ABSTRACT
Banana (Musa acuminata) is one of the most important fruit crops in the world. In June 2020, a leaf spot disease was detected on M. acuminata (AAA Cavendish cv. Williams B6) in a commercial plantation (â¼1.2 ha), Nanning, Guangxi province, China. The disease occurred on ~30% of plants. The first symptoms were round or irregular dark brown spots on the leaf surface, which progressively expanded into large, suborbicular or irregular-shaped dark brown necrotic areas. Finally, the lesions coalesced and resulted in leaf abscission. Fragments of tissues (~5 mm) were cut from six symptomatic leaves, surface disinfected (2 min in 1% NaOCl, and rinsed three times in sterile water), and incubated on potato dextrose agar (PDA) at 28°C for 3 days. The hyphal tips from emerging colonies were transferred onto fresh PDA plates to obtain pure cultures. From the 23 isolates, 19 exhibited similar morphology. The colonies on PDA and Oatmeal agar (OA) were villose, dense, white to grey. NaOH spot test resulted in a dark green discolouration on malt extract agar (MEA) cultures. After 15 days of incubation, pycnidia were observed, which were dark, spherical or flat spherical, 67.1 to 173.1 µm (n = 64) in diameter. Conidia were oval mostly, aseptate, hyaline, guttulate, 4.1 to 6.3 × 1.6 to 2.8 µm (n = 72). Morphological features were similar to Epicoccum latusicollum (Chen et al. 2017, Qi et al. 2021). The internal transcribed spacer (ITS), the partial 28S large subunit rDNA (LSU), beta-tubulin (TUB), and RNA polymerase II second largest subunit (RPB2) genes of the three representative isolates (GX128.6.3, GX132.14.1, GX140.4.3) were amplified and sequenced using the primers ITS1/ITS4 (White et al. 1990), LR0R/LR5 (Vilgalys and Hester 1990, Rehner and Samuels 1994), TUB2-Ep-F/TUB2-Ep-R (GTTCACCTTCAAACCGGTCAATG/AAGTTGTCGGGACGGAAGAGCTG), and RPB2-Ep-F/RPB2-Ep-R (GGTCTTGTGTGCCCCGCTGAGAC/TCGGGTGACATGACAATCATGGC), respectively. The ITS (OL614830-32), LSU (OL739128-30), TUB (OL739131-33), and RPB2 (OL630965-67) sequences were 99% (478/479, 478/479, and 478/479 bp), 99% (881/882, 867/868, and 877/878 bp), 99 to 100% (332/333, 333/333, and 333/333 bp), and 100% (556/556, 559/559, and 555/555 bp) identical to those of the ex-type E. latusicollum LC5181 (KY742101, KY742255, KY742343, KY742174) (Chen et al. 2017). A phylogenetic analysis confirmed the isolates as E. latusicollum. Therefore, based on morphological and molecular data, the isolates were identified as E. latusicollum. To verify pathogenicity, healthy leaves on 1.5 months old banana plants (cv. Williams B6) were stab-wounded using a needle and inoculated with either mycelial discs (5 mm) or aliquots of 10 µl conidial suspension (106 conidia/ml). Three leaves on each of six plants were inoculated. Each leaf had four inoculation sites, two were inoculated with a representative strain, and two treated with pollution-free PDA discs or sterile water served as controls. All plants were incubated in a greenhouse at 28°C (12-h photoperiod, 80% humidity). After seven days, leaf spot appeared on the inoculated leaves. No symptoms were detected on controls. The experiments were repeated three times showed similar results. To fulfill Koch's postulates, the Epicoccum isolates were consistently re-isolated from symptomatic tissue and confirmed by morphology and sequencing. To our knowledge, this is the first report of E. latusicollum causing leaf spot on banana in China. This study may provide the basis for control of the disease.
ABSTRACT
A new benzo[e]indolium derivative 1 including pyridyl and thienyl groups was synthesized and characterized, which failed to response to Hg2+ or Cu2+ in aqueous system. However, it is interesting that when it reacted with bisulfite in HEPES buffer, the in situ generated ensemble as 1-SO3H displayed dramatic absorption and fluorescence changes after adding Cu2+ or Hg2+, which were contrary to the changes of 1 upon the addition of bisulfite ions. By contrast, the other two derivatives 2 and 3 showed the almost similar trends of spectral changes, which were short of ligating atoms N or S. The further investigation of 1HNMR spectra changes of 1 showed that C-SO3H bond may be interrupted because the good binding capacity of Hg2+ and Cu2+ with O of C-SO3H weaken the binding force of C-SO3H, which resulted in the recovery of ethylene with benzo[e]indolium block. The DFT calculations results further confirmed it.
ABSTRACT
The pH-dependent reversible cyclometallation and reactions with nitrite in a near-aqueous system of a related set of cyclometallated ruthenium(ii) bipyridyl complexes were investigated in detail. These complexes are [Ru(ppy)(bpy)2]PF6 (, bpy = 2,2'-bipyridine, Hppy = 2-phenylpyridine), [Ru(thpy)(bpy)2]PF6 (, Hthpy = 2-(2-thienyl)pyridine), and [Ru(dfppy)(bpy)2]PF6 (, Hdfppy = 2-(2,4-difluorophenyl)pyridine). As expected, reversible UV-Vis spectra of these three complexes in near-aqueous solutions can be achieved by treating with acid or base, which indicates a pH-dependent reversible cyclometallation. However, the addition of nitrite to acidic solutions of these complexes disturbed the reversible pH-dependent processes. Unexpected ruthenium complexes in the aforementioned system were then isolated and characterized using FT-IR, MS, (1)H NMR, and UV-Vis spectra, indicating that two reaction modes occurred at the ruthenium(ii) centers: (1) the insertion of NO into the ruthenium-aryl bond to form a ruthenium C-nitroso complex; and (2) the coordination of NO with the entire dissociation of one bipyridine to form a {Ru-NO}(6) complex, which is the first example involving the cleavage of Ru-N(â§)N bonds in ruthenium bipyridyl complexes.
