[Adult-onset immunodeficiency induced by anti-interferon-γ autoantibodies: report of 13 cases].

Objective: To investigate the clinical characteristics of a group of patients with adult-onset immunodeficiency (AOID) induced by anti-interferon-γ autoantibodies (AIGA). Methods: Thirteen cases of AOID in a northern China medical center (Peking Union Medical College Hospital) from October 2020 to April 2022 were included. Data comprising clinical manifestations, laboratory results, infection sites and pathogens were collected. Results: Among the 13 patients, 5 were male. The median age of disease onset was 47 (14 to 71) years. The median time from symptom onset to diagnosis was 4 years (1 to 8 years). Four patients were from northern China, and 9 from southern China. Common symptoms included lymphadenopathy (13/13), fever (12/13), respiratory tract symptoms (12/13), and weight loss (11/13). Laboratory tests showed increased levels of white blood cell count (9/13), neutrophil count and proportion (9/13), erythrocyte sedimentation rate (ESR) (12/13), and C reactive protein (CRP) (11/13). The median plasma titers of AIGA upon diagnosis were 5681(3194, 13246). Sites of infection included lungs (12/13), lymph nodes (9/13), bones and joints (9/13), skin and soft tissue (7/13), blood flow and bone marrow (4/13), and glands (3/13). Most patients had nontuberculous mycobacteria (NTM) (12/13) infection. Seven patients had more than one pathogen. Conclusions: AOID also affects patients visiting northern China hospitals. AIGA screening is recommended among patients with disseminated NTM infections or recurrent infections.

[Status of fungal sepsis among preterm infants in 25 neonatal intensive care units of tertiary hospitals in China].

Objective: To analyze the prevalence and the risk factors of fungal sepsis in 25 neonatal intensive care units (NICU) among preterm infants in China, and to provide a basis for preventive strategies of fungal sepsis. Methods: This was a second-analysis of the data from the "reduction of infection in neonatal intensive care units using the evidence-based practice for improving quality" study. The current status of fungal sepsis of the 24 731 preterm infants with the gestational age of <34+0 weeks, who were admitted to 25 participating NICU within 7 days of birth between May 2015 and April 2018 were retrospectively analyzed. These preterm infants were divided into the fungal sepsis group and the without fungal sepsis group according to whether they developed fungal sepsis to analyze the incidences and the microbiology of fungal sepsis. Chi-square test was used to compare the incidences of fungal sepsis in preterm infants with different gestational ages and birth weights and in different NICU. Multivariate Logistic regression analysis was used to study the outcomes of preterm infants with fungal sepsis, which were further compared with those of preterm infants without fungal sepsis. The 144 preterm infants in the fungal sepsis group were matched with 288 preterm infants in the non-fungal sepsis group by propensity score-matched method. Univariate and multivariate Logistic regression analysis were used to analyze the risk factors of fungal sepsis. Results: In all, 166 (0.7%) of the 24 731 preterm infants developed fungal sepsis, with the gestational age of (29.7±2.0) weeks and the birth weight of (1 300±293) g. The incidence of fungal sepsis increased with decreasing gestational age and birth weight (both P<0.001). The preterm infants with gestational age of <32 weeks accounted for 87.3% (145/166). The incidence of fungal sepsis was 1.0% (117/11 438) in very preterm infants and 2.0% (28/1 401) in extremely preterm infants, and was 1.3% (103/8 060) in very low birth weight infants and 1.7% (21/1 211) in extremely low birth weight infants, respectively. There was no fungal sepsis in 3 NICU, and the incidences in the other 22 NICU ranged from 0.7% (10/1 397) to 2.9% (21/724), with significant statistical difference (P<0.001). The pathogens were mainly Candida (150/166, 90.4%), including 59 cases of Candida albicans and 91 cases of non-Candida albicans, of which Candida parapsilosis was the most common (41 cases). Fungal sepsis was independently associated with increased risk of moderate to severe bronchopulmonary dysplasia (BPD) (adjusted OR 1.52, 95%CI 1.04-2.22, P=0.030) and severe retinopathy of prematurity (ROP) (adjusted OR 2.55, 95%CI 1.12-5.80, P=0.025). Previous broad spectrum antibiotics exposure (adjusted OR=2.50, 95%CI 1.50-4.17, P<0.001), prolonged use of central line (adjusted OR=1.05, 95%CI 1.03-1.08, P<0.001) and previous total parenteral nutrition (TPN) duration (adjusted OR=1.04, 95%CI 1.02-1.06, P<0.001) were all independently associated with increasing risk of fungal sepsis. Conclusions: Candida albicans and Candida parapsilosis are the main pathogens of fungal sepsis among preterm infants in Chinese NICU. Preterm infants with fungal sepsis are at increased risk of moderate to severe BPD and severe ROP. Previous broad spectrum antibiotics exposure, prolonged use of central line and prolonged duration of TPN will increase the risk of fungal sepsis. Ongoing initiatives are needed to reduce fungal sepsis based on these risk factors.

[Analysis of genotypes, EEG and phenotypes of tuberous sclerosis complex patients].

Objective: Tuberous sclerosis complex (TSC) is a multi-system disease with TSC1 and TSC2 genes as the pathogenic genes. The purpose of our study was to analyze the gene mutation in patients with TSC with epilepsy as the main clinical manifestation. The relationship between genotype and phenotype, scalp EEG in patients was analyzed. Methods: The peripheral blood was extracted from 43 patients and their families. TSC gene was detected by second-generation sequencing. Long-term video EEG monitoring and MRI examination were performed to determine the onset area, seizure type and location of nodules. Results: 39 patients had TSC gene mutation, 4 patients did not detect the gene mutation.11 had TSC1 mutations and 28 had TSC2 mutations. 22 mutations were de novo. Patients with TSC2 mutations had earlier seizure and more nodules than patients with TSC1 mutations, but no significant difference in intelligence and spasm were observed. 28 patients had focal origin of scalp EEG, of which 85.7% of TSC2 mutations patients had focal origin. Conclusions: Patients of TSC2 mutations always has an early onset age. Although MRI shows multiple nodules, the onset of EEG is mainly focal origin.

BLACAT1 is negatively associated with prognosis in patients with NSCLC and inhibits cell progression, metastasis and epithelial-mesenchymal transition through down-regulating Wnt/ß-catenin signaling pathway.

OBJECTIVE: To evaluate the clinical significance and molecular mechanism of bladder cancer-associated transcript 1 (BLACAT1) in non-small-cell lung cancer (NSCLC). PATIENTS AND METHODS: Overall, 156 NSCLC cancer patients were recruited and divided into high and low BLACAT1 level group by the median value of BLACAT1 expression. The associations of BLACAT1 expression with the clinicopathological features and prognosis were evaluated. A series of in vitro assays were performed to explore the role of BLACAT1 on NSCLC progression and metastasis. RESULTS: Patients with high BLACAT1 expression had shorter overall survival and progression-free survival than those with low BLACAT1 expression. Multivariate analyses showed that BLACAT1 was an independent prognostic factor of survival in NSCLC patients. In vitro assays showed that the downregulation of BLACAT1 significantly suppressed cell progression, migration, and invasion. The epithelial-mesenchymal transition was also inhibited when BLACAT1 was silenced, indicated by an increase in E-cadherin expression and a decrease in vimentin expression by mediating Wnt/ß-catenin signaling pathway. CONCLUSIONS: BLACAT1 should be a potential prognostic biomarker and therapeutic target for NSCLC.

[Retrospective study on the characteristics of early organ injury in elderly patients with severe burns].

Objective: To analyze the clinical characteristics of early organ injury in elderly patients with severe burns and the effects on the prognosis of patients. Methods: From January 2010 to August 2018, 62 patients with severe burns (43 men and 19 women, aged from 60 to 89 years at the time of admission) who were hospitalized in the Institute of Burn Research of the First Affiliated Hospital of Army Medical University (the Third Military Medical University, hereinafter referred to as the author's affiliation), meeting the inclusion criteria, were included in elderly (E) group, and 124 patients with severe burns (86 men and 38 women, aged from 18 to 59 years at the time of admission) at the same term were included in young and middle-aged (YM) group. Treatment of patients in the 2 groups followed the conventional procedures of the author's affiliation. The following data of patients in the 2 groups were retrospectively analyzed. (1) Fluid replacement volume and urine volume within the first and second post injury hour (PIH) 24 were recorded. The levels of hemoglobin, haematocrit, and blood lactic acid at admission, PIH 24 and 48 were recorded. (2) The creatine kinase isozyme-MB (CK-MB), total bilirubin, blood creatinine, oxygenation index, and blood platelet count at admission, at shock stage, and on post injury day (PID) 3 to 7 were collected. (3) The days of seriously or critically ill and deaths were recorded. Data were processed with chi-square test, group t test, Mann-Whitney U test, analysis of variance for repeated measurement, and Bonferroni correction. Results: (1) There were no statistically significant differences in fluid replacement volume within the first and second PIH 24, and urine volume within the second PIH 24 between patients in the 2 groups (t=0.351, 1.307, 1.110, P>0.05). The urine volume of patients in group E within the first PIH 24 was significantly less than that in group YM (t=5.628, P<0.05). There were no statistically significant differences in levels of hemoglobin (t=0.011, 1.075, 0.239), haematocrit (t=0, 0.033, 0.199), and blood lactic acid (t=0.017, 1.002, 0.739) at admission, PIH 24 and 48 between patients in the 2 groups (P>0.05). (2) There were no statistically significant differences in levels of CK-MB at admission and on PID 3 to 7 between patients in the 2 groups (t=0.069, 0.001, P>0.05). The level of CK-MB of patients in group E at shock stage was significantly higher than that in group YM (t=4.017, P<0.05). There were no statistically significant differences in levels of total bilirubin at admission and on PID 3 to 7 between patients in the 2 groups (t=0.227, 0.002, P>0.05). However, the level of total bilirubin of patients in group E at shock stage was significantly higher than that in group YM (t=6.485, P<0.05). The levels of blood creatinine of patients in group E at admission and shock stage were significantly higher than those in group YM (t=4.226, 12.299, P<0.05 or P<0.01), while there was no statistically significant difference between them on PID 3 to 7 (t=0.693, P>0.05). The oxygenation indexes of patients in group E at admission and shock stage and on PID 3 to 7 [(371±16), (263±16), and (228±18) mmHg (1 mmHg=0.133 kPa)] were lower than (420±13), (327±13), and (281±17) mmHg of patients in group YM, respectively (t=5.650, 9.782, 4.856, P<0.05 or P<0.01). There were no statistically significant differences in levels of blood platelet count at admission and shock stage between patients in the 2 groups (t=0.038, 0.588, P>0.05), while the level of blood platelet count of patients in group E on PID 3 to 7 was significantly lower than that in group YM (t=6.636, P<0.05). (3) The days of seriously or critically ill and death rate of patients in group E were respectively longer or higher than those in group YM (Z=-2.303, χ(2)=13.676, P<0.05 or P<0.01). Conclusions: In the case of the same tissue perfusion at shock stage, injuries in heart, liver, kidney, lung, and coagulation system in elderly patients with severe burns are more obvious than those in young and middle-aged patients, with more severe illness and higher mortality.

Efficacy and safety of magnetic guided capsule gastroscopy in gastric diseases.

The current mainstay of screening and diagnosis for gastric diseases is conventional standard gastroscopy. However, it is invasive and uncomfortable procedure for the patients especially in case of non-sedative procedures and other adverse effects related to conscious sedation anesthesia. Recently, a magnetic guided capsule gastroscopy (MGCG) was introduced to overcome these challenges. It is a safe and pleasant procedure with no involvement of sedation and no risks of cross-infection between patients. In addition, this method is anticipated to be an alternative tool for screening and diagnosis of gastric diseases with similar gastric visualization as one achieved through standard gastroscopy. In this narrative review, we focused on the recent advances in MGCG including technical issues, ideal gastric preparation, indications and contraindications, available evidences regarding the use of magnetic guided capsule gastroscopy in clinical practice and highlighted further technical advancements which are needed to make MGCG as a potential diagnostic tool. After reviewing the literature, we concluded that the magnetic guided capsule gastroscopy is a safe tool and would be a promising alternative examination equipment for gastric diseases.

[The application of stereo-electroencephalography guided radiofrequency thermocoagulation in refractory temporal epilepsy].

Objective: To investigate the clinical value of stereo-electroencephalography guided radiofrequency thermos-coagulation (RFTC) in drug resistant temporal epilepsy. Methods: The clinical data of 12 patients with refractory temporal epilepsy who underwent implantation of SEEG electrodes and radiofrequency thermos-coagulation from July 2016 to November 2017 were analysed retrospectively. Results: The mean follow-up time was 6.4±4.6 months after thermos-coagulation, and 10.2±3.5 months after resection. Engel Ⅰa was observed in 9 cases, with Ⅱa, Ⅲa and Ⅳa 1 cases respectively. Nine patients experienced a ≥50% decrease of seizure frequency after RFTC (R+ , 75%), of whom one had got a sustained seizure free for 15 months and the other with decrease of seizure frequency by over 90% for 14 months. There was a statistical significance in seizure frequency between pre- and post-thermo-coagulation (P=0.008). Ten cases underwent open surgery following SEEG-guided RFTC, of them 8 cases got seizure free. RFTC was effective in 6 of 8 cases. In our group, all patients have not suffered from any neurologic and cognitive deficiency, and even several patients have some improvements on memory quotient. Conclusions: Although it is less effective than resective surgery, SEEG-guided RFTC can be a relatively safe, effective treatment because of its precision and minimal invasion for patients with complex drug resistant temporal epilepsy, especially for impossible any cortical resection. In addition, its effect may be a predictor of outcome after conventional cortectomy.

Vitamin A pretreatment protects NO-induced bovine mammary epithelial cells from oxidative stress by modulating Nrf2 and NF-κB signaling pathways.

It is known that physiological overproduction of nitric oxide (NO) contributes to oxidative stress and inflammation. Our published studies indicated that vitamin A (VA) reduces NO-induced oxidative stress in bovine mammary epithelial cells (BMECs) by increasing antioxidant enzyme activities. However, the precise mechanism is unclear. The present study was conducted to examine the protective effects of VA on NO-induced damage to BMECs in vitro using diethylenetriamine nitric oxide (DETA-NO) as the NO donor and to explore the intracellular signaling mechanisms of VA that involve nuclear factor erythroid 2-related factor (Nrf2) and nuclear factor kappa-B (NF-κB). Subconfluent BMECs were divided into 10 treatment groups with 6 replicates per treatment and were cultured with dimethyl sulfoxide (DMSO, vehicle negative control) or 0, 0.05, 0.1, 0.2, 0.5, 1, 2, 3, or 4 µg/mL of VA for 24 h and then incubated in the absence or presence of DETA-NO (1,000 µmol/liter) and VA for an additional 6 h. The results showed that exposure to DETA alone decreased cell proliferation compared with the negative control. Pretreatment with VA promoted the proliferation of BMECs, increased the activities of antioxidative enzymes including selenoprotein glutathione peroxidase (GPx) and thioredoxin reductase (TrxR) and their gene and protein expression but decreased NO and interleukin 1 (IL-1) contents in a quadratic manner (P < 0.05). In addition, the expression of mRNA and protein of factors that are related to NF-κB or Nrf2 signaling pathways in BMECs were regulated by VA in a quadratic dose-dependent manner; VA at a concentration of 1 µg/mL exhibited the strongest effect. Together, these results suggest that VA promotes antioxidant functions of BMECs by regulating the synthesis of selenoproteins including GPx and TrxR and by reducing concentrations of IL-1 and NO in vitro by modulating Nrf2 and NF-κB signaling pathways.

[The associations between adenosine triphosphate binding cassette subfamily G member-2 single nucleotide polymorphism and hyperuricemia in a Chinese tertiary hospital faculty cohort].

Objective: To investigate gender specific association between single nucleotide polymorphism rs2231142 and hyperuricemia. Method: A matched case-control study was conducted in a faculty cohort of a tertiary hospital in Beijing. The enrollment criteria were faculty member of the hospital with signed consent. The exclusion criteria were tumor, previous renal diseases, renal function damage, pregnancy, currently taking medicines that could increase or decrease serum uric acid level, and those who had gout. Males with serum uric acid>416.4 µmol/L and females with serum uric acid> 359.6 µmol/L were enrolled as hyperuricemia group. Subjects with normal serum uric acid were randomly enrolled at 1∶2 ratio after matching for gender, age, renal function and body mass index. Rs2231142(C>A) was assayed by amplification refractory mutation system polymerase chain reaction, with common forward primer: 5' GGCTTTGCAGACATCTATGG 3', C specific reverse primer: 5'CGAAGAGCTGCTGAGAAATG 3', and A specific reverse primer: 5' CGAAGAGCTGCTGAGAAATT 3'.Association between rs2231142 and hyperuricemia was analyzed in the general study group, as well as different gender and age groups. Results: A total of 198 subjects with hyperuricemia and 370 controls were enrolled. The A allele frequency of rs2231142 was significantly higher in the hyperuricemia group than control group (38.38% vs 26.62%, P<0.001), with an OR for hyperuricemia of 2.89 (95%CI 1.91-4.37, P<0.001). After adjustment for hypertension, hyperglycemia and dyslipidemia, the OR was 2.99 (95%CI 1.94 - 4.62, P<0.001). Subgroup analysis showed that the ORs were 3.83 (95%CI 2.03-7.24, P<0.001) in male and 2.30 (95%CI 1.32-4.00, P=0.003) in female. In those 55 years or older, the gender differences of ORs were decreased, with ORs of 3.23 (95%CI 1.02-10.29, P=0.047) in male and 3.06 (95%CI 1.37-6.84, P=0.006) in female. While in those less than 55 years, the gender differences of ORs were enlarged, with ORs of 4.11 (95%CI 1.92-8.79, P<0.001) in males and 1.73 (95%CI 0.80-3.76, P=0.165) in females. Interaction study between gender and rs2231142 did not reach significant level in both the gender group and two age groups. Conclusion: Single nucleotide polymorphism rs2231142 A allele is an independent risk factor for hyperuricemia in this tertiary hospital faculty cohort. The ORs are higher in male than those in female, especially in those less than 55 years old.

[Regulatory effect of faciogenital dysplasia 6 gene on hepatic stem cell differentiation].

Objective: To investigate the regulatory effect of faciogenital dysplasia 6 (FGD6) gene on hepatic stem cell differentiation. Methods: FGD6 gene was selected for the co-intervention of target sequence, the AdEasy system was used for the construction of adenovirus vector and the packaging and multiplication of the recombinant adenovirus vector pSES-FGD6-siRNA, and the HP14.5 cells were infected. Immunofluorescence assay was used to measure the expression of FGD6 protein in HP14.5 cells, quantitative real-time PCR was used to measure the mRNA expression of FGD6, alpha-fetoprotein (AFP), and albumin (Alb), and Western blot was used to measure the protein expression of FGD6, AFP, and Alb. The empty pSES-Ad-RFP adenovirus vector was constructed as control in each group. All data were expressed as x±s, and a one-way analysis of variance was performed. Results: FGD6 protein was mainly expressed in the nucleus of HP14.5 cells. The pSES-FGD6-siRNA adenovirus vector was successfully constructed and it downregulated the expression of FGD6 gene and the mRNA and protein expression of AFP in HP14.5 cells and upregulated the mRNA and protein expression of Alb (P < 0.01). Conclusion: The inhibition of the expression of FGD6 gene in HP14.5 cells may differentiate HP14.5 cells into hepatocytes. Therefore, FGD6 gene plays an important role in the differentiation regulation of hepatic stem cells.

[Research advances in diagnosis and treatment of post-transjugular intrahepatic portosystemic shunt hepatic encephalopathy].

Transjugular intrahepatic portosystemic shunt (TIPS) has become an important minimally invasive interventional technique for the treatment of complications of cirrhotic portal hypertension, and currently, it is often used in cirrhotic patients with esophagogastric variceal bleeding (EVB), intractable ascites, hepatic hydrothorax, and Budd-Chiari syndrome. On one hand, TIPS can effectively reduce portal vein pressure and the risk of EVB and intractable ascites; on the other hand, it may reduce the blood flow in liver perfusion, aggravate liver impairment, and cause porto-systemic encephalopathy. Related influencing factors should be evaluated comprehensively in order to prevent the development of post-TIPS hepatic encephalopathy. The diagnosis and treatment of post-TIPS hepatic encephalopathy is still a great challenge in current clinical practice. This article reviews the diagnosis and treatment of post-TIPS hepatic encephalopathy to enhance people's knowledge of this disease.

[Functional mapping of the insular and opercular cortex: A study using SEEG electrical stimulation in epileptic patients].

OBJECTIVE: Insular and opercular cortex is involved in complicated physiological function.Insular seizures involve extensive epileptic network, which results in the complex and diverse semiology.Electrical cortical stimulation(ECS) can explore the functional mapping and symptomatogenic zone. METHODS: The clinical presurgical evaluation and ECS data of 20 patients whose electrode contacts were located in the insular and opercular were analyzed retrospectively.CT scan/3D MRI data fusion was performed in order to accurately identify and locate each contact and check the electrode trajectory by the MRI images performed after the electrodes were removed.ECS was applied between two contiguous contacts.Stimulation usually lasted for 5 s at 50 Hz(pulse width=0.3 ms). Depending on the area of stimulated cortex, the stimulation intensities ranged from 0.2 to 3.0 mA.The classification of the insular were anterior short gyrus, middle short gyrus, precentral gyrus, postcentral gyrus, posterior long gyrus and insular pole.The classification of the opercular were orbital, frontal, precentral, central, parietal and temporal opercular. RESULTS: One hundred and six contacts were located in the insular and 51 responses were evoked (48.11%). Four hundred eighteen contacts were located in the insular and 132 responses were evoked (31.58%). We classified the principal responses as somatosensory, pain, auditory, oropharyngeal, speech disturbances and neurovegetative response.Somatosensory responses were mainly evoked in parietal opercular and postcentral gyrus, while pain response distributed sporadically.Auditory were only evoked in temporal opercular(transverse temporal gyri) and posterior long gyrus.Oropharyngeal symptoms were only evoked in central opercular.Speech disturbances were located in precentral and central opercular and neurovegetative responses were mainly evoked in insular pole and middle short gyrus. CONCLUSIONS: These findings may indicate a functional specificity for the insular gyrus and opercular, which contribute to the understanding of anatomo-functional organization and the role in insular and opercular epileptic network.Moreover, it could optimize the implantation strategy for exploring these structures.

The role of molecular margins as prognostic factors in laryngeal carcinoma in Chinese patients.

CONCLUSION: Molecular margins were a more important prognostic factor in laryngeal carcinoma in Chinese patients than histopathological margins. eIF4E was the most sensitive molecular index of those that we tested for in these patients. OBJECTIVES: Safe surgical margins are closely related to prognosis. The aim of the present study was to investigate the role of molecular margins, not traditional histopathological margins, as prognostic factors in laryngeal carcinoma in Chinese patients. An additional aim of the study was to investigate the prognostic significance of tumor markers in the primary site of laryngeal carcinoma. METHODS: From January 1992 to January 2000, the data for 321 Chinese patients with laryngeal carcinoma who were divided into a recurrent laryngeal carcinoma group and a non-recurrent group were analyzed. Tumor markers in surgical margins and primary site, such as cyclin D1, p53, and eIF4E, were detected in the two groups with immunohistochemical staining. RESULTS: There was a significant difference in the expression of cyclin D1, p53, and eIF4E in surgical margins between the recurrent laryngeal carcinoma group and the non-recurrent group. The eIF4E-positive rate in surgical margins was higher than that for the other two factors. There was a significant difference in cyclin D1 and p53 in the primary site of laryngeal carcinoma and no significant difference in eIF4E in the two groups.

Insulin-like growth factor binding protein 5 suppresses tumor growth and metastasis of human osteosarcoma.

Osteosarcoma (OS) is the most common primary malignancy of bone. There is a critical need to identify the events that lead to the poorly understood mechanism of OS development and metastasis. The goal of this investigation is to identify and characterize a novel marker of OS progression. We have established and characterized a highly metastatic OS subline that is derived from the less metastatic human MG63 line through serial passages in nude mice via intratibial injections. Microarray analysis of the parental MG63, the highly metastatic MG63.2 subline, as well as the corresponding primary tumors and pulmonary metastases revealed insulin-like growth factor binding protein 5 (IGFBP5) to be one of the significantly downregulated genes in the metastatic subline. Confirmatory quantitative RT-PCR on 20 genes of interest demonstrated IGFBP5 to be the most differentially expressed and was therefore chosen to be one of the genes for further investigation. Adenoviral mediated overexpression and knockdown of IGFBP5 in the MG63 and MG63.2 cell lines, as well as other OS lines (143B and MNNG/HOS) that are independent of our MG63 lines, were employed to examine the role of IGFBP5. We found that overexpression of IGFBP5 inhibited in vitro cell proliferation, migration and invasion of OS cells. Additionally, IGFBP5 overexpression promoted apoptosis and cell cycle arrest in the G1 phase. In an orthotopic xenograft animal model, overexpression of IGFBP5 inhibited OS tumor growth and pulmonary metastases. Conversely, siRNA-mediated knockdown of IGFBP5 promoted OS tumor growth and pulmonary metastases in vivo. Immunohistochemical staining of patient-matched primary and metastatic OS samples demonstrated decreased IGFBP5 expression in the metastases. These results suggest 1) a role for IGFBP5 as a novel marker that has an important role in the pathogenesis of OS, and 2) that the loss of IGFBP5 function may contribute to more metastatic phenotypes in OS.

Antigens containing TAVSPTTLR tandem repeats could be used in assaying antibodies to Classical swine fever virus.

Classical swine fever virus (CSFV) causes a highly contagious and often fatal viral disease in pigs. The highly conserved epitope TAVSPTTLR on the glycoprotein E2 was shown to be suitable for differentiation of CSFV from other pestiviruses. In this study, we found that swine CSFV antisera contained TAVSPTTLR-related rather than TAVSPTTLR-specific CSFV antibodies. The CSFV antisera reacted only to some extent with a synthetic TAVSPTTLR-containing peptide, but inhibited the binding of TAVSPTTLR-specific antibodies to the viral antigen. Since chimeric antigens containing TAVSPTTLR tetramers or hexamers were recognized by the swine CSFV antisera, such antigens could be potentially applied to the detection of CSFV antibodies. These results might be helpful in designing a TAVSPTTLR epitope-based CSFV vaccine and a corresponding serological test.