recently due to the finding that several analogues of clinically ineffective trans-diamminedichloroplatinum(II) (transplatin) exhibit antitumor activity. One of these therapeutically active trans compounds is trans-dichlorobisiminoetherplatinum(II) (trans-EE) [iminoether = E-HN = C(OMe)Me]. In view of the fact that DNA is the main pharmacological target for platinum(II) complexes and that these complexes attack preferentially guanine residues in DNA, it is of interest to examine the effect of iminoether platinum(II) complexes on the conformation of double-stranded poly(dG-dC) and its synthetic analogues. As these polymers can undergo the B-->Z transition, we have investigated in detail the effect of trans-EE and its cis isomer (cis-EE) on this conformational transformation using different techniques. They include circular dichroism spectroscopy, Raman spectroscopy and immunochemical assay employing specific antibodies against Z-DNA. It has been shown that cis-EE somewhat facilitates the B-->Z transition induced by increasing NaCl concentration and radically lowers its cooperativity. The polymers modified by cis-EE at low or high salt concentrations have been found to adopt distorted conformations which belong to the B and Z families respectively. Thus, cis-EE affects the B-->Z transition in DNA in a way similar to antitumor cis-diamminedichloroplatinum(II) (cisplatin). On the other hand, trans-EE was found to affect B-->Z transition (its cooperativity or the NaCl concentration corresponding to the midpoint of the salt-induced transition) only slightly. This behavior of trans-EE was, however, fundamentally different from that of clinically ineffective transplatin, which hinders B-->Z transition and lowers its cooperativity. The different effects of trans-EE on the B-->Z transition in comparison with the effects of cisplatin, transplatin and monofunctional chlorodiethylenetriamineplatinum(II) chloride are consistent with a unique DNA binding mode of this new antitumor trans compound, which might be associated with its unexpected biological efficacy.

DNA interactions of bifunctional dinuclear platinum(II) antitumor agents.

Modifications of natural DNA in a cell-free medium by dinuclear bisplatinum complexes with equivalent coordination spheres, represented by the general formula [¿trans-PtCl(NH3)2¿2(H2N-R-NH2)]2+, where R is a propane or hexane, were studied by various methods of biochemical analysis or molecular biophysics. These methods include binding studies by means of differential-pulse polarography, measurements of melting curves with the aid of absorption spectrophotometry, measurements of CD spectra, ELISA with specific antibodies that recognize DNA modified by platinum complexes, interstrand cross-linking assay employing gel electrophoresis under denaturing conditions and mapping of DNA adducts by means of transcription assays. The results indicated that the major adduct of [¿trans-PtCl(NH3)2¿2(H2N-R-NH2)]2+ in DNA was an interstrand cross-link which was formed with a relatively short half-time (approximately 1 h). At least some types of these interstrand cross-links induced local denaturational changes in the DNA. The results of analyses of interactions of [¿trans-PtCl(NH3)2¿2(H2N-R-NH2)]2+ with linear DNA at relatively higher levels of the modification could be interpreted to mean that these dinuclear platinum complexes were also capable of intrastrand-cross-link formation between adjacent base residues in DNA. However, these intrastrand adducts of [¿trans-PtCl(NH3)2¿2(H2N-R-NH2)]2+ distorted DNA conformation in a way different from the DNA intrastrand adducts of cisplatin. In addition, the DNA adducts of the dinuclear platinum complexes inhibited DNA transcription in vitro. The length of the aliphatic linker chain affected the DNA-binding mode of [¿trans-PtCl(NH3)2¿2(H2N-R-NH2)]2+ and the resulting conformational changes in DNA. The extensive analysis of DNA interactions with [¿trans-PtCl(NH3)2¿2(H2N-R-NH2)]2+ described in this communication has provided further experimental support for previous suggestions [Farrell, N. (1991) in Platinum and other metal coordination compounds in cancer chemotherapy (Howell, S. B., ed.) pp. 81-91, Plenum Press, New York] that the binding of the dinuclear platinum complexes modifies DNA in a way that is different from the modification by antitumor cisplatin. Thus, the results of this work are consistent with the hypothesis that platinum drugs that bind to DNA in a manner fundamentally different from that of cisplatin can exhibit altered biological properties, including a different spectrum and intensity of antitumor activity.

The effect of ionic strength on melting of DNA modified by platinum(II) complexes.

Thermal denaturation of calf thymus DNA modified by antitumor cis-diamminedichloroplatinum(II) (cis-DDP) and by two related Pt(II) compounds which had been shown to be clinically ineffective, viz. trans-diamminedichloroplatinum(II) (trans-DDP) or monodentate diethylenetriaminechloroplatinum(II) chloride [[Pt(dien)Cl)]Cl], was studied by monitoring changes of absorbance at 260 nm. The melting of DNA platinated to different levels was investigated in neutral media containing varying concentrations of Na+. It has been shown that the ionic strength has a strong influence on the character and magnitude of changes in the melting temperature of DNA (Tm) induced by the platination. The modification of DNA by either platinum complex used in this work results in an increase of Tm if DNA melting is measured in media containing low Na+ concentrations (ca. 1 mM). This effect is reversed at higher Na+ concentrations. The concentration of Na+ at which this reversal occurs is, however, markedly lower for DNA modified by cis-DDP than for DNA modified by the other two platinum complexes. These results have been interpreted to mean that at least three factors affect the thermal stability of DNA modified by the platinum(II) complexes: stabilization effects of the positive charge on the platinum moiety and of interstand cross-links, and a destabilization effect of conformational distortions in DNA. Thus, in order to compare and interpret the melting behavior of DNA modified by different compounds, a great attention has to be paid to the composition of the medium in which the melting experiments are carried out.

Interaction of organophosphorus insecticide methylparathion with calf thymus DNA and a synthetic DNA duplex.

The interaction of an organophosphorus insecticide methylparathion (O,O-dimethyl O-4-nitrophenyl phosphorothioate) with double-stranded DNA was characterized by UV and circular dichroism (CD) spectroscopy. Two kinds of DNA were employed: calf thymus DNA (CT DNA) and a synthetic two-stranded oligomer of sequence 5'-d(TTGGATCCGAATTCAAGCTT)-3'. Melting curves and CD spectra were taken for the DNAs in the presence of the insecticide at methylparathion/DNA base pair molar ratio of 0.5. The insecticide evoked a decrease of the melting temperature and a broadening of the transition range for CT DNA. Similar effects were observed for the synthetic oligomer but they were less pronounced than in the case of CT DNA. Methylparathion evoked a slight shift and an increase in the amplitude of the negative band in the CD spectra of both DNAs. Obtained results indicate that methylparathion may perturb the thermal stability and conformation of DNA, which is an evidence that the insecticide has an ability to interact directly with DNA.

Reaction of cis and trans isomers of platinum(II) diamminedichloride with purine, adensine and its derivatives in dilute solutions.

Reactions of the cytostatic and antitumour agent, cis-platinum(II) diamminedichloride, and its trans isomer with purine, adenine and its N-9 derivatives were followed spectrophotometrically in dilute aqueous solutions. While the cis isomer formed with all compounds studied complexes with the metal-to-ligand ratios ML, ML2 and M2L, it was found that the trans isomer did not form the complexes ML2 with adenosine and AMP. The values of dissociation constants, reaction rate constants and activation energies of the reactions of the cis and trans isomers with purine, adenine, and its derivatives were in most cases comparable. Lower stability was exhibited only by the complexes of trans-platinum(II) diamminedichloride (trans-Pt(II)) with AMP as well as by its complexes M2L with adenine and adenosine. The ability of cis-platinum(II) diamminedichloride (cis-Pt(II)) to react with two adenine residues can explain the greater tendency of the cis isomer to form intrastrand cross-links in nucleic acids as compared with the trans isomer.