Singing training predicts increased insula connectivity with speech and respiratory sensorimotor areas at rest.

The insula contributes to the detection of salient events during goal-directed behavior and participates in the coordination of motor, multisensory, and cognitive systems. Recent task-fMRI studies with trained singers suggest that singing experience can enhance the access to these resources. However, the long-term effects of vocal training on insula-based networks are still unknown. In this study, we employed resting-state fMRI to assess experience-dependent differences in insula co-activation patterns between conservatory-trained singers and non-singers. Results indicate enhanced bilateral anterior insula connectivity in singers relative to non-singers with constituents of the speech sensorimotor network. Specifically, with the cerebellum (lobule V-VI) and the superior parietal lobes. The reversed comparison showed no effects. The amount of accumulated singing training predicted enhanced bilateral insula co-activation with primary sensorimotor areas representing the diaphragm and the larynx/phonation area-crucial regions for cortico-motor control of complex vocalizations-as well as the bilateral thalamus and the left putamen. Together, these findings highlight the neuroplastic effect of expert singing training on insula-based networks, as evidenced by the association between enhanced insula co-activation profiles in singers and the brain's speech motor system components.

Breast cancer and physical activity: A bibliometric analysis.

Breast cancer is a pathology suffered by millions of women worldwide, affecting the mental health, quality of life (QoL), physical functioning, cognitive functioning, and social and work life of surviving patients. Moreover, breast cancer is associated with weight gain, muscle atrophy, and weakness. Physical exercise appears to be an effective non-pharmacological treatment to improve short-term self-esteem, QoL, fatigue, and psychological factors such as depression, anxiety, happiness, and body image. The practice of physical activity is also associated with a reduction in the side effects of treatment. This bibliometric analysis analyzed the trend followed by publications on breast cancer and physical activity. The Web of Science database was used, and bibliometric laws were applied to identify the most prolific authors, the journals most involved in the field, and the countries, institutions, and keywords most used by the authors. Breast cancer and physical activity have an exponential trend in the number of publications, with Psycho-Oncology being the journal with the highest number of publications.

Nematicidal effect of rhizobacteria on plant-parasitic nematodes associated with vineyards.

The action of metabolites and exoenzymes from rhizobacteria on different plant-parasitic nematodes has an influence on the nematicidal efficacy of the microbe. Seven rhizobacteria, divided into two bacterial groups, were evaluated in vitro for nematicidal activity on Meloidogyne ethiopica and Xiphinema index. The direct effect of their filtrates on egg hatching and juveniles of M. ethiopica as well as mobile stages of X. index was evaluated during a 72-h period. The production of four exoenzymes and two metabolites associated with nematode mortality was investigated. Molecular characterization of three isolates was performed, and the physiological profiles and lipase activity of all isolates were obtained using the BIOLOG EcoPlate system. While chitinase and collagenase were measured using the BIOLOG MT2 plate system, protease, hydrogen cyanide and hydrogen sulphide were directly determined in Petri dishes. Nematode mobile stages exposure to the bacterial filtrate revealed a nematicidal effect up to 93.7% on X. Index and up to 83.3% on M. ethiopica. The control of egg hatching varied between 35 and 85%. A positive correlation was found between the mortality of both nematode mobile stages and the concerted activities of the bacterial enzymes as well as the level of the volatile metabolites. The nematicidal effect of rhizobacteria strains varies by nematode genera and among the developmental stages evaluated.

First Report of Cherry green ring mottle virus and Cherry necrotic rusty mottle virus in Sweet Cherry (Prunus avium) in Chile and South America.

Cherry green ring mottle virus (CGRMV) infects several Prunus species, while Cherry necrotic rusty mottle virus (CNRMV) has been detected mainly in sweet cherry. In Chile, sweet cherry represents one of the most valuable fruit crops, and the country is the main producer of cherries in the southern hemisphere. In October 2011, leaf samples were collected from 21 trees of cv. Bing in Libertador General Bernardo O'Higgins and Maule regions. Leaves of symptomatic plants showed brown angular necrotic spots, the center of which can drop out giving a shot-hole appearance. Total RNA was extracted by the silica capture method (1). Reverse transcription (RT)-PCR was carried out to test the presence of CGRMV and CNRMV using primer pairs GRM7950/GRM8316 (1), and DetCNR-F (TCCCACCTCAAGTCCTAGCAGAGA) / DetCNR-R (TCATTGCTAATTGCAAAATCCCA). Ten and six samples were tested positive for CGRMV and CNRMV, obtaining 366- and 333-bp fragments, respectively. Mixed infections occurred in five samples. Two sets of primer pairs were designed to amplify a region of the genome which includes the entire coat protein (CP) gene: CGRM-CPF (GGCTGATGAAGAATTTGA-GAAG) and CGRM-CPR (GAGTGGAATTGCAGGGGTTT), and CNRM-CPF (GAGTGTGTGTGAGCTTTCAAGTT) and CNRM-CPR (TTCGCCCCGTGTTGTAAAAC). Amplicons of the expected size of 828 bp (CGRMV) and 892 bp (CNRMV) were obtained from infected samples. Three amplicons for each virus were cloned into pGEM-T and three colonies per cloned fragment were sequenced in both directions. For CNRMV, Chilean isolates CP9754 (GenBank Accession No. KC432619) and CP9956N (KC432621) had 98% for nucleotide identity with isolate JK10 from India (FN546178), while isolate CP9879 (KC432620) had 97% of nucleotide identity. For CGRMV, Chilean isolate CP3359 (KC432616) had 98% identity with isolate HI17 from Poland (JX468873), while isolates CP9731 (KC432617) and CP9956G (KC432618) had 98% and 99% nucleotide identity with isolate ita7 (AF533161) from Italy, respectively. Nucleotide and amino acid sequence identity between Chilean isolates of CGRMV ranged between 94.5% and 99.3%, and from 97.8% to 99.2%, respectively. For Chilean isolates of CNRMV, sequence identity ranged between 98.0% and 98.5% (nucleotide), and from 98.6% to 98.9% (amino acid). Sequence analysis indicated that CGRMV isolates found in Chile belong to group II (3). Detection was confirmed by non-isotopic molecular hybridization. Riboprobes were designed on the basis of a consensus sequence of CP gene and labeled with digoxigenin (2); are complementary to the fragments located from the nucleotide 7415 to 7576 for CGRMV (reference sequence NC 001946.1), and 7475 to 7638 for CNRMV (reference sequence NC 002468.1). The cultivar Bing manifested symptoms only when infected by CNRMV. Results suggest that CNRMV is the cause of symptoms and yield loss observed in Bing, the most important cherry variety cultivated in Chile. To our knowledge, this is the first report of CGRMV and CNRMV infecting sweet cherry in South America. References: (1) M. E. Rott and W. Jelkmann. Eur. J. Plant Pathol. 107:411, 2001. (2) J. A Sánchez-Navarro et al. Plant Pathol. 47:780, 1998. (3) Y. P. Zhang et al. J. Plant. Pathol. 82:49, 2000.

[Superficial femoral vein thrombosis due to large psoas bursitis secondary to particle disease in total hip arthroplasty]. / Trombosis de vena femoral superficial por bursitis del psoas posterior a artroplastía total de cadera.

Male, 76 year-old patient with a history of total hip arthroplasty who presents with a mass in the iliac fossa with swelling of the thigh and hip pain upon flexion and extension. Complementary ultrasound and computed tomography scan studies show a giant lobulated cystic mass in the left iliac fossa, 7 cm in diameter, near the prosthesis. Cyst formation caused by polyethylene disease after total hip arthroplasty is infrequent. We present a case of large psoas bursitis secondary to the release of polyethylene particles which caused superficial femoral vein compression and thrombosis.

Systematic approach for severe respiratory failure due to novel A (H1N1) influenza.

AIM: In April 2009, a novel influenza A (H1N1) virus appeared in Mexico. It rapidly acquired the characteristics of a pandemic disease. Our objective is to present a case series of mechanically ventilated patients with severe influenza, treated with a systematic approach. METHODS: Prospective, observational, single-center study in a University Hospital. A (H1N1) virus was confirmed by rRT-PCR. In this report, we only considered patients that required mechanical ventilation (MV). All patients received antibiotics, steroids and oseltamivir from the time of admission. The main strategies incorporated in the systematic approach were a lung-protective strategy, PEEP adjusted for each patient, protocol-guided sedoanalgesia, restrictive fluid management, weaning protocol, and prolonged prone ventilation and extracorporeal membrane oxygenation (ECMO) as rescue therapies. RESULTS: We studied 19 patients: age 41 ± 13 years old, APACHE II 16 ± 7 and SOFA 8 ± 4. All patients presented PaO2/FiO2 ≤ 200 before connection to MV. Their worst values within the first 24 hours for oxygenation index, PaO2/FiO2, and PaCO2 on MV were 21.8 ± 13, 98 ± 39, and 48 ± 16 mmHg, respectively. Sixteen patients achieved ARDS; three exhibited acute lung injury criteria. Ten required a prone position, and two required ECMO (one patient required both therapies). Time on MV was 16 ± 13 days. Length of stay in the ICU and in hospital was 18 ± 12 and 28 ± 17 days, respectively. Mortality was 21%. CONCLUSION: Severe hypoxemia and a high rate of rescue therapies were observed among our patients. Nevertheless, mortality was lower than previously reported in comparable populations, which may be related to the management by a critical care team and the use of a systematic approach for ventilatory and non-ventilatory therapeutic strategies.

[Thrombosis of the superficial femoral vein due to psoas bursitis secondary to particle disease in total hip arthroplasty]. / Trombosis de la vena femoral superficial por bursitis del psoas secundaria a enfermedad de las partículas en artroplastía total de cadera.

The case of a male 76 year-old patient with a history of total hip replacement surgery is presented herein. The patient had tumors in the iliac fossa with swelling of the thigh and pain upon hip flexion and extension. The complementary ultrasound and computed tomography show a large lobed cystic tumor in the left iliac fossa, 7 cm in diameter, close to the prosthesis. The diagnosis was psoas bursitis secondary to the release of polyethylene particles that caused compression and thrombosis of the superficial femoral vein. Cyst formation caused by polyethylene disease after total hip arthroplasty is infrequent.

Efectos de la ventilación en posición prono extendida en SDRA secundario a influenza A(H1N1) / Impact of extended prone position ventilation in patients with severe ARDS secondary to influenza A(H1N1)

Introducción: Durante la pandemia por influenza A(H1N1), Chile alcanzó una de las tasas de casos más alta del mundo. Nuestro hospital recibió numerosos afectados el 2009 y 2010. Evaluamos el impacto de ventilación en posición prono (VPP) extendida, en las variables respiratorias de pacientes con SDRA grave secundario a influenza, y comparamos estos resultados con los obtenidos en otras series de VPP. Métodos: Estudio prospectivo, intervencional en UCI. Los pacientes recibieron oseltamivir y antibióticos y fueron manejados según protocolos (ventilatorio y no ventilatorio). Aquellos con criterios de SDRA grave fueron pronados hasta un índice de oxigenación <10. Se registraron parámetros de intercambio gaseoso, ventilatorios y desenlaces clínicos. Resultados: 12 pacientes con SDRA grave (edad 46+/-12 años, 7 hombres, APACHE II 17+/-6, SOFA 9+/-3) requirieron VPP, que se instauró a las 14(7-39) horas de ventilación mecánica (VM) y se mantuvo por 72(54-96) horas. Ningún paciente experimentó complicaciones mayores. La PaO2:FiO2 mejoró de 82(63-101) mmHg a 145(138-223) mmHg, (p<0.001). El tiempo en VM fue 20+/-13 días y en UCI 22+/-13 días. La mortalidad hospitalaria fue 25 por ciento y no cambió en el seguimiento de más de 8 meses. Este comportamiento con VPP fue similar al observado en otras series de SDRA grave. Conclusión: Los resultados obtenidos sugieren que la VPP resultó segura y se asoció a mejoría del intercambio gaseoso en pacientes con SDRA por influenza A(H1N1). Aunque el número reducido de pacientes no permite sacar mayores conclusiones, la VPP extendida podría ser de utilidad en los casos más graves causados por esta nueva influenza.

Introduction: During pandemic for influenza A(H1N1), Chile achieved one of the highest rates of infection worldwide. On 2009 and 2010, our hospital received a large number of infected patients. We evaluated the impact of extended prone position ventilation (PPV) on respiratory variables from severe ARDS patients secondary to this influenza. We also compared these results with those obtained with PPV in other series. Methods: Prospective, interventional study, performed in a mixed-ICU. Patients received oseltamivir and antibiotics, and were treated according to protocols (ventilatory and non-ventilatory). Severe ARDS patients were proned until oxygenation index was < 10. Oxygen exchange, ventilatory parameters and clinical outcomes were registered. Results: 12 severe ARDS patients (46+/-12 y.o., 7 men, APACHE II 17+/-6, SOFA 9+/-3) required PPV, which was started 14(7-39) hours after mechanical ventilation (MV) initiation, and it was maintained for 72(54-96) straight hours. No major complication was described. Three patients needed two periods of PPV. PaO2:FiO2 improved significantly with PPV from 82(63-101) mmHg to 145(138-223) mmHg, (p<0.001). Time on MV was 20+/-13 days, and LOS in UCI was 22+/-13 days. Hospital mortality was25 percent and remained unchanged for at least 8 month of follow-up. PPV had the same effect than in other severe ARDS series. Conclusion: Our results suggest PPV is safe and it was associated with improvement in oxygen exchange in ARDS secondary to A(H1N1) influenza. Although the small number of patients does not allow drawing any major conclusion, we believe PPV can be useful to treat severe ARDS cases due to influenza infection.

Phytoplasmas Associated with Grapevine Yellows Disease in Chile.

An extensive survey was performed from 2002 to 2006 to detect and identify phytoplasmas associated with Chilean grapevines. Nested polymerase chain reaction assays using phytoplasma universal primer pairs P1/P7 and R16F2n/R2 detected phytoplasmas in 34 out of the 94 samples tested (36%). Restriction fragment length polymorphism (RFLP) analyses, cloning, and sequencing allowed identification of phytoplasmas belonging to ribosomal subgroups 16SrI-B, 16SrI-C, 16SrVII-A, and 16SrXII-A. The 16SrVII-A phytoplasma represents a new finding in grapevine; moreover, variability of the RFLP profile was observed in some of the 16SrXII-A phytoplasmas, indicating possible new ribosomal subgroups. Mixed phytoplasma infections and infections of phytoplasmas together with one or more viruses also occurred.

Resultados obstétricos asociados al incremento del índice de masa corporal durante el embarazo en el Hospital Clínico de la Universidad de Chile / No disponible

Introducción: Estudios previos muestran que el incremento en la categoría del índice de masa corporal (IMC) se asocia a un mayor riesgo de complicaciones obstétricas. Objetivo: Investigar el impacto que tiene el incremento del IMC durante el embarazo en los resultados obstétricos en el Hospital Clínico de la Universidad de Chile. Material y métodos: Estudio retrospectivo que incluye a embarazadas atendidas en el hospital entre el año 2001 y 2006. Las mujeres con embarazos únicos fueron clasificadas en las distintas categorías de IMC. El incremento del IMC se calculó como la diferencia entre el IMC del inicio y el del final de la gestación. Para comparar las variables categóricas se usó el test exacto de Fisher y para las variables continuas el test de la t para comparación de 2 medias. Resultados: El estudio incluyó a 5.478 mujeres: 568(10,48%) no incrementaron su categoría de IMC y4.910 (89,51%) aumentaron su IMC en 1 o más categorías. El incremento del IMC se asoció a mayor riesgo de preeclampsia (p = 0,004) y operación cesárea (p =0,009) en las pacientes con sobrepeso, no así en las pacientes con normopeso al inicio del embarazo. Las pacientes obesas presentan mayor riesgo de preeclampsia(p = 0,008), diabetes gestacional (p < 0,001), operación cesárea (p < 0,001) e infección posparto (p = 0,009).Conclusión: El incremento en la categoría de IMC se asocia a un aumento del riesgo de complicaciones obstétricas (AU)

Background: Previous studies have shown that an increase in body mass index (BMI) is associated with a greater risk of obstetric complications. Aim: To investigate the effect of an increase in BMI category on obstetric outcomes in Hospital Clínic of the University of Chile. Material and methods: A retrospective study was conducted of women followed-up in the hospital from2001 to 2006. Women with singleton pregnancies were placed in standard BMI categories. Increases in BMI were calculated as the difference between initial BMI and that at delivery. Fisher’s exact test was used to compare categorical variables and the t test between two means was used for continuous variables. Results: This study included 5,478 women: 568(10.48%) had no change in BMI category and 4.910(89.51%) increased their BMI by >= 1 category. An increase in BMI category was associated with higher rates of preeclampsia (p = 0.004) and cesarean delivery(p = 0.009) in overweight women but not in women with a healthy weight at the beginning of pregnancy. Obese women had a higher risk of preeclampsia (p =0.008), gestational diabetes (p < 0.001), cesarean delivery(p < 0.001), and postpartum infection (p = 0.009).Conclusions: An increase in BMI category is associated with a greater risk of obstetric complications (AU)

Relación entre bronquiolitis aguda con factores climáticos y contaminación ambiental / Association of acute bronchiolitis with climate factors and environmental contamination

BACKGROUND: Annually, acute bronchiolitis (AB) occurrence peaks during winter and is probably associated with air pollution. AIM: To relate the number of ambulatory consultations, emergency and hospital admission due to AB with climatic factors and air pollution. PATIENTS AND METHODS: Patients of less than 1 year old with AB that consulted to outpatient clinics, the emergency room or were admitted to the Pediatrics ward of the Catholic University Hospital, were enrolled. Information about respiratory syncytial virus (RSV) was obtained from the Catholic University Medical Investigation Center. Indices of air pollution such as particulate matters of less than 10 microns/m3 (PM 10), of less than 2.5 microns/m3 (PM 2.5), CO, SO3 and O3 were obtained from the Metropolitan Environmental Service. Temperature, humidity and precipitations were obtained from the Chilean Meteorological Service. RESULTS: Ninety nine consultations in out patient clinics and 442 in emergency rooms were collected (55 per cent male, mean age 4.8 months). One hundred fifty two were admitted (34.4 per cent). Thirty percent of children consulting in emergency rooms were younger than 3 months and 43 per cent of them were hospitalized. The RSV study was made in 307 patients and 52 per cent were positive. There was a higher rate of hospital admissions among RSV positive than RSV negative patients (52.5 and 22 per cent respectively, p < 0.001). No association between environmental variables or air pollution and the number of consultations was observed. Young age and smoking inside the household were the main risk factors for hospital admission due to acute bronchiolitis. CONCLUSIONS: Environmental variables did not influence the number of cases of acute bronchiolitis. Young age and exposure to tobacco smoke were risk factors for hospital admission.

Production of antimicrobial substances, by hospital bacteria, active against other micro-organisms.

Fifty-nine clinical strains of bacteria, isolated from patients in the Regional Hospital of Talca, were studied. Seventy-four percent of these strains produced antibacterial substances, in comparison with 18% of the same bacterial species obtained from patients from a non-hospital habitat. Almost all the bacteria isolated from hospitalized patients demonstrated in vitro resistance to different antimicrobial agents. Pseudomonas aeruginosa was the most frequent species producing antibacterial substances and its products were of high potency, with a wide spectrum of antimicrobial activity. Cure of plasmid DNA, in most of the antibacterial-producer strains, resulted in the loss of their lethal activity and they also became susceptible in vitro to anti-microbials. These results indicated that such properties are encoded in extrachromosomal DNA. We believe that the knowledge of the antimicrobial activity and resistance to antimicrobials of bacteria from a hospital habitat can help explain the selection and persistence of such strains in this particular ecological niche.

[Pattern of blood levels of erythropoietin and proinflammatory cytokines in patients with anemia of chronic disorders secondary to infection]. / Perfil de los niveles séricos de eritropoyetina y citocinas proinflamatorias en pacientes con anemia de trastornos crónicos secundaria a infección.

OBJECTIVE: To evaluate the pattern of erythropoietin (EPO) and some proinflammatory cytokines in the anemia of chronic disorders (ACD) secondary to infection. METHODS: Sequential determination in serum of interleukin-1 beta (IL-1 beta), necrosis tumoral factor alpha (TNF-alpha), gamma interferon (IFN-gamma), interleukin-6 (IL-6), and erythropoietin (EPO) in 25 patients with chronic bacterial infectious diseases and ACD criteria. We evaluated the relationship of these mediators with the anemia and the iron metabolism. RESULTS: Serum EPO levels significatively decreased compared with initial values, and the last control was in normal rank (18.04 +/- 19.10 vs. 8.56 +/- 4.72 UI/mL; p < 0.001; normal rank: 4-15 mUI/mL). In the first control, there was a negative and non significative correlation between the EPO levels and the hemoglobin concentration (r = -0.115, NS), reaching significance in the last control (r = -0.446; p < 0.05). There was negative correlation between the hematocrit and TNF-alpha levels (r = 0.467; p < 0.05) and between the haemoglobin values and the log of serum TNF-alpha (r = 0.424; p < 0.001). An inverse correlation between the IL-6 levels and both, the hemoglobin concentration and the serum iron was found, and there was a direct correlation between this cytokine values and the EPO levels. CONCLUSIONS: Blunted response of erythropoietin and the action of TNF may contribute to the pathogenesis of ACD secondary to infection. Positive correlation between IL-6 and EPO suggest a proerythropoietic action of IL-6 in response to the anemia.

Perfil de los niveles séricos de eritropoyetina y citocinas proinflamatorias en pacientes con anemia de trastornos crónicos secundaria a infección / Pattern of erythropoietin and proinflammatory cytokines in serum from patients with anemia of chronic disorders secondary to infection

Objetivo: Evaluar el comportamiento de la eritropoyetina (EPO) y determinadas citocinas proinflamatorias en la anemia de trastornos crónicos (ATC) de origen infeccioso. Métodos: Determinación secuencial en suero mediante enzimoinmunoanálisis de interleucina-1 beta (IL-1 ), factor de necrosis tumoral alfa (TNF- ), interferón gamma (IFN-), interleucina-6 (IL-6) y eritropoyetina (EPO) en 25 pacientes con enfermedades de origen bacteriano, curso clínico prolongado y criterios de ATC. Se analizó la relación de estos mediadores con la anemia y con el metabolismo del hierro. Resultados: Los niveles de EPO experimentaron un descenso significativo respecto al nivel inicial, normalizándose en el control tardío (18,04 ± 19,10 vs 8,56 ± 4,72 UI/mL; p < 0,001; rango normal: 4-15 mUI/mL). Inicialmente, existía correlación inversa no significativa entre los niveles de EPO y la concentración de hemoglobina (r = - 0,115, NS), alcanzándose significación estadística en el control tardío (r = -0,446; p < 0,05). Existía correlación inversa entre el hematocrito y los niveles del TNF- (r = 0,467; p < 0,05) y entre la hemoglobina y la transformación logarítmica del TNF (r = 0,424; p < 0,001). La IL-6 mostró correlación inversa con la hemoglobina (r = 0,366; p < 0,05) y con la sideremia (r = 0,614; p < 0,001), mientras que se correlacionó directamente con los niveles de la EPO (r = 0,297; p < 0,05). Conclusiones: Una deficiente respuesta de la eritropoyetina y la acción del TNF pueden implicarse en la patogenia de la ATC de origen infeccioso. La correlación positiva entre la IL-6 y la EPO sugiere una implicación proeritropoyética de la primera en respuesta a la anemia (AU)

Effects of exogenous neurotensin on intestinal postresectional growth in the suckling rat.

BACKGROUND: In the suckling rat, massive bowel resection provokes intestinal malabsorption that leads to diminished growth. The object of this report was to test whether neurotensin, intestinal trophic peptide, enhances postresection intestinal adaptation, improving absorption and reducing the adverse effects of resection on growth. METHODS: Fifty-seven 15-day-old suckling. Wistar rats were divided into four groups: 41 rats were subjected to resection of 90% of their small bowel, while the rest (n = 16) underwent laparotomy. Half of the animals, resected and laparotomized, were treated with neurotensin for 30 days. The body weight was monitored, and samples of bone and intestinal mucosa were obtained at the end of the study period for analysis. Blood was tested to determine iron, ferritin, folic acid, and vitamin B12 levels. RESULTS: The resected animals lost body weight regardless of neurotensin administration. In the resected animals, femur weight increased significantly when they received neurotensin. Bowel resection provokes significant increases in the intestinal mucosa (crypts and villi), but after neurotensin administration, significant increases were detected only in the jejunum of the resected animals but not in the ileum of laparotomized rats. In the resected animals, significant decreases in iron, ferritin, folic acid, and vitamin B12 levels were observed. The postresection administration of neurotensin only produced a significant rise in the ferritin concentration. CONCLUSIONS: In the suckling rat, neurotensin enhances the intestinal proliferative phenomenon but does not improve the course of medium-term postresection growth.

Serum erythropoietin levels in anaemic patients with advanced human immunodeficiency virus infection.

This study attempts to evaluate the adequacy of the erythropoietin (EPO) response in 42 anaemic patients with advanced human immunodeficiency virus (HIV) infection [30 with acquired immunodeficiency syndrome (AIDS) and 12 with AIDS-related conditions] by comparing their serum EPO levels with those found in a non-HIV reference population consisting of 36 patients with anaemia of chronic disorders (ACD) and 57 with iron deficiency anaemia (IDA). Although the average Hb concentration was similar in the three groups, the EPO level for HIV patients (mean +/- SEM, 64.3 +/- 7.7 mU/ml) did not differ significantly from that in ACD patients (45.3 +/- 8.3 mU/ml, P > 0.1), and both groups had a lower mean EPO level (P < 0.05 and P < 0.01 respectively) than IDA subjects (133.5 +/- 18.7 mU/ml). Thirteen HIV patients on zidovudine therapy showed similar mean Hb and EPO levels to those in the untreated patients. A significant inverse correlation between the log of serum EPO and the Hb values was observed in the three groups. However, this relationship was found to be stronger in IDA patients than in either HIV or ACD subjects (P < 0.001), with no difference between the two latter groups (P > 0.2). These data suggest that the EPO response is blunted in the anaemia associated with advanced HIV infection.

[The treatment of anemia in patients on hemodialysis with recombinant human erythropoietin]. / Tratamiento de la anemia de los pacientes en hemodiálisis con eritropoyetina humana recombinante.

BACKGROUND: Anaemia of chronic renal failure is primarily due to relative erythropoietin deficiency. This hormone has been recently cloned and it is now available for clinical use. METHODS: Sixteen patients maintained on haemodialysis with non-complicated anaemia and on stable clinical condition were selected for 12 months' treatment with r-HuEPO. Our aim was to analyse the factors influencing r-HuEPO response and the modifications on main haematological and biochemical parameters and adverse reactions occurrence. RESULTS: All patients responded with an increase of haemoglobin (from 78 +/- 9 to 103 +/- 18 g/dl at second month of therapy, p less than 0.001) and blood transfusions were eliminated. Time of response and doses were very different to one another. R-HuEPO requirements decreased slowly with time. Neither transfusion number, nor hyperparathyroidism, nor ferritin levels, nor diabetic condition influenced r-HuEPO response. Serum ferritin decreased significantly from 1,772 +/- 1,791 to 1,116 +/- 1,240 ng/ml (p less than 0.05), especially in patients without iron overload. Serum vitamin B12 levels did not decrease significantly. Both uric acid and phosporus increased significantly after the treatment period (5.25 +/- 1.18 to 6.29 +/- 0.99 mg/dl and 5.78 +/- 1.29 to 6.69 +/- 1.55 mg/dl respectively, p less than 0.01). Platelet counts did not modify. It was necessary to adjust antihypertensive therapy in a few patients because of a mild rise in blood pressure, although important adverse reactions did not occur. CONCLUSIONS: Anaemia of haemodialysis patients improves with r-HuEPO treatment and reduces blood transfusion requirement. Adverse effects are not very remarkable.

Serum erythropoietin levels in the anaemia of chronic disorders.

Serum erythropoietin (S-EPO) levels were measured in 50 patients with anaemia of chronic disorders (ACD), classified into three groups according to their aetiology: inflammatory (n = 20), infectious (n = 15) and neoplastic (n = 15). The inflammatory group showed a higher mean S-EPO level (mean value +/- SEM, 69 +/- 11 mU ml-1) than the neoplastic (43 +/- 5 mU ml-1; P less than 0.05) and infectious groups (27 +/- 4 mU ml-1; P less than 0.01). The S-EPO level in the inflammatory group also differed from that of 32 healthy controls (36 +/- 3 mU ml-1; P less than 0.05). Fourteen patients with added iron deficiency (12 subjects from the inflammatory group) showed the highest S-EPO concentration (72 +/- 17 mU ml-1). Conversely, S-EPO levels were lower in febrile subjects (12 patients with infection and five with malignancy) than in non-febrile patients (28 +/- 4 mU ml-1 vs. 55 +/- 7 mU ml-1; P less than 0.01). In the infectious group, the logarithm of S-EPO correlated directly with the haemoglobin and haematocrit values. We conclude that differences in S-EPO concentration in ACD may be further related to the patient's iron stores and temperature. A decrease in EPO production may contribute to the pathogenesis of ACD secondary to infection.

Medium term response to H-R erythropoietin in CAPD patients: the influence of erythropoietin plasmatic levels and the effects on peritoneal transport capacity.

Anemia of CRF has been corrected by use of H-R-EPO both in hemodialysis and CAPD patients. Long term response to subcutaneous EPO and its relationship with serum EPO levels remain to be established. Twenty-five CAPD patients treated with CAPD during 30 +/- 28 (mean +/- SD) months were included in this study. The follow-up period was 6-24 months. All patients have been on CAPD at least 6 months and their Hemoglobin (Hb) level was lower than 8.5 g/dl. Twelve patients received EPO by subcutaneous route, at doses of 20 u./Kg daily and 13 other patients at doses of 2000 units twice a week. Thereafter, these doses were adjusted to obtain a Hemoglobin level ranging 10.5-13 g/dl. In conclusion, our results suggest that the subcutaneous route for H-R-Erythropoietin can be considered as the best choice for CAPD patients. Low doses twice a week seem to improve anemia in 2 months. Later, dose adjustment should be done according to the patient's response. The improvement in nutritional status we observed suggests a new positive aspect for EPO therapy. Our data did not show changes in peritoneal function.

[Concentrations of serum lipids in children with Down's syndrome]. / Concentraciones de lípidos séricos en niños con síndrome de Down.

The level of blood lipids in children with Down's syndrome was determined with the purpose of establishing possible differences in total cholesterol, triglyceride and HDL-cholesterol levels with those of healthy children. LDL-cholesterol fraction was calculated. Blood samples were obtained from 66 healthy children (controls) and 72 patients who suffered from clinically diagnosed Down's syndrome. All the children were grouped according to age. The variables of body weight, height, and blood lipids gave a distribution of values that allows one to distinguish the group of children with Down's syndrome from the normal group. The values obtained for triglycerides, total cholesterol, and LDL-cholesterol ranged higher, with a constant deficit of HDL-cholesterol in all age groups. The lipid pattern encountered in the Down's syndrome patient suggests the existence of unknown, possibly genetically determined mechanisms, that provoke a disorder in lipid metabolism.